the nature of language as a communication tool

Tài liệu The Man of Letters as a Man of Business docx

Tài liệu The Man of Letters as a Man of Business docx

... that there is always a danger that the reigning favorite may fail to please; that at any rate, in the order of things, he is passing away, and that if the magazine is not to pass away with the ... thing, and not by marketing a thing after some other man has done it or made it. The quality of the thing has nothing to do with the economic nature of the case; the author is, in the last analysis, ... is the case of authorship as it now stands with regard to the magazines. I am not sure that the case is in every way improved for young authors. The magazines all maintain a staff for the careful...

Ngày tải lên: 17/02/2014, 19:20

21 544 0
The Project Gutenberg EBook of The Man of Letters as a Man of Business, by William Dean Howells potx

The Project Gutenberg EBook of The Man of Letters as a Man of Business, by William Dean Howells potx

... because they have the affair altogether in their hands they are apt to take advantage in it; but this does not follow, and as a matter of fact they have the affair no more in their own hands than any ... it is because I am impatient of the antiquated and ignorant prejudice which classes the magazines as ephemeral. They are ephemeral in form, but in substance they are not ephemeral, and what is best ... best in them awaits its resurrection in the book, which, as the first form, is so often a lasting death. An interesting proof of the value of the magazine to literature is the fact that a good...

Ngày tải lên: 28/06/2014, 17:21

126 362 0
The Project Gutenberg EBook of The Man of Letters as a Man of Business by William Dean Howells pptx

The Project Gutenberg EBook of The Man of Letters as a Man of Business by William Dean Howells pptx

... writing of him as an Artist. Besides, as an artist he has been done a great deal already; and a commercial state like ours has really more concern in him as a business man. Perhaps it may sometime ... at Oxford made an American collegian say in a theme which they imagined for him in his national parlance; and the man of letters, as an artist, is apt to have times and seasons when he cannot blossom. Very ... case of authorship as it now stands with regard to the magazines. I IV I doubt, indeed, whether the earnings of literary men are absolutely as great as they were earlier in the century, in any...

Ngày tải lên: 28/06/2014, 17:21

130 318 0
báo cáo hóa học: " Cultural adaptation into Spanish of the generalized anxiety disorder-7 (GAD-7) scale as a screening tool" pot

báo cáo hóa học: " Cultural adaptation into Spanish of the generalized anxiety disorder-7 (GAD-7) scale as a screening tool" pot

... Convergent validity: The degree of concordance between the GAD-7 scale and the Hamilton Anxiety Scale (HAM -A) , the Hospital Anxiety and Depression Scale (HADS, anxiety domain), and the WHO-DAS II disability ... disability questionnaire was cal- culated. Concordance between classifi cation criteria was assessed by inter-rater agreement statistics (kappa) and a Chi-square test. All statistical calculations were ... Retest:oneweek later, the GAD-7 scale was again administered to a patient subsample; the retest information was used to studythestabilityofquestionnaire measurements over time. The latter was ensured by administering...

Ngày tải lên: 18/06/2014, 19:20

11 537 0
báo cáo hóa học: " Considerations for the future development of virtual technology as a rehabilitation tool" doc

báo cáo hóa học: " Considerations for the future development of virtual technology as a rehabilitation tool" doc

... is to have most of the main data-set replicated across all the sites and transmit only incremental changes. Furthermore the main data-set is often cached locally at each of the col- laborating ... estimated that only about 5–10% of the available fiber has been lit, and each fiber has several terabits/s of capac- ity. The dot-com implosion has made this dark fiber and wavelengths of light ... various people that are subscribers to the data. For example, a user send their data to a multicast address and the routers that receive the data send copies of the data to remote sites that are...

