the factor of safety as a design variable

... of the Man of Letters as a Man of The Man of Letters as a Man of Business, by Business, I shall attract far more readers than I should in writing of him as an Artist Besides, as an artist he has ... often a lasting death An interesting proof of the value of the magazine to literature is the fact that a good novel will have wider acceptance as a book from having been a magazine serial I am ... sure that the case is in every way improved for young authors The magazines all maintain a staff for the careful examination of manuscripts, but as most of the material they print has been engaged,...

Ngày tải lên: 17/02/2014, 19:20

... of the Man of Letters as a Man of Business, I shall attract far more readers than I should in writing of him as an Artist Besides, as an artist he has been done a great deal already; and a commercial ... always a danger that the reigning favorite may fail to please; that at any rate, in the order of things, he is passing away, and that if the magazine is not to pass away with the men who have made ... I am not sure that the case is in every way improved for young authors The magazines all maintain a staff for the careful examination of manuscripts, but as most of the material they print has...

Ngày tải lên: 28/06/2014, 17:21

... I am not sure that the case is in every way improved for young authors The magazines all maintain a staff for the careful examination of manuscripts, but as most of the material they print has ... living—when they can get the work Their incomes are mainly from serial publication in the different magazines; and the prosperity of the magazines has given a whole class existence which, as a class, was ... right along," as the English boys at Oxford made an American collegian say in a theme which they imagined for him in his national parlance; and the man of letters, as an artist, is apt to have...

Ngày tải lên: 28/06/2014, 17:21

... deal of attention to stable balance of payments situations The main aim of this paper is to examine the monetary approach to the balance of payments (MABP), which argues that the balance of payments ... whether the series are stationary Table above summarizes the results for all the variables The results show that all the variables are non-stationary at levels since the calculated tau values are ... 1972 The monetary approach to balance of payments theory Journal of financial and quantitative analysis, 7:1555–1572 Laffer, AB 1969 The US balance of payments – A financial center view Law and...

Ngày tải lên: 13/07/2014, 21:13

... that ketamine was the cause of the patient's complaints, as the timing of the onset of symptoms correlated strongly with the commencement of ketamine use In addition, the evidence shows our case ... consent was obtained from the patient for publication of this case report and any accompanying images A copy of the written consent is available for review by the Editor-in-Chief of this journal Table ... urine analysis and urine cytology were negative and a urine culture was sterile An ultrasound examination revealed a thickened bladder wall and a small bladder capacity but normal kidneys Cystoscopy...

Ngày tải lên: 11/08/2014, 21:22

... effort has been taken to verify the accuracy of this information, neither The Economist Intelligence Unit Ltd nor the sponsor of this report can accept any responsibility or liability for reliance ... “Boardroom risk in a changing economic climate—Executive Summary”; 《经 济学人》会议，2015年9月2日 http://www.goldmansachs.com/gsam/glm/insights/market-insights/china-bondmarket/china-bond-market.pdf © The ... 1301 Cityplaza Four 12 Taikoo Wan Road Taikoo Shing Hong Kong Tel: (852) 2585 3888 Fax: (852) 2802 7638 E-mail: hongkong@eiu.com Geneva Boulevard des Tranchées 16 1206 Geneva Switzerland Tel: (41)...

Ngày tải lên: 06/12/2015, 23:04

... Tools Data Access Data Storage Security After completing the above steps, you will discuss your responses with the class The instructor will write the class consensus on a flipchart THIS PAGE INTENTIONALLY ... Determining the Impact of Technology on a Windows DNA Design 51 Write your answers in the table below User Interface User Services Business Services Data Access Data Store Communication Operating Systems ... Activity 7.2: Determining the Impact of Technology on a Windows DNA Design Exercise 1: Determining Technology Implications ! Determine technology implications Participate in small groups as assigned...

