translation of a drop through a quiescent fluid at low re
Báo cáo y học: "Expression of a protein involved in bone resorption, Dkk1, is activated by HTLV-1 bZIP factor through its activation domain" potx
... 5′-ACCAGTCGCCTTGTACACAGTCTC; HBZ-S1-F, 5′- TTAAACTTACCTAGACGGCGGACG; HBZ-S1-R, 5′-GCATGACACAGG CAAGCATCGAAA; ACTB-F, 5′-ACCAACTGGGACGACATGGAGAAA; ACTBR, 5′-TAGCACAGCCTGGATAGCAACGTA The DKK1b primer pair was ... DKK1-1854R, 5′-CACCACCAAGTAAAGCCAGTGACA; DKK1-991F, 5′-CATTCGGAAGCGTTGCGATGTGAT; DKK1-991R, 5′-ACTTGATTAGGCAGACGCGTGAGA; DKK1-331F, 5′-ACTTGTGTGCACAGTCAGCGAGTA; DKK1-331R, 5′-TTAATAAATGCAGGCGGCAGCAGG; DKK1 ... spliced and polyadenylated Retrovirology 2006, 3:15 59 Murata K, Hayashibara T, Sugahara K, Uemura A, Yamaguchi T, Harasawa H, Hasegawa H, Tsuruda K, Okazaki T, Koji T, Miyanishi T, Yamada Y, Kamihira...
- 16
- 460
- 0
Tài liệu Báo cáo khoa học: Crystal structures of a bacterial 6-phosphogluconate dehydrogenase reveal aspects of specificity, mechanism and mode of inhibition by analogues of high-energy reaction intermediates pdf
... preliminary crystal characterization at the European Synchrotron Radiation Facility, Grenoble References Barrett MP (1997) The pentose phosphate pathway and parasitic protozoa Parasitol Today ... the accessible surface area of a monomer contributes to LlPDH dimer formation Whereas LlPDH and OaPDH have a ˚ buried surface area of 5500 A2 , TbPDH has a larger ˚ interface surface area of ... Sundaramoorthy et al catalytic residue Glu191 and with Asn188 This interaction of C2-OH with Glu191 is essential, because the tautomerization step of the catalytic reaction requires a general acid...
- 12
- 452
- 0
Tài liệu Báo cáo khoa học: Local stability identification and the role of a key aromatic amino acid residue in staphylococcal nuclease refolding pdf
... conformation of denatured proteins Here we show that a specific single mutation or removal of a specific fragment can cause large changes in the native state of SNase Fig Steady-state fluorescent spectra of ... W14 0A at 295 nm had a similar spectrum to that of the wild-type protein, but W140O did not (h 0) This may indicate that the aromatic F or Y in the W14 0A mutant are more ordered and compact than ... have been performed previously Parker et al [18] showed that the apparent association constant of SNase(1–126) bound to pdTp in the presence of Ca2+ is approximately threefold lower than that...
- 7
- 551
- 0
Mobilizing Climate Finance - A Paper prepared at the request of G20 Finance Ministers potx
... figure relates to mitigation (and related capacity building) only; first data on adaptation, relating to 2010 flows, will become available at the end of 2011 In future, OECD-DAC data on climate ... Outlook database, April 2011 34 Box 5: Bilateral Support for Action on Climate Change OECD-DAC estimates that bilateral official development assistance (ODA) for mitigation-related activities averaged ... Copenhagen -Low scenario This assumes, in addition, expanded regional initiatives in the U.S and Canada and the adoption of national mitigation targets in Japan, Australia and New Zealand, resulting...
- 56
- 494
- 0
Báo cáo khoa học: Crystal structure and enzymatic properties of a bacterial family 19 chitinase reveal differences from plant enzymes pdf
... dimensions a ¼ 48.67 A, b ¼ 74.38 A, c ¼ 64.18 A and ˚ resolution b ¼ 108.6°, and diffracted to at least 1.5 A Crystal data and data collection statistics are summarized in Table Calculation of the Matthews ... picture The pictures were made with PYMOL [47] able sequences, some bacterial family 19 chitinases have catalytic domains that are at least as large as those of the plant enzymes and that may contain ... the reaction, and stored at ) 20 °C until they were analyzed by HPLC at room temperature All reactions were analyzed in triplicate HPLC analysis of 20 lL portions of the stored reaction mixtures...
- 12
- 399
- 0
Báo cáo khoa học: Structure of the complex of a yeast glucoamylase with acarbose reveals the presence of a raw starch binding site on the catalytic domain doc
... TGGATGCTATTAATGATGATGGCTC-3¢), GLU H44 7A reverse (5¢- GAGCCATCATCATTAATAGCATCCAAAA TGACTTGC-3¢); GLU T46 2A forward (5¢- GAACAACTT AACAGATATGCCGGTTATTCCACCGGTGCC-3¢), GLU T46 2A reverse (5¢- GGCACCGGTGGAATAACCGGCA ... were used: GLU R1 5A forward (5¢-ATTCAAACTATAAAGTTGACGCAA CTGACTTGGAAACCTTC-3¢), GLU R1 5A reverse (5¢GAAGGTTTCCAAGTCAGTTGCGTCAACTTTATAGTT TGAAT-3¢); GLU H44 7A forward (5¢- GCAAGTCATTT TGGATGCTATTAATGATGATGGCTC-3¢), ... Journal compilation ª 2006 FEBS 2167 ˇ ˇı J Sevc´k et al Glucoamylase raw starch binding site reverse (5¢-GTTCATTCAAGGAGCCATCAGCATTAAT AGCATCCAAAATGACTTGC-3¢) All mutations were verified by DNA sequencing...
- 11
- 548
- 0
Báo cáo khoa học: Proper targeting and activity of a nonfunctioning thyroid-stimulating hormone receptor (TSHr) combining an inactivating and activating TSHr mutation in one receptor pptx
... and measured using the standard optics of the FACSort The CELLQUEST software program (Becton Dickinson and Co.) was used to acquire and analyze data A minimum of at least 10 000 cells was analyzed ... pathway suggesting that different activating mutations result in receptor conformations with different relative abilities to stimulate the cAMP or IP regulatory cascades Surprisingly the combination ... described as an inactivating mutation in a patient with congenital hypothyroidism and thyroid hypoplasia [16] Similarly, an inactivating mutation of the FSH receptor gene that is located in the...
- 9
- 499
- 0
Báo cáo khoa học: Factors involved in the assembly of a functional molybdopyranopterin center in recombinant Comamonas acidovorans xanthine dehydrogenase pot
... maximum at 430–440 nm and two negative bands with maxima at 370–380 nm and at 560–570 nm Similar CD spectra were obtained for purified preparations of XDHAB (grown at low aeration) and with XDHABC ... (low aeration) and XDHABC preparations All spectra were calculated as an average of four or five scans to reduce the signal-to-noise ratio The xanthine reduced spectrum for XDHAB was very weak ... that high aeration was achieved at LÆmin)1 and low aeration at LÆmin)1 airflow in a 10 L BIOFLO 3000 bioreactor (New Brunswick Scientific) catalytic activity were pooled and applied directly to a...
- 11
- 584
- 0
Báo cáo khoa học: Substrate specificity of the human UDP-glucuronosyltransferase UGT2B4 and UGT2B7 Identification of a critical aromatic amino acid residue at position 33 doc
... CTGGTGTGGCCCACAGAATACAGCCACTGGATGAATATAAAG CTTTATATTCATCCAGTGGCTGTATTCTGTGGGCCACACCAG CTGGTGTGGGCAGCAGAACTCAGCCATTGGATGAATATAAAG CTTTATATTCATCCAATGGCTGAGTTCTGCTGCCCACACCAG CTGGTGTGGGCAGCAGAATACAGCCATTGGATGAATATAAAG ... Mutant Primer Sequence (5’- to 3’) 2B4F33 L Sense Antisense Sense Antisense Sense Antisense Sense Antisense CTGGTGTGGCCCACAGAACTCAGCCACTGGATGAATATAAAG CTTTATATTCATCCAGTGGCTGAGTTCTGTGGGCCACACCAG ... CTGGTGTGGGCAGCAGAATACAGCCATTGGATGAATATAAAG CTTTATATTCATCCAATGGCTGTATTCTGCTGCCCACACCAG 2B4F33Y 2B7Y33 L 2B7Y33F 1262 FEBS Journal 274 (2007) 1256–1264 ª 2007 The Authors Journal compilation ª 2007 FEBS L Barre et al (70...
- 9
- 343
- 0
Breast Cancer In Younger Women - Proceedings Of A Conference Held At The National Institutes Of Health, Bethesda, Maryland, January 28, 1993 pot
... Ecuador El Salvador Granada Guatemala Guyana Haití Honduras Jamaica México Nicaragua Panamá Paraguay Perú República Dominicana Saint Kitts y Nevis San Vicente y las Granadinas Santa Luc a Surinam ... PAÍSES INDUSTRIALIZADOS Alemania Andorra Australia Austria Bélgica Canadá Chipre Dinamarca Eslovaquia Eslovenia Espa a Estados Unidos Estonia Finlandia Francia Grecia Hungr a Irlanda Islandia ... sistemas no dan abasto debido al SIDA y a la mortalidad asociada esta enfermedad En última instancia, aunque las causas de la mortalidad materna y de las lesiones y discapacidades relacionadas el...
- 48
- 417
- 0
báo cáo hóa học: " Validation of a short form Wisconsin Upper Respiratory Symptom Survey (WURSS-21)" pdf
... strengths, there are of course limitations The original item-generation procedures may have failed to include representation of cold-related symptoms or functional impairments that are important ... Potthoff RF, Tudor GE, Pieper KS, Hasselblad V: Can one assess whether missing data are missing at random in medical studies? Stat Methods Med Res 2006, 15:213-234 Agresti A: Categorical Data Analysis ... incidence approximating to colds per year in children and to per year among adults [5-7] Incidence rates of viral respiratory infection are higher than clinical colds, as many infections are asymptomatic...
- 20
- 454
- 0
báo cáo hóa học: " Development and validation of a French patient-based health-related quality of life instrument in kidney transplant: the ReTransQoL" pot
... C, Navascués RA, Naves M, Ure a A, Bad a X, Alvarez-Ude F, Alvarez-Grande J: Health related quality of life (HRQOL) of kidney transplanted patients : variables that influence it Clin Transplant ... Fujisawa M, Ichikawa Y, Yoshiya K, Isotani S, Higuchi A, Nagano S, Arakawa S, Hamami G, Matsumoto O, Kamidono S: Assessment of health-related quality of life in renal transplant and hemodialysis ... the statistical analysis BD and VM: participated in the design of the study, collected medical data and participated to the interpretation of data RS et YB revised the manuscript critically for...
- 12
- 520
- 0
báo cáo hóa học:" Use of a novel cell-based fusion reporter assay to explore the host range of human respiratory syncytial virus F protein" ppt
... Indianapolis, IN) Lysates were spun for 30 minutes at 4°C to remove insoluble material and immunoprecipitated by incubation with a saturating amount (as determined by prior titration) of a cocktail ... (pGL3-control), and relative luciferase activity was measured To account for potential differences in host cell transcription factors that mediate activation of the reporter plasmid, the assay was flipped and ... non-essential amino acids, 1.0 mM sodium pyruvate and 10% heat-inactivated, gamma-irradiated fetal bovine serum (FBS) (HyClone Laboratories, Salt Lake City, Utah) AK-D cells (CCL-150) were maintained...
- 12
- 541
- 0
báo cáo hóa học:" Validation of a short form Wisconsin Upper Respiratory Symptom Survey (WURSS-21)" pot
... strengths, there are of course limitations The original item-generation procedures may have failed to include representation of cold-related symptoms or functional impairments that are important ... Potthoff RF, Tudor GE, Pieper KS, Hasselblad V: Can one assess whether missing data are missing at random in medical studies? Stat Methods Med Res 2006, 15:213-234 Agresti A: Categorical Data Analysis ... incidence approximating to colds per year in children and to per year among adults [5-7] Incidence rates of viral respiratory infection are higher than clinical colds, as many infections are asymptomatic...