Ngày tải lên: 19/06/2014, 10:20

10 449 0
Tài liệu Test of English as a Foreign Language doc

Tài liệu Test of English as a Foreign Language doc

... Andorra 010 Angola 011 Anguilla 012 Antigua and Barbuda 015 Argentina 016 Armenia 017 Aruba 020 Australia 025 Austria 029 Azerbaijan 030 Azores 035 Bahamas 040 Bahrain 045 Bangladesh 050 Barbados 094 ... any depart- ment not listed. 001 Afghanistan 003 Albania 005 Algeria 007 American Samoa 008 Andorra 010 Angola 011 Anguilla 012 Antigua and Barbuda 015 Argentina 016 Armenia 017 Aruba ... former Yugoslav Republic of 350 Madagascar 353 Madeira Islands 355 Malawi 360 Malaysia 361 Maldives 363 Mali 365 Malta 367 Northern Mariana Islands 368 Marshall Islands 366 Martinique 369 Mauritania 370 Mauritius...

Ngày tải lên: 20/02/2014, 11:21

36 870 0
A COMPARATIVE STUDY OF THE DIAGNOSIS OF PULMONARY TUBERCULOSIS USING CONVENTIONAL TOOLS AND POLYMERASE CHAIN REACTION* pot

A COMPARATIVE STUDY OF THE DIAGNOSIS OF PULMONARY TUBERCULOSIS USING CONVENTIONAL TOOLS AND POLYMERASE CHAIN REACTION* pot

... Mycobacteria was done at the Corporation laboratory by primary differential tests for atypical Mycobacteria. Statistical analysis As no single gold standard was available for comparison of the performance ... 2005 Aug; 9(8): 877-83. KAVITA MODI – PAREKH ET AL CHANCHAL SINGH MEMORIAL AWARD - 2006 The Tuberculosis Association of India awards every year a cash prize of Rs. 1000/- to a medical graduate ... smear microscopy, culture and PCR. The data were compared with available clinical information. Radiological data was available from 61 subjects. The study was conducted blind. Quality of samples...

Ngày tải lên: 06/03/2014, 04:20

8 526 0
Báo cáo khoa học: Identification of NF1 as a silencer protein of the human adenine nucleotide translocase-2 gene pptx

Báo cáo khoa học: Identification of NF1 as a silencer protein of the human adenine nucleotide translocase-2 gene pptx

... autoradiographed. Competitor DNAs used in EMSA analysis were: NF1 wt, 5Â-TTTTG GATTGAAGCCAATATGATA-3Â;NF1mut,5Â-TTTT GGATTGAATAAAATATGATA-3Â;Site-2wt,5Â-GCGT CTCACCCTAGTCCTGGTCCTGCTCCAAGGGTTTT TGTCC-3Â;Site-2mut,5Â-GCGTCTCACCCTAGTAA TGGTAATGCTCCAAGGGTTTTTGTCC-3Â;Site-3wt, 5Â-GGGTTCTTTTGGCATCCCTGTAGC-3Â;Site-3mut, 5Â-GGGTTCTTTTTAAATCCCTGTAGC-3Â. Chromatin ... [13]. Site-2 and Site-3 binding activity in all fractions was monitored by the in vitro DNase I protection assay. The DNA affinity column, used as the last step in the purification, was prepared with an ... )525 (5Â-TGACCTTGTCTCGTTGCCTCACCC-3Â)and)378 (5Â-GCTACAGGGATGCCAAAAGAACCC-3Â)forthe Site-3, and primer set )346 (5Â-GCGTCTCACCCTAGT CCTGGTCCTGC-3Â)and)214 (5Â-GGAAGGGGCGGG TCCAGAGAACA-3Â) for the Site-2 element. PCR was performed...