Ngày tải lên: 21/12/2013, 06:16

... plot analysis of AP1 (m), the known anionic a- AMP, maximin H5 (d), and peptides of the a- AMP dataset (http://www.uclan.ac.uk/biology/bru/amp_data.htm), all as described in the text AP1, maximin ... Council, Ottawa, Ontario, Canada The band shapes of the single components are superpositions of Gaussian and Lorentzian band shapes Best ts were obtained by assuming a Gauss fraction of 0.550.6 The curfit ... AP1 (GEQGALAQFGEWL), as a potential anionic a- AMP against Escherichia coli The sequence of AP1 was designed to form a membrane-interactive oblique orientated a- helix, shown here by theoretical...

Ngày tải lên: 07/03/2014, 12:20

... were dried and autoradiographed Competitor DNAs used in EMSA analysis were: NF1 wt, 5¢-TTTTG GATTGAAGCCAATATGATA-3¢; NF1 mut, 5¢-TTTT GGATTGAATAAAATATGATA-3¢; Site-2 wt, 5¢-GCGT CTCACCCTAGTCCTGGTCCTGCTCCAAGGGTTTT ... activities were measured as described [17] DNase I protection assay Rat liver and HeLa nuclear extracts were prepared as described previously [18,19] The DNase I protection assay was performed as described ... binding activity in all fractions was monitored by the in vitro DNase I protection assay The DNA affinity column, used as the last step in the purification, was prepared with an oligonucleotide containing...

Ngày tải lên: 07/03/2014, 15:20

... In all cases, the optimal amount of arachidonic acid was determined and used to analyze the effect of S10 0A8 /A9 on oxidase activation After an incubation of 10 at 20 °C, the oxidase activity was ... an optimal amount of arachidonic acid determined for each assay of oxidase activation [12] The rate of O2– production by the activated NADPH oxidase was calculated from the rate of the superoxide ... NADPH oxidase activity was also assayed by polarographic measurement of the rate of O2 uptake at 20 °C with a Clark electrode at a voltage of 0.8 V All experiments were carried out at least twice...

Ngày tải lên: 18/03/2014, 01:20

... (scalars) not have separate data types but instead are special cases of vectors On the other hand, as in C family languages, matrices are special cases of vectors We’ll spend a considerable amount ... Data Frames A typical data set contains data of different modes In an employee data set, for example, we might have character string data, such as employee names, and numeric data, such as salaries ... by reading in a data set from a file or database We’ll talk more about data frames in Chapter 1.4.6 Classes R is an object-oriented language Objects are instances of classes Classes are a bit...

Ngày tải lên: 23/03/2014, 05:24

... Moreover, there is also a variant of the BCP for self-maps of a non-Archimedean metric space proved by Prieß-Crampe [10] (also see Petalas and Vidalis [9]) It turns out that, in general, the contraction ... obtain only some particular cases of the contraction principle via a discrete argument Finally, we discuss a variant of ET given by Rus [11] (cf Remarks 2.1 and 4.3) Proof of Eilenberg’s theorem ... Actually, a minor modification of the above proof shows that the assumptions of Theorem 1.1 could be weakened: the relations Rn need not be transitive if we assume the uniqueness of a point x...

Ngày tải lên: 23/06/2014, 00:20

... occurrence of mammary tumor again after surgery at any stage or grade Progression of the disease was considered at the death of the animal from cancer or remote lymph node or organs metastasis Tissue ... ductal carcinoma in situ associated with p53-mutated invasive carcinomas Immunohistochemical analysis of MIB-1, as a proliferative marker is a good approach for evaluation of the growth fraction ... determine the prognostic value of several parameters All statistical analyses were performed with software package SPSS (Release 8.0, SPSS inc.) and a P-value of

Ngày tải lên: 07/08/2014, 17:22

... Annals of General Psychiatry 2009, 8:16 the treatment of acute mania, the approval of quetiapine and the olanzapine-fluoxetine combination against acute bipolar depression and the approval of ... is also approved as an adjunct agent for the treatment of depression The mechanism of action of aripiprazole differs both from FGAs as well as from SGAs, and it seems to be a dopamine D2 partial ... efficacy of aripiprazole against acute mania and they report that the separation from placebo occurred as early as days to They also provide some support for its efficacy against mixed episodes and...

Ngày tải lên: 08/08/2014, 23:21

... interpretation of data MR carried out the ELISA experiments and participated in analysis of data CA performed the statistical analysis and the clinical associations AS participated in the analysis and ... interpretation of data and in the revision of the manuscript RR participated in the design of the study and in the revision of the manuscript EP participated in analysis of data GV participated in the ... G, Alessandri C, Capoano R, Profumo E, Siracusano A, Salvati B, Rigano R, et al.: Screening of a HUAEC cDNA library identifies actin as a candidate autoantigen associated with carotid atherosclerosis...

Ngày tải lên: 09/08/2014, 06:23

... subsequently the proximal by partial clamping of the aorta (for the cases with more than one graft) After completion of the proximal anastomoses the extracorporeal circulation is interrupted and hemostasis ... beat empty of volume The last part of the operation is carried out using an off pump coronary artery bypass (OPCAB) stabilizer in order to perform the necessary distal coronary anastomoses and ... surrounding anatomical structures such as the anterolateral papillary muscle, the lateral ventricular wall, the inferior ventricular wall, etc Gradually we remove most of the necrotic tissues around the...

Ngày tải lên: 10/08/2014, 10:20

... represents a or AML indicates acute myeloid leukemia; ALL, acute lymphoblastic leukemia; MDS myelodysplastic syndrome; AA, aplastic anemia plant echocardiogram or MUGA scan All measures of EF were ... defined by the Transplant Iron Score Based on these groupings, a univariate relative risk of death was calculated for each iron parameter using hazard regression analysis Survival time was measured ... from the date of transplant to the date of death or last known follow-up All data was censored as of July 1st 2007 The following clinical and demographic parameters were collected for statistical...

Ngày tải lên: 10/08/2014, 22:20

... with a rapidly enlarging, yet other wise asymptomatic, neck mass Perhaps it was because the mediastinal mass found an escape route into the neck, tha our patient did not have features of mediastinal ... may prove fatal [4] Adherent mediastinal pleura and pericardium can be dealt with by removal of the involved portions As most mediastinal teratomas are benign, even a Competing interests The author(s) ... sacro-coccygeal region Superior mediastinal teratomas are usually asymptomatic till late, and are often discovered incidentally on chest x-ray Symptoms such as chest pain, dyspnoea or cough are a Page of...

Ngày tải lên: 11/08/2014, 10:23

... planning the therapeutic plan and drafting the manuscript All authors read and approved the final manuscript Acknowledgements The technical assistance of Eiji Komatsu and Toru Maeda (Department of Radiology, ... Hospital, Bunyo, Oita, 870-8511, Japan and 2Department of Surgery, National Hospital Organization Fukuoka Higashi Medical Center, Koga, 811-3195, Japan Ninomiya and Ikeda Journal of Medical Case ... tomography Transplantation 2003, 75:1561-1564 Urata K, Kawasaki S, Matsunami H, Hashikura Y, Ikegami T, Ishizone S, Momose Y, Komiyama A, Makuuchi M: Calculation of child and adult standard liver...

Ngày tải lên: 11/08/2014, 12:20

... modified radical mastectomy with either SNB or axillary node clearance (ANC) [2,3,6] Despite the lack of firm evidence about the safety of SNB, increasingly there is an acceptance of the technique and ... initial manuscript DJH performed the initial operation, and organised the primary management plan of the patient He supervised the writing and editing of the paper All the authors have read and approved ... indications and lack of evidence about the safety and efficacy of BCS with nipple preservation in men with breast cancer, it is a feasible approach if other options are declined by the patient Apparently...

Ngày tải lên: 11/08/2014, 23:21