the capital account balance is a nations

... vulnerable balance sheets. b. Changes to the Regulatory Regime in the Aftermath of the Liberalization of the Financial System and the Capital Account Financial sector liberalization and the opening ... of the Financial Crisis. In 1983–87, Thailand experienced a financial crisis that was associated with a slowdown in the economy, globally high interest rates, and fraud and mismanagement on the ... banks. Table 10. Changes to the Regulatory and Supervisory Framework Date Measures 1993/January • Imposing BIS capital adequacy standards on commercial banks. Initially minimum capital- to-risk-asset...

Ngày tải lên: 27/01/2014, 11:20

Ngày tải lên: 30/03/2014, 09:20

Ngày tải lên: 20/06/2014, 06:20

Ngày tải lên: 20/06/2014, 06:20

Ngày tải lên: 20/06/2014, 06:20

Ngày tải lên: 20/06/2014, 06:20

... Kennedy, a folklorist at heart, apparently wanted to put across 52 The Ku Klux Klan and Real-Estate Agents the typical online dater is either a fabulist, a narcissist, or simply re- sistant to the ... of their customers. But like the funeral director and the car salesman and the life- insurance company, the real-estate agent has also seen her advantage eroded by the Internet. After all, anyone ... internal scandals once again laid the Klan low. Public sentiment turned against the Klan as the unity of a country at war trumped its message of separatism. But within a few years, there were already...

Ngày tải lên: 17/10/2013, 18:20

... 5-ACATTGT GCTCAGTGGTGGA-3 and 5-CTGAGGGAAGCAAG AATGGA-3, OXI1 (At3g25250): 5-GACGAGATTATC AGATTTTACGC-3 and 5-AACTGGTGAAGCGGAAG AGAC-3, PTI1-4 (At2g47060): 5-CCCCAAAGAAAATG AGTTGCT-3 and 5-GCATCATTTCCTGGAGGAAAG-3. Acknowledgement This ... [c- 32 P]-ATP. MBP was used as an artifi- cial substrate to assess the kinase activity and GST alone was used as a negative control. The top panel shows the kinase assay visualized by autoradiography and ... mutants simulating disease resistance response. Cell 77, 565–577. 26 Takahashi A, Agrawal GK, Yamazaki M, Onosato K, Miyao A, Kawasaki T, Shimamoto K & Hirochika H (2007) Rice Pti 1a negatively...

Ngày tải lên: 14/02/2014, 19:20

... to the learner is the same as the number of credits allocated to the component. The full number of credits is always awarded if the student achieves a passing grade; it is never adjusted according ... information), but they should ascertain that it contains all the elements and that, as far as pos- sible, the sequence is respected. More information on the European Union is available on the ... workload information• about these assessment methods that is available well in advance award of the number of ECTS credits• allocated to each educational component after the required assessment...

Ngày tải lên: 16/02/2014, 03:20

... using annual data is that, on average over the past 30 years, a 100 basis point rise in the Federal funds rate has been associated with a 24 basis points rise in 2 The standard deviation ... envisaged under the standardised approach of Basel II (which was carried over into Basel III), the internal ratings-based (IRB) approach requires banks to allocate capital according to their ... have fallen despite an extraordinary expansion in the issuance of AAA-rated fixed-rate paper in the past few years – thanks to large fiscal deficits and government guarantees for the US mortgage...

Ngày tải lên: 17/02/2014, 03:20

... polyubiquitination and subsequent proteasomal degradation in HEK293 cells, Rac1b is poorly ubiquitinated and appears to be much more resistant to proteasomal degradation than Rac1L61. Mutational analysis ... unlike Rac1L61, Rac1b mostly escapes the ubiquitination process and is there- fore resistant to proteasomal degradation. We show by mutational analysis that the main target site for Rac1L61 polyubiquitination ... has closely similar spatial situations; this observation raises the hypothesis that similar mechanisms and homologous E3 ubiquitin ligases are involved in both cases. On the basis of structural...

Ngày tải lên: 18/02/2014, 16:20

... phosphatases sigma and delta. J Neurosci 26, 5872–5880. 35 Stoker AW, Gehrig B, Newton MR & Bay BH (1995) Comparative localisation of CRYP alpha, a CAM-like tyrosine phosphatase, and NgCAM in the ... black dots, protease cleavage sites. (B) SDS ⁄ PAGE separation of FN3d–AP purified from conditioned media using anti-placental alkaline phosphatase (PLAP) agarose. (C) SDS ⁄ PAGE and silver stain ... inevitable partial degradation of nucleolin, mean that calculations of binding affinity are unrealistic at this stage. Nucleolin localization in muscle is analogous to PTPr ligand localization To determine...

