tentyriini species c genus

Báo cáo khoa học: A study on genomic distribution and sequence features of human long inverted repeats reveals species-specific intronic inverted repeats pptx

Báo cáo khoa học: A study on genomic distribution and sequence features of human long inverted repeats reveals species-specific intronic inverted repeats pptx

Ngày tải lên : 07/03/2014, 00:20
... For species specification of the LIRs, 421 (77%) are human-speci c, 355 (74%) are chimpanzee-speci c, 180 (90%) are mouse-speci c and 107 (82%) are rhesus monkey-speci c For the nonspeci c LIRs, ... excluded We then selected recombinogenic LIRs among the collection using the same criterion Next, we tried to uncover the specification in the biological profile of genes having species- speci c ... Wagner EJ & Garcia-Blanco MA (2003) A stem structure in fibroblast growth factor receptor transcripts mediates cell-type-speci c splicing by approximating intronic control elements Mol Cell Biol 23,...
  • 13
  • 542
  • 0
Báo cáo Y học: Identification of residues in the PXR ligand binding domain critical for species specific and constitutive activation docx

Báo cáo Y học: Identification of residues in the PXR ligand binding domain critical for species specific and constitutive activation docx

Ngày tải lên : 08/03/2014, 16:20
... designed: 5¢-TGAGATGTGCCAGCTGAGGTTCA-3¢ for I282Q (forward), 5¢-CAACGCCCAGCATACCCAGCAGT-3¢ for Q404H (forward), 5¢-CAACGCCCAGGCAACCCAG CAGT-3¢ for Q404A (forward), 5¢-TGAACCTCAGCT GGCACATCTA-3¢ for I282Q ... (Clontech) The following primers were used: 5¢-TCGAGCTGTGTATACTGAGATTCA-3¢ for Q285I, 5¢-TCAATGCTCAGCAGACCCAGCGGC-3¢ for H407Q, 5¢-TCAATGCTCAGGCCACCCAGCG GC-3¢ for H407A The selection restriction ... na614 5¢-CTGCTTACTGGCTTATCGAA-3¢ (forward) and na1106 5¢-GGGTCAAGGAAGGCACGG-3¢ (reverse) The mutants were subcloned into the pCDNA3 vector (Invitrogen) General plasmid constructs The CYP3A4 luciferase...
  • 9
  • 552
  • 0
Báo cáo Y học: The structure of the O-chain of the lipopolysaccharide of a prototypal diarrheagenic strain of Hafnia alvei that has characteristics of a new species under the genus Escherichia pot

Báo cáo Y học: The structure of the O-chain of the lipopolysaccharide of a prototypal diarrheagenic strain of Hafnia alvei that has characteristics of a new species under the genus Escherichia pot

Ngày tải lên : 24/03/2014, 04:21
... trifluoroacetic acid (120 C, h), and monosaccharides identified by GLC as their alditol acetates Sugars were analysed on a Hewlett– Packard 5880 GLC instrument on a DB-5 fused-silica capillary column ... by comparison with the spectra of the O-polysaccharide Figures 3–6 show the COSY, TOCSY, HSQC and HMBC spectra, respectively From the large glycosylation shifts of signals from C- 6 in A, C- 3 ... C →6)-β-D-Galf-(1→3)-β-D-GalpNAc-(1→3)-β-D-Galp-(1→ ↑ α-NeuAc D Ó FEBS 2002 New species under the genus Escherichia (Eur J Biochem 269) 3293 Fig TOCSY spectra of the Hafnia alvei lipopolysaccharide...
  • 7
  • 463
  • 0
Báo cáo lâm nghiệp: "Ecological requirements of some ant species of the genus Formica (Hymenoptera, Formicidae) in spruce forests" pps

Báo cáo lâm nghiệp: "Ecological requirements of some ant species of the genus Formica (Hymenoptera, Formicidae) in spruce forests" pps

Ngày tải lên : 07/08/2014, 10:21
... Latreille, 1798, and Formica truncorum Fabricius, 1804 (Czechowski et al 2002) The aim of the paper is to scientifically describe the occurrence and activity of individual ant species depending on stand ... 1165–1175 Received for publication June 12, 2008 Accepted after corrections September 23, 2008 Ekologické nároky některých druhů mravenců rodu Formica (Hymenoptera, Formicidae) ve smrkových lesích ABSTRAKT: ... kulminovala v červenci Nejvíce jedinců bylo odchyceno na slunnějších stanovištích a na místech s pokryvností vegetace více než 50 % F pratensis byl odchytáván pouze v kulturách a tyčovinách a byl aktivní...
  • 9
  • 467
  • 2
Báo cáo khoa học: "Germination behaviour of 3 species of the genus Pinus in relation to high temperatures suffered during forest fires" pdf

Báo cáo khoa học: "Germination behaviour of 3 species of the genus Pinus in relation to high temperatures suffered during forest fires" pdf

