the basic social organization of a society is its

Ngày tải lên: 17/03/2014, 10:20

Ngày tải lên: 18/06/2014, 17:20

Ngày tải lên: 07/08/2014, 06:20

Ngày tải lên: 10/08/2014, 22:21

Ngày tải lên: 13/08/2014, 23:20

Ngày tải lên: 14/08/2014, 08:20

... view the log as the most up to date ‘‘truth’’ about the state of the data on disk. The main difference is that database systems do not use the log as the final repository for data: a separate data ... area is reserved for this purpose. The separate data area of these database systems means that they do not need the segment cleaning mechanisms of the Sprite LFS to reclaim log space. The space ... below. The second issue is how to manage the free space on disk so that large extents of free space are always available for writing new data. This is a much more difficult issue; it is the topic of...

Ngày tải lên: 12/09/2012, 15:05

Ngày tải lên: 05/09/2013, 16:11

Ngày tải lên: 07/09/2013, 13:48

... declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative ... which there are a man and a woman sitting in a forest of a new planet. Behind them there is a spaceship. There are two astronauts’ helmets, one in front of them and the other at their back. They ... declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative declarative imperative declarative declarative ability/neg....

Ngày tải lên: 12/02/2014, 20:20

... NA TGCARRAAYATHTTYTCCAG Deg RPE65-Rev AYRAAYTCRWRBCCYTTCCA RPE6 5a- Fwd NM_200751 GCGGCCGCCACCATGGTCAGCCGTTTTGAACAC RPE6 5a- Rev GATATCTTATGGTTTGTACATCCCATGGAAAG RPE65c-Fwd NM_001113653 GCGGCCGCCACCATGGTCAGCCGTCTTGAACAC RPE65c-Rev ... GCGGCCGCCACCATGCATCATCACCATCAC CATGTCAGCCGTTTTGAACAC RPE65c-His-Fwd NM_001113653 GCGGCCGCCACCATGCATCATCACCATCAC CATGTCAGCCGTCTTGAACAC Y. Takahashi et al. A novel isomerohydrolase in the retina FEBS Journal 278 (2011) ... CTGAGGTTACAGACAACTGTTC 13cIMH GSP-Rev CCTTTGACATCGCAAGTGGATCA RPE65c GSP-Fwd NM_001113653 TTGAGGTGACAGACAATTGCCT RPE65c GSP-Rev TCTTTGACTTCTCAAACTGATCG RPE6 5a- His-Fwd NM_200751 GCGGCCGCCACCATGCATCATCACCATCAC CATGTCAGCCGTTTTGAACAC RPE65c-His-Fwd NM_001113653...

Ngày tải lên: 14/02/2014, 14:20

... was basically stable at 35 °C, and retained 60% of the initial activity at 45 °C for 90 min when assayed at 35 °C (Fig. 3A, B). The presence of Ca 2+ increased the thermal stability of PhyH and ... was determined using the Bradford assay with BSA as the standard [28]. Phytase activity assay Phytase activity was determined by measuring the amount of phosphate released from InsP 6 using a modified ferrous sulfate ... °C and is not strictly psychrophilic. The apparent optimal temperature of PhyH is 35 °C, similar to the optimal temperature of strain HJB17, and the optimal pH is 7.0. PhyH has some cold-adaptive...

Ngày tải lên: 14/02/2014, 15:20

... consists of the mainland and islands including Tasmania, Norfolk, and very distant islands like Christmas and Keeling. A state can also comprise many islands. The Marshall Islands are two archipelagic ... a major hurricane that affected East Pakistan. The apathy of the West Pakistani leadership and their failure to aid East Pakistan only aggravated an already tense situation. 284 Clearly, ... Peninsula Gulf of Oman U .A. E. Russian Federation Muskat Angola Luanda Congo Cabinda Argentina Chile Rio Grande Atlantic Ocean Pacific Ocean Estonia Latvia Lithuania Belarus Poland Riga Kaliningrad...