Ngày tải lên: 19/02/2014, 05:20

... TAT ATG T Weak 3 aa 2 ⁄ 4 55067 TCA ATG C Weak 58 aa 3 33 39% 60929 60933 60939 GTA ATG C TGC ATG T TCC ATG G G Adequate Weak Adequate 13 aa 33 aa 31 aa 3¢ 76 49% – 4¢ 56 61% 61041 GGA ATG T Adequate ... obvious retrieval signal is missing. The human phospholipases D1 and D2 are mainly associated with the plasma membrane or with the membranes of intracellular organelles although they lack a transmembrane ... [13]. Position Kozak consensus A GCC ATG G G Context ATG 1 330 AAG ATG A Adequate ATG 2 345 CTG ATG T Weak ATG 3 396 CCC ATG A Weak ATG 4 489 CTG ATG A Weak Hu-K4 A. Munck et al. 1722 FEBS Journal 272 (2005)...

Ngày tải lên: 19/02/2014, 17:20

... b-1,4-Endogalactanases cleave within the galactan moiety of type I arabinogalactan, releasing D -galacto-oligosaccharides. Bacterial b-1,4-endo- galactanases release mainly galactotriose and galactotetra- ose ... soy arabinogalactan consists of 57% D -galactose and 38% L -arabinose. Methylation analysis demonstrated that a substantial amount of the L -arabinose residues (14%) in soy arabinogalactan is ... against any of the transgalactooligosaccharides listed in Materials and methods. Hydrolysis of arabinogalactans The sugar composition of the arabinogalactans from potato, onion and soy was determined...

Ngày tải lên: 21/02/2014, 01:21

... homologs are poly (A) polymerases. Proc Natl Acad Sci USA 101, 4407–4412. 18 Nakanishi T, Kubota H, Ishibashi N, Kumagai S, Watanabe H, Yamashita M, Kashiwabara S, Miyado K & Baba T (2006) ... repression is an RNA-mediated oligomer. Nucleic Acids Res 32, 1325– 1334. 5 Nakahata S, Kotani T, Mita K, Kawasaki T, Katsu Y, Nagahama Y & Yamashita M (2003) Involvement of Xenopus Pumilio in the ... XRbm9 is able to target XGld2 to specific mRNA. The molecular mechanism underlying XRbm9-dependent translational activation is unclear and awaits further investigations. The subcellular localization...

Ngày tải lên: 07/03/2014, 05:20

... are likely to be other meiotic clade AAA ATPases and have the AAA domain helix and the C-terminal helix, but not the b domain. The distinguishing feature of members of the meiotic clade of AAA ... these AAA ATPases. Thus many AAA ATPases function as protein disassembly machines [25]. ATPase activity of Vps4 is critical for disassembling the MVB sorting machinery, including the endosomal sorting ... sequences as well as the Arg residues in the SRH (red) and Walker A and B motifs (black) are shown. The colour code for the remainder of the protein is: large AAA subdomain, pink; small AAA subdomain,...

Ngày tải lên: 07/03/2014, 05:20

... joining, a distance algorithmic method. Stability of clades was evaluated by 1000 bootstrap rearrangements. Bootstrap values lower than 20% are not displayed in the cladogram. RNA isolation and hybridization Fungal ... immitis, which is produced by the saprophytic and the parasitic phases of Coccidioides immitis, the causative agent of the human respiratory disease San Joaquin Valley fever, was proposed as a Coccidioides- specific ... of the EST database, and especially Patrizia Ambrosino and Luis Sanz for providing purified cell walls of plant pathogenic fungi. The authors also wish to thank Christian Gamauf for his help in...

Ngày tải lên: 07/03/2014, 12:20

... disRAS1fwd 5¢-TTCACGATTGAACAGGTAAACAAAATTTTCC CTTTTTAGAACGACATGCAGCTGAAGCTTCGTA CGC-3¢ and disRAS1rev CAAAACCATGTCATAT CAAGAGAGCAGGATCATTTTCAACAAATTATGC ATAGGCCACTAGGGATCTG-3¢. YEp351-SUT2 was constructed to contain SUT2 as ... 5¢-TGACGCTCACCAAGCTATTGGTTT GTTTGGATCAATCGTCAGATATGAAGGCATAG GCCACTAGTGGATCTG-3¢ and disSUT2rev 5¢-TAT TAATATTCCTATATTTTACATAGGAGGAAATTA CATGCATGAAACCTACAGCTGAAGCTTCGTAC GC-3¢, respectively. The plasmid pFL38-RAS2 was con- structed by ligating the ... (S1278b) the kanMX cassette from plasmid pUG6 [12] was amplified by polymerase chain reaction (PCR) using the primers disRAS2fwd 5¢-TAACCGT TTTCGAATTGAAAGGAGATATACAGAAAAAA AACAGCTGAAGCTTCGTACGC-3¢ and...

Ngày tải lên: 07/03/2014, 15:20