the dead band of a process is that rang

Báo cáo Y học: Incorporation of 3-nitrotyrosine into the C-terminus of a-tubulin is reversible and not detrimental to dividing cells potx

Báo cáo Y học: Incorporation of 3-nitrotyrosine into the C-terminus of a-tubulin is reversible and not detrimental to dividing cells potx

... indicates clearly that the two compounds are incorporated into tubulin at the same site Another biochemical characteristic of tubulin is its ability to act as substrate of the detyrosinating ... dividing the optical density of each band stained with antibodies to Glu- and nitrotyrosinated tubulin by that of an identical sample stained with DM 1A antibody Capabilities of nitrotyrosinated and ... incubation was the same in both cases (data not shown), indicating that replacement of tyrosine by 3-nitrotyrosine at the C-terminus of a- tubulin is not relevant to the association of carboxypeptidase...

Ngày tải lên: 17/03/2014, 10:20

9 518 0
Báo cáo toán học: "The characteristic polynomial of a graph is reconstructible from the characteristic polynomials of its vertex-deleted subgraphs and their complements" doc

Báo cáo toán học: "The characteristic polynomial of a graph is reconstructible from the characteristic polynomials of its vertex-deleted subgraphs and their complements" doc

... in their respective coefficients of x The list of the characteristic polynomials of the vertex deleted subgraphs of the two graphs is shown in Table This is hardly an indication that counter-examples ... (G)} and since a graph has at least one main eigenvalue, so is aG,0 Discussion The original problem of whether P(G) uniquely determines aG,0 is still open It is part of a general class of reconstruction ... to prove that the characteristic polynomial is also reconstructible But there is an alternative argument to this Let PG (x) be the derivative of the characteristic polynomial of G Then (see [9])...

Ngày tải lên: 07/08/2014, 06:20

9 363 0
Tài liệu Báo cáo khoa học: The single tryptophan of the PsbQ protein of photosystem II is at the end of a 4-a-helical bundle domain docx

Tài liệu Báo cáo khoa học: The single tryptophan of the PsbQ protein of photosystem II is at the end of a 4-a-helical bundle domain docx

... determined numerical values of the ratio a/ b, and is the theoretical numerical value of ratio a/ b for a mixture of aromatic amino acids (Tyr and Trp), containing the same molar ratio as the protein ... script a is the peak–peak distance between the maximum at %287 nm and the minimum at %283 nm, and the script b is the peak–peak distance between the maximum at %295 nm and the minimum at %290 ... good and the programs did not mark any as poor or inappropriate Another structural analysis, obtained by the VERIFY3D program [61], gave an average value of 0.21, which is greater than zero, the...

Ngày tải lên: 21/02/2014, 00:20

12 550 0
Tài liệu Báo cáo Y học: Thermostability of manganese- and iron-superoxide dismutases from Escherichia coli is determined by the characteristic position of a glutamine residue pdf

Tài liệu Báo cáo Y học: Thermostability of manganese- and iron-superoxide dismutases from Escherichia coli is determined by the characteristic position of a glutamine residue pdf

... mutagenesis reactions together with oligonucleotides ECF-Q69G d(5¢-AACAACGCAGCTGGGCTCTG GAACCAT), ECF -A1 41Q d(5¢-TCAACCTCTAACCAG GCTACTCCGCTG) ECM-G77Q d(5¢-AACAACGCTGG CCAGCACGCTAACCAC) and ECM-Q14 6A ... effects of a combination of key residues Further analysis of these and other mutant SODs is currently underway ACKNOWLEDGEMENTS We are indebted to G Peplow, F Yamakura and T Matsumoto for the analyses ... Tamagawa, H., Iwakura, K., Tsunasawa, S & Tsunemitsu, A (1990) Characterization of superoxide dismutases purified from either anaerobically maintained or aerated Bacteroides gingivalis J Bacteriol...

Ngày tải lên: 21/02/2014, 01:21

12 741 0
Báo cáo khoa học: Esculentin-1b(1–18) – a membrane-active antimicrobial peptide that synergizes with antibiotics and modifies the expression level of a limited number of proteins in Escherichia coli doc

Báo cáo khoa học: Esculentin-1b(1–18) – a membrane-active antimicrobial peptide that synergizes with antibiotics and modifies the expression level of a limited number of proteins in Escherichia coli doc

... Mangoni ML, Maisetta G, Di Luca M, Gaddi LM, Esin S, Florio W, Brancatisano FL, Barra D, Campa M & Batoni G (2008) Comparative analysis of the bactericidal activities of amphibian peptide analogues ... permeation/proteome proteome of the target microorganism and no microbial resistance; and (b) the design of potential coadjuvants of those antimicrobial agents that are already available after ... where A and B are the MICs of drug A and drug B in the combination, MICA and MICB are the MICs of drug A and drug B alone, FICA and FICB are the FICs of drug A and drug B and n is the number of...

Ngày tải lên: 16/03/2014, 00:20

18 494 0
Báo cáo khoa học: Identification of preferred substrate sequences for transglutaminase 1 – development of a novel peptide that can efficiently detect cross-linking enzyme activity in the skin pot

Báo cáo khoa học: Identification of preferred substrate sequences for transglutaminase 1 – development of a novel peptide that can efficiently detect cross-linking enzyme activity in the skin pot

... Matsuki M, Yamashita F, Ishida-Yamamoto A, Yamada K, Kinoshita C, Fushiki S, Ueda E, Morishima Y, Tabata K, Yasuno H et al (1998) Defective stratum corneum and early neonatal death in mice lacking ... or (b) the phage clone that contained this sequence was efficiently amplified in bacteria Mutational analysis of each amino acid residue in the K5 sequence demonstrated that the consensus TGase motif, ... control The reaction mixture was incubated at 37 °C and then separated by 12.5% SDS–PAGE A fluorograph of the gel was obtained by UV irradiation (254 nm) to visualize the amount of incorporated Dansyl-Cd...

Ngày tải lên: 23/03/2014, 06:20

11 449 1
Báo cáo khoa học: Identification of the epitope of a monoclonal antibody that disrupts binding of human transferrin to the human transferrin receptor pptx

Báo cáo khoa học: Identification of the epitope of a monoclonal antibody that disrupts binding of human transferrin to the human transferrin receptor pptx

... AAAGGATCCTGCAAGCCTGTGAAGTGG AAAGAATTCATTAAGGTCTACGGAAAGTGCAGG b AAAGGATCCATGAAGTGGTGTGCGCTGAG AAAGAATTCTTACAGGTGAGGTCAGAAGCTGATT AAAGGATCCAATTTTGCTGTAGCAGTGGTGAA AAAGAATTCTTAACCTGAAAGCGCCTGTGTAG AAAGGATCCCCCAACAACAAAGAGGGATACT ... c AAAGAATTCTTACTTGCCCGCTATGTAGACAAA c AAAGAATTCTTAATCCTCACAATTATCGCTCTTATT c AAAGAATTCTTACCCTACACTGTTAACACT c AAAGAATTCTTAAACACTCCACTCATCACA d GTGTATCAGCAGAGAACACCGAAGACTGCATCGCC GGCGATGCAGTCTTCGGTGTTCTCTGCTGATACAC ... AAAGGATCCCCCAACAACAAAGAGGGATACT AAAGAATTCTTAGGTGCTGCTGTTGACGTAATAT AAAGGATCCAAGGAAGCTTGCGTCCACAAGATA AAAGAATTCTTAGGCAGCCCTACCTCTGAGATTTT c AAAGAATTCTTAGGTGGTCTCTGCTGATACACACTC c AAAGAATTCTTAATGCAGTCTTCGGTGGTCTCT c AAAGAATTCTTACTTGCCCGCTATGTAGACAAA...

Ngày tải lên: 30/03/2014, 11:20

10 308 0
– THE GRE QUANTITATIVE SECTION – The area of a sector is found in a similar way to finding the pptx

– THE GRE QUANTITATIVE SECTION – The area of a sector is found in a similar way to finding the pptx

... a cylinder, use the formula V = ␲r2h h r S URFACE A REA The surface area of an object measures the combined area of each of its faces The total surface area of a rectangular solid is double the ... (the median), and/or the average of all the values (the mean) M EAN AND M EDIAN To find the average, or the mean, of a set of numbers, add all the numbers together and divide by the quantity of ... Diagonals bisect each other S PECIAL T YPES OF PARALLELOGRAMS There are three types of special parallelograms: ■ A rectangle is a parallelogram that has four right angles 193 – THE GRE QUANTITATIVE...

Ngày tải lên: 18/06/2014, 17:20

25 410 0
báo cáo hóa học:" A process evaluation of the scale up of a youth-friendly health services initiative in northern Tanzania" pot

báo cáo hóa học:" A process evaluation of the scale up of a youth-friendly health services initiative in northern Tanzania" pot

... between the Tanzanian National Institute for Medical Research, the African Medical and Research Foundation, the ministries of Health and Social Welfare and of Education and Vocational Training of the ... scale up of MEMA kwa Vijana (MkV2), supervised the data collection, and performed the final analysis and write up of all the components of this study and manuscript BA was lead researcher for the ... Regional and District Commissioners, the Regional Medical Officer and the District Medical Officers The head of each health unit, the parents of the simulated patients, the simulated patients and...

Ngày tải lên: 20/06/2014, 08:20

12 370 0
Báo cáo toán học: "The Quantum Double of a Dual Andruskiewitsch-Schneider Algebra Is a Tame Algebra" pdf

Báo cáo toán học: "The Quantum Double of a Dual Andruskiewitsch-Schneider Algebra Is a Tame Algebra" pdf

... generally tame Hopf algebras, we need more examples of tame Hopf algebras The Andruskiewitsch-Schneider algebra is a kind of generalization of generalized Taft algebra and of course Taft algebra Therefore, ... [11], we know that the most typical examples of basic Hopf algebras of finite representation type are Taft algebras and the dual of A( n, d, μ, q), which as an associative algebra is generated by two ... relations and AR-quivers of the quantum doubles of the duals of the generalized Taft algebras explicitly and show that these quantum doubles are tame The structures of basic Hopf algebras of finite...

Ngày tải lên: 06/08/2014, 05:20

19 386 0
Báo cáo toán học: "The crossing number of a projective graph is quadratic in the face–width" doc

Báo cáo toán học: "The crossing number of a projective graph is quadratic in the face–width" doc

... with a proof of Theorem 1.1) We remark that our constants are not unreasonable (see Theorem 3.4) B¨r¨czky, Pach and T´th showed [2] that for every surface χ there is a constant c χ oo o such that ... edges of G intersected by the (dual) edges of C ∗ Then G − F is actually a plane embedding, and we easily add the edges of F back to G − F , making a plane drawing D with at most |F | pairwise ... Let G denote the plane graph derived in this way from G We claim that G contains a collection of r pairwise disjoint paths P1 , , Pr , and a collection of r/2 pairwise disjoint paths Q1 , ...

Ngày tải lên: 07/08/2014, 15:23

8 336 0
Báo cáo toán học: "The maximum size of a partial spread in H(4n + 1, q 2) is q 2n+1 + 1" docx

Báo cáo toán học: "The maximum size of a partial spread in H(4n + 1, q 2) is q 2n+1 + 1" docx

... − 1} These parameters bi and ci are known as the intersection numbers of the distance-regular graph Γ If θ is any eigenvalue of a distance-regular graph Γ, then there is a series of eigenvalues ... the matrix of eigenvalues of the association scheme If ∆m is the diagonal matrix with (∆m )ii the dimension of the eigenspace Vi , and if ∆n is the diagonal matrix with (∆n )jj the valency of the ... considerably shorter as the oppositeness relation can be directly associated with the dual polar graph The dual polar graph is distance-regular and hence we readily have the required information about...

Ngày tải lên: 07/08/2014, 21:21

6 327 0
Báo cáo toán học: "The toric ideal of a matroid of rank 3 is generated by quadrics" pps

Báo cáo toán học: "The toric ideal of a matroid of rank 3 is generated by quadrics" pps

... prove the next theorem by Corollary Theorem The k-base graph of a matroid of rank is connected The remainder of this paper is devoted to the proof of this theorem We consider a matroid M of rank ... partition of bases, that contains both a blue base and a red base Therefore this partition is adjacent to both the initial blue and red partitions in the 3-base graph Therefore, we know that aef cannot ... red bases (aef and ihg), (efi and afg), or (efh and aig) Because aef is not a base, either (efi and afg) or (efh and aig) are bases Without loss of generality, we may assume that efh and aig are...

Ngày tải lên: 08/08/2014, 12:22

12 270 0
Báo cáo y học: " Decreased respiratory system compliance on the sixth day of mechanical ventilation is a predictor of death in patients with established acute lung injury" ppt

Báo cáo y học: " Decreased respiratory system compliance on the sixth day of mechanical ventilation is a predictor of death in patients with established acute lung injury" ppt

... variables measured at day 1, day 6, and the change in value between day and Stata 9.0 (StataCorp, College Station, Texas) computer software was used for statistical analysis All interval data ... the data ES created the figures and wrote the manuscript HJ and ME helped with the statistical analysis RK and MAM oversaw the research, helped analyzed the data and edit the manuscript All authors ... an average duration of mechanical ventilation in ALI between and 16 days, suggesting that a large proportion of patients with ALI are alive and mechanically ventilated days after the diagnosis...

Ngày tải lên: 12/08/2014, 13:22

8 351 0
Báo cáo y học: " Induction of the HIV-1 Tat co-factor cyclin T1 during monocyte differentiation is required for the regulated expression of a large portion of cellular mRNAs" pptx

Báo cáo y học: " Induction of the HIV-1 Tat co-factor cyclin T1 during monocyte differentiation is required for the regulated expression of a large portion of cellular mRNAs" pptx

... β-actin (forward): AGCAAGCAGGAGTATGACGAGTC, β-actin: AGAAAGGGTGTAACGCAACTAAGTC (reverse), CSF1R(forward): TTCTGCTGCTCCTGCTGGTG, CSF1R(reverse): ACCGTTGCTCCTGGCTTCAC, LOX1(forward): ACTGTGAAGGACCAGCCTGATG, ... similarity below each GO node This number is then compared against the distribution of counts expected for a random list of the same size Statistical consideration of the counts is based on a sampling ... YW and XQ constructed and characterized the HIV-1 viruses and lentiviral vectors used in the study CS performed the analysis of DNA microarray data and performed the statistical analysis AR conceived...

Ngày tải lên: 13/08/2014, 09:20

16 178 0
Báo cáo y học: "A proposed adaptation of the European Foundation for Quality Management Excellence Model to physical activity programmes for the elderly - development of a quality self-assessment tool using a modified Delphi process" ppt

Báo cáo y học: "A proposed adaptation of the European Foundation for Quality Management Excellence Model to physical activity programmes for the elderly - development of a quality self-assessment tool using a modified Delphi process" ppt

... that these results are related to the fact that many experts are programme leaders and thus, are more aware of practices that pertain to Leadership Also, experts may have been aware of the fact ... Pedro Soares pedromortaguasoares@gmail.com Rute Santos rutemarinasantos@hotmail.com António Oliveira-Tavares oliveiratavares@netvisao.pt Jorge Mota jmota@fade.up.pt Joana Carvalho jcarvalho@fade.up.pt ... drafting and editing the manuscript AOT and RS managed the data collection and analysis JC participated in the coordination of the study and supervised the drafting and editing of manuscript All authors...

Ngày tải lên: 14/08/2014, 08:20

30 369 0
The Marketing Strategy of a multinational join stock company.doc

The Marketing Strategy of a multinational join stock company.doc

... sales of products is another main task of the department • Financial and Accounting department: this department deals with all financial and accounting matters Another main function is to manage ... company only sold famous brands that are Toshiba (Japanese), Mitsubishi (Japanese) Then recently it has expanded and started to sell other brands: Trane (American) and Sanyo (Japanese) This is ... (Japanese), Trane (American) and Sanyo (Japanese) These are famous brands in the world market and Vietnamese consumers highly appreciate them A multinational join stock company has never had any...

Ngày tải lên: 27/10/2012, 16:51

25 624 8
Tài liệu Issues Involved When Updating the Primary Key of a Parent Row pptx

Tài liệu Issues Involved When Updating the Primary Key of a Parent Row pptx

... made in the child DataTable This is the default None Indicates that no action takes place SetDefault Indicates that the DataColumn values in the child DataTable are to be set to the value in the ... CustomerID of J6COM A copy of this row is stored in a DataTable named customersDT There is a row in the Orders table that also has a CustomerID of J6COM A copy of this row is stored in a DataTable named ... you change the DataColumn in the parent DataTable on which the ForeignKeyConstraint was created, then the same change is also made in any corresponding DataRow objects in the child DataTable You...

Ngày tải lên: 24/12/2013, 01:17

6 429 0
Tài liệu Báo cáo khoa học: "Learning the Latent Semantics of a Concept from its Definition" pptx

Tài liệu Báo cáo khoa học: "Learning the Latent Semantics of a Concept from its Definition" pptx

... Proceedings of Fifth Annual Meeting of the North American Chapter of the Association for Computational Linguistics Ravi Sinha and Rada Mihalcea 2007 Unsupervised graph-based word sense disambiguation ... Empirical Methods in Natural Language Processing Weiwei Guo and Mona Diab 2012 Modeling sentences in the latent space In Proceedings of the 50th Annual Meeting of the Association for Computational ... 144 Rada Mihalcea 2005 Unsupervised large-vocabulary word sense disambiguation with graph-based algorithms for sequence data labeling In Proceedings of the Joint Conference on Human Language Technology...

Ngày tải lên: 19/02/2014, 19:20

5 585 0

Bạn có muốn tìm thêm với từ khóa:

w