Ngày tải lên: 16/02/2014, 11:20

... widths of the NMR signals were used as a measure of the uncertainty of each NMR data point and an experimental uncertainty of 2% was assumed for the experimental points of the redox titrations. Acknowledgements The ... release. The unpaired electron in the oxidized haem causes a paramagnetic shift on its signals that is directly proportional to the fractional oxida- tion in the absence of extrinsic paramagnetic ... Frausto da Silva JJR, Amorim MTS, Cabral MF, Chaves S & Costa J (1991) Dissociation constants of Bronsted acids in D 2 O and H 2 O: studies on polyaza and polyoxa–polyaza macrocycles and a general...

Ngày tải lên: 19/02/2014, 17:20

... guar- anteed that its deadline will be met, based on the published parameters of each schedulable operation. One advantage of our approach is that operation invoca- tions only pay the overhead of the C++ ... this paper is written in C++ as one of the services in TAO [5]. TAO is a real-time implementation of CORBA based on the ACE framework [28]. ACE is a widely used communi- cation framework that ... If the avail- ability of new hardware, such as Forward Looking Infrared Radar, requires a new Sensor Proxy, I/O Facades must be al- tered to take advantage of the new technology. 3.6 Alleviating...

Ngày tải lên: 19/02/2014, 18:20

... share the same latent semantics profile, as long as they are in the same topic/domain. To solve the sparsity issue we use missing words as negative evidence of latent semantics, as in (Guo and Diab, ... as our disambiguation algorithm. It is a graph- based algorithm, where nodes are senses, and edge weight equals to the sense pair similarity. The final answer is chosen as the sense with maximum ... link the senses across dictionaries, hence Wik is only used as augmented data for WMF to better learn the semantics of words. All data is tokenized, POS tagged (Toutanova et al., 2003) and lemmatized,...

Ngày tải lên: 19/02/2014, 19:20

... with the negatively charged Asp113 at distance of 3.2 A ˚ . One of the reasons that the pK a of His210 is 2 pH units higher than that of His57 is the buried charge interaction with Asp113. The ... 2002 side-chain at residue 210 is dispensable, as shown by the fact that H21 0A and H210S are as active as native API with VLK-MCA as a substrate (Table 1). This means that Trp169 does not play a role as ... by the Trp169–His210 stacking, suggesting that API has a catalytic quadruple apparatus, composed of Ser194, His57, Asp113 and His210, rather than a catalytic triad. ACKNOWLEDGEMENT We are grateful...

Ngày tải lên: 21/02/2014, 03:20

... a NUMERICAL CHARACTERIZATION OF THE K ¨ AHLER CONE 1251 of N. Buchdahl [Buc99, 00] and A. Lamari [Lam9 9a, 99b]; it turns out that there exists a very neat characterization of nef classes on arbitrary ... Jean-Pierre Demailly and Mihai Paun Abstract The goal of this work is to give a precise numerical description of the K¨ahler cone of a compact K¨ahler manifold. Our main result states that the K¨ahler ... ∇ 1,1 of the Gauss-Manin connection. Of course, once this is proved, one can apply again the result on each stratum S ν instead of S to see that there is a countable stratification of S such that the...

Ngày tải lên: 05/03/2014, 23:20

... form of proHP8 Xa and the catalytic domain of active HP8 are marked with arrowheads. The size and position of molecular weight stan- dards are indicated on the left. (B) The catalytic activity of ... Ile-Glu-Ala-Arg-p-nitro- anilide (IEARpNA) [31]. ProHP8 Xa lacked IEARase activity, but after the zymogen was activated by factor Xa, IEARase activity increased significantly above that of factor Xa alone, which could also ... Y (1988) Isolation and characterization of the human Gs alpha gene. Proc Natl Acad Sci USA 85, 2081–2085. 42 Quan F & Forte MA (1990) Two forms of Drosophila melanogaster Gs alpha are produced...

Ngày tải lên: 06/03/2014, 09:22

... from the larger workshop that the attacks look technical, this group responded, “They’re [the attacks are] actually brain-dead!” The group emphasized that although the attacks may look sophisticated ... that proper markings are pre- Vulnerabilities and Exploits 13 Table 3.1 at the end of this chapter contains the group’s expanded list of “discrete attack actions.” The table gives a name for each ... an attacker “cover his trail” of observables? • What is the overall scope of activities that a malicious insider might undertake and what role do environmental factors play? • Can we create a...

Ngày tải lên: 06/03/2014, 16:20