Ngày tải lên : 08/08/2014, 19:21
... significant differences exist between the germination levels of the species and, without taking into account the species, between the treatments themselves (P < 0.001).The interaction species x ... reproductive strat- egy Traditionally, it is considered that this genus has pyrophyte characteristics, although most of its species cannot sprout after fire (Naveh 1974; Trabaud, 1970, 1980) as occurs ... respect to the control, and the same occurred with Pinus contorta (Knapp and Anderson, 1980), Rosmarinus officinalis (Trabaud and Casal, 1989), Cytisus multiflorus (Añorbe, 1988), Acacia cyclops,...
  • 8
  • 258
  • 0
Báo cáo sinh học: "Selection of allozyme genotypes of two species of marine gastropods (genus Littorina) in experiments of environmental stress by nonionic detergent and crude oil-surfactant mixtures" pptx

Báo cáo sinh học: "Selection of allozyme genotypes of two species of marine gastropods (genus Littorina) in experiments of environmental stress by nonionic detergent and crude oil-surfactant mixtures" pptx

Ngày tải lên : 14/08/2014, 20:20
... (25 x 25 x cm) made of perspex These cages were subdivided into smaller interconnected cells (5 x x5 cm) by a plastic net so that water currents could pass freely through all cells Each cell held ... communities has been critically reviewed by Loya & Rinkevitch (1980) They reported a syndrome of oil effects, including complete lack of colonization by hermatypic corals in reef areas chronically polluted ... pollutants Such direct genetic indicators can complement other methods of bio- and chemical monitoring The merit of genetic monitoring is that it alerts us to both the short-and long-term genetic changes...
  • 8
  • 261
  • 0
chemical constituents of some species of the genus garcinia (guttiferae) growing in south viet

chemical constituents of some species of the genus garcinia (guttiferae) growing in south viet

Ngày tải lên : 07/11/2014, 17:25
... compounds SUPERVISORS PhD STUDENT Assoc Prof Pham Dinh Hung Assoc Prof Nguyen Dieu Lien Hoa Vo Tan Hau CONFIRMATION OF HO CHI MINH CITY UNIVERSITY OF SCIENCE THE RECTOR ... Investigating the chemical constituents of three Garcinia species, G pedunculata, G merguensis and G schomburgkiana, and isolating seven compounds which have not been previously reported Part of the ... In addition, cytotoxicity towards two human cell lines, HeLa and NCI-H460, of fourteen isolated xanthones was tested using the SBR assay with camptothecin as the positive control The result...
  • 2
  • 213
  • 0
chemical constituents of some species of the genus garcinia (guttiferae)

chemical constituents of some species of the genus garcinia (guttiferae)

Ngày tải lên : 07/11/2014, 17:25
... Chemistry, Vin Húa Hu c Thng c cao CHCl3 Hi, 25-28/09/2005 Vic phõn lp cht c thc hin bng phng phỏp SKC kt hp vi SKLM trờn c c cht hp ph silica gel, RP18 hay Diol silica Sc ký lc gel c thc hin trờn Sephadex ... 2.3.2 X c nh cu tr c Vic x c nh cu tr c c thc hin bng c c phng phỏp ph (1H v 13 C NMR, HSQC, HMBC kt hp vi UV, IR, HR-MS) cng nh so sỏnh ph c c vi ti liu tham kho 2.3.3 Th nghim hot tớnh gõy c t ... lp cht v s liu ph Trong phn ny chỳng tụi trỡnh by quy trỡnh phõn lp cht t c c cao chit nờu trờn v c c s liu ph thu c Chng KT QU V BN LUN 3.1 Thnh phn húa hc ca v c y ba cng T v c y ba cng chỳng...
  • 14
  • 226
  • 0
dna barcoding gene cytochrome c oxidase subunit i of channa species in the mekong delta

dna barcoding gene cytochrome c oxidase subunit i of channa species in the mekong delta

Ngày tải lên : 17/10/2015, 08:41
... 2.3.2 PCR amplification: The gene COI of DNA mitochondria was amplified using a pair of primers Fish F2-t1: TGTAAAACGACGGCCAGTCGACTAATCATAAAGATATCGGCAC and Fish R2-t1: 5‟CAGGAAACAGCTATGACACTTCAGGGTGACCGAAGAATCAGAA‟3 ... species COI sequences with Genbank No Species Aligned species Identity Channa micropeltes Channa micropeltes 100% Channa gachua Channa gachua 99% Channa striata Channa striata 99% Channa lucius ... The temperature cycles of PCR reaction included 1circle at 95oC in minutes, 35 circles of amplification including 30 seconds at 94oC, 30 seconds at 52oC and 1minute at 72oC, and circle of final...
  • 15
  • 447
  • 0
1500 Test C.pdf

1500 Test C.pdf

Ngày tải lên : 05/08/2012, 12:27
... rate c a chair c a look c b picture c lecture d furniture b how c cow d row b cough c although d rough b only c lone d bone b late c private d date b cheap c chemist d child b book c soon ... Reagan > c 44 We can't reduce the number of nurses a cut back on b cut off on c cut out on d cut out a 45 Put on your coat just ………… it becomes cold a in fact b in time c in order d in case > ... had been coming c has come d has been coming a 29 I tried the bus, but I missed it a catching b to catch c catch d catch up >b 30 Women only began to gain with men in the 20th century a...
  • 428
  • 2.5K
  • 11
Bảo quản thực phẩm