- 20
- 497
- 0
Báo cáo hóa học: " The Influence of a Continuum Background on Carrier Relaxation in InAs/InGaAs Quantum Dot" ppt
... Therefore our observation indicates that the intra-dot relaxation is slower than the direct carrier capture for high power density excitation Such a fast relaxation probably occurs through a finite ... have found that the higher energy states of the QDs don’t act as intermediate stages in the carrier relaxation, while the carriers can cool down to any lower energy states following a relaxation ... the ground state For excitation levels below that required for ground-state filling, the ground-state emission, as expected, increases linearly with excitation and it finally saturates At higher power...
- 3
- 290
- 0
Báo cáo hóa học: " Analysis of a Combined Antenna Arrays and Reverse-Link Synchronous DS-CDMA System over Multipath Rician Fading Channels" doc
... performance of an improved AA, in which RLSTT is incorporated to effectively make better an estimation of covariance matrices at a beamformer-RAKE receiver through the analysis of the scenario of a ... Information and Communication’s technology fund and a Director of Accreditation Board for Engineering Education of Korea Currently, he serves as a Member of Korea Communications Commission, a Project ... improved AA, in which RLSTT is incorporated to effectively make better an estimation of covariance matrices at a beamformer-RAKE receiver The results show that the addition of an unfaded specular component...
- 10
- 236
- 0
Design and development of a medical parallel robotfor cardiopulmonary resuscitation
... medical aspects, a 3-PUU translational parallel manipulator was chosen and designed to satisfy the specific requirement The kinematic analysis was performed and the manipulatorreachable workspace ... Hence, translational parallel manipulators (TPMs) with only three translational DOF in space are sufficient to be employed in CPR operation Because in addition to a translation, vertical to the ... components of the manipulator not bear any load of the actuators This enables large powerful actuators to drive relatively small structures, facilitating the design of the manipulator with faster,...
- 9
- 472
- 0
Báo cáo lâm nghiệp: "Results of a phenological study of the tree layer of a mixed stand in the region of the Drahanská vrchovina Upland" ppt
... 150 100 50 Year average annual air temperature air temperature in the growing season annual precipitation percipitation Fig 10 Average annual air temperatures and annual precipitation in 1990–2007 ... Phenological data are a certain expression of the climate character of a given region Thus, they can contribute to assess the variability of weather and also to evaluate the impacts of potential climatic ... the assessed stand, the amount of precipitation, air temperature and radiation were monitored in the open area To evaluate phenological data for the characterized period, arithmetic mean, maximum...
- 12
- 386
- 0
Báo cáo y học: " Predictive validity of a brief antiretroviral adherence index: Retrospective cohort analysis under conditions of repetitive administration" docx
... temporally matched represent truly missing observations is debatable since the very nature of the data accrual process in clinical care did not require temporal matching of adherence and viral load ... of adherence measurement was related to adherence scores such that longer intervals between measurements were associated with better or poorer adherence, we calculated rates of adherence measurement ... Adjusted hazard ratios (HR) less than are interpretable as indicating longer time to achieving viral suppression relative to the reference category As anticipated, treatment experienced patients and...
- 10
- 204
- 0
Báo cáo y học: "The role of a pseudocapsula in thymic epithelial tumors: outcome and correlation with established prognostic parameters. Results of a 20-year single centre retrospective analysis" pptx
... analysis of cancer-related survival in the total populationa Risk factor Multivariate analysisc Univariate analysis p valueb R-status Masaoka stagingd Presence of a pseudocapsula WHOd classificatione ... classification, R-status, encapsulated or non-encapsulated thymoma as well as the N- and M-status and local recurrence was statistically reviewed Local recurrence for patients with a performed R0-resection ... of a pseudocapsula Joint-effects were analysed by Cox-Regression and independence was found for resection state and Masaoka (Table 4) An increased risk for increased cancer-related death of almost...
- 10
- 355
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25