Ngày tải lên: 07/03/2014, 15:20

8 426 0
Báo cáo Y học: The S100A8/A9 protein as a partner for the cytosolic factors of NADPH oxidase activation in neutrophils doc

Báo cáo Y học: The S100A8/A9 protein as a partner for the cytosolic factors of NADPH oxidase activation in neutrophils doc

... Rac2 and S10 0A9 . Assay of NADPH oxidase activity after oxidase activation The dormant NADPH oxidase of neutrophil membranes was activated by mixing neutrophil plasma membranes and the recombinant cytosolic ... GTPcS-loaded Rac2, MgSO 4 and an optimal amount of arachidonic acid determined for each assay of oxidase activation [12]. The rate of O 2 – production by the activated NADPH oxidase was calculated ... dismutase. NADPH oxidase activity was also assayed by polarographic meas- urement of the rate of O 2 uptake at 20 °CwithaClark electrode at a voltage of 0.8 V. All experiments were carried out at...

Ngày tải lên: 18/03/2014, 01:20

10 396 0
Test  of English  as a  Foreign Language for Internet-Based Testing: Information and Registration BULLETIN

Test of English as a Foreign Language for Internet-Based Testing: Information and Registration BULLETIN

... Albanian AMA Amharic ARA Arabic ARM Armenian ASM Assamese AZE Azerbaijani BAM Bambara BAK Bashkir BAQ Basque BEL Belarusian BEM Bemba BEN Bengali BER Berber BIK Bikol BOS Bosnian BUL Bulgarian BUR ... Kurukh KUS Kusaiean LAO Lao LAV Latvian LIN Lingala LIT Lithuanian LUA Luba-Lulua LUO Luo MAC Macedonian MAD Madurese MLG Malagasy MAY Malay MAL Malayalam MLT Maltese MAR Marathi MAH Marshallese MEN ... Ethiopia, Gabon, Gambia, Ghana, Guinea, Guinea Bissau, Kenya, Lesotho, Liberia, Madagascar, Malawi, Mali, Mauritania, Mauritius, Mozambique, Namibia, Niger, Nigeria, Reunion, Rwanda, Sao Tome and...

Ngày tải lên: 25/03/2014, 10:41

28 765 2
Báo cáo khoa học: Monitoring the prevention of amyloid fibril formation by a-crystallin Temperature dependence and the nature of the aggregating species pdf

Báo cáo khoa học: Monitoring the prevention of amyloid fibril formation by a-crystallin Temperature dependence and the nature of the aggregating species pdf

... time of 4 h 38 min. In the main, the pres- ence of a- crystallin significantly decreased formation of this large aggregate. As a result of the interaction of a- crystallin with reduced j-casein, a ... of nonfibrillar aggregation of j-casein, which might have reduced the number of fibrils in favour of amorphous aggregates. The decrease can be attributed, at least partially, to a decrease in TFT ... the Arrhenius law, we have: ln(k app ) E A RT + ln (A) . The activation energy of fibril formation (E A ) was calculated (Table 1) as the slope of the straight line fitted to a plot of ln(k app )...

Ngày tải lên: 30/03/2014, 04:20

16 577 0
Báo cáo hóa học: " A DISCRETE FIXED POINT THEOREM OF EILENBERG AS A PARTICULAR CASE OF THE CONTRACTION PRINCIPLE" pptx

Báo cáo hóa học: " A DISCRETE FIXED POINT THEOREM OF EILENBERG AS A PARTICULAR CASE OF THE CONTRACTION PRINCIPLE" pptx

... information to Professor Andrzej Granas.) This result is a discrete analog of the Banach contraction principle (BCP) and it has applications in automata theory. Theorem 1.1 (Eilenberg). Let X be an ... y), and therefore, each non- Archimedean metric space has the extraordinary geometric property that each three points of it are vertices of an isosceles triangle. We notice that non-Archimedean ... contraction theorems, [5, Example 1] concerning a comparison of two fixed point theorems of the Meir-Keeler type). Moreover, there is also a variant of the BCP for self-maps of a non-Archimedean...

Ngày tải lên: 23/06/2014, 00:20

6 268 0

Bạn có muốn tìm thêm với từ khóa:

w