Bảo quản thực phẩm

Ngày tải lên : 11/08/2012, 12:43
... phitin, têch ly c c axit hỉỵu c tỉì c c cacbuahydro dỉåïi t c dủng ca VSV, têch ly c c axit bẹo tỉû tỉì c c cháút bẹo dỉåïi t c dủng ca enzim phitaza C åìng âäü ca c c quạ trçnh ny tàng cng våïi ... th c â åí nhiãût âäü 40 0C v âäü áøm ca khäng khê l 80% Âäúi våïi cháút ca c c tia sạng, våïi c c tia sạng nhçn tháúy thç c c tia c bỉå c sọng ngàõn c t c dủng kêch thêch sáu hải mảnh hån c c ... quanh chäù c ạnh sạng Låi dủng âà c ny ta c thãø tiãu diãût âỉå c sáu hải kho 5/ T c dủng c hc : Sáu mt l nhỉỵng sinh váût c kêch thỉå c âạng kãø nãn chụng dãù bë chãút c c va chảm c hc lục...
  • 104
  • 870
  • 2
Cấu tạo giải phẫu thực vật

Cấu tạo giải phẫu thực vật

Ngày tải lên : 11/08/2012, 12:45
... giải cho pectin làm cho tế bào rời Khi pectin tan nư c cho dung dịch giao trạng nhày cho acid pectic đ c thành ngưng giao (gélée) Pectin → acid pectic + CH3OH Acid pectic chuỗi g c giống glucoz, ... glucoz, acid d-galacturonic làm C c hợp chất pectin nghiên c u sử dụng c ng nghệ th c phẩm 1.4 Gôm chất nhầy C ng hợp chất hydrat carbon vách tế bào, c liên quan với hợp chất pectic c đ c tính ... dụng th c vật cho m c đích sơn, kiến tr c điêu kh c ? Gọi tên mô tả lãnh v c th c nghiệm vi c nghiên c u th c vật CHƯƠNG C U TR C CỦA TẾ BÀO TH C VẬT Từ khoá - Tế bào - Mạng nội chất - S c tố quang...
  • 199
  • 3.1K
  • 12
Phụ gia thực phẩm

Phụ gia thực phẩm

Ngày tải lên : 11/08/2012, 12:48
... GÒN KHOA C NG NGHỆ TH C PHẨM CHƯƠNG DANH M C C C CHẤT PHỤ GIA TH C PHẨM TT Danh m c chất phụ gia Bộ Y tế(QĐ 3742/2001/ BYT ) Tên nhóm phụ gia th c phẩm Ch c năng, c ng dụng C c ch c kh c lượng ... phẩm thạch, E330: acid citric sản phẩm đồ uống c vò chua… C nhiều chất phụ gia mang tính chất ứng dụng kh c loại th c phẩm: chẳng hạn chất chống oxy hoá c chất tan dầu, c chất tan nư c, nhiên ... 422 Glycerol Glycerol Nhũ hóa, ổn đònh, làm dày 450 Canxi dihydro Calcium Điều chỉnh độ axit vii diphosphat Dihydrogen Diphosphate 16 C C CHẤT LÀM RẮN CH C 333 Canxi citrat Calcium Citrates Chống...
  • 165
  • 1.7K
  • 12
Giáo trình thuốc bảo vệ thực vật

Giáo trình thuốc bảo vệ thực vật

Ngày tải lên : 11/08/2012, 13:00
... NG CHƯƠNG I C S ð C CH T H C NÔNG NGHI P Thu c BVTV m t ch t ñ c, nên chương cung c p cho h c viên nh ng khái ni m b n nh t v ch t ñ c, yêu c u c a ch t ñ c dùng nông nghi p phân lo i thu c BVTV ... n b c ng ngh gia c ng, ñóng gói, c ng ngh s n xu t ch t ñ n ph gia cho phép gia c ng ñư c nhi u d ng ch ph m m i, ñáp ng ñư c yêu c u qu n lý thu c BVTV ngày ch t ch c a qu c gia t ch c qu c t ... u h t thu c tr nh n thông d ng hi n ñ u c t c d ng ti p x c ð i ña s thu c nhóm nh ng thu c ñ c hi u c t c d ng di t nh n, c kh ch n l c cao, gây h i cho c n trùng c ích thiên ñ ch Nhi u lo...
  • 13
  • 3.5K
  • 37
Công nghệ chế biến thực phẩm đóng hộp

Công nghệ chế biến thực phẩm đóng hộp

Ngày tải lên : 11/08/2012, 13:01
... quát C đ c làm b cc sản phẩm c ch đun sôi Quá trình c đ c sử dụng nhiều c ng nghiệp đồ hộp để sản xuất c chua c đ c, mứt, nư c cô đ c, loại soup khô, sữa đ c M c đích C đ c nhằm m c đích: ... Chần làm giảm chất c mùi vị không thích hợp vị đắng (măng, c tím) hợp chất lưu huỳnh (rau c i, c i bắp, gia c m) - Làm cho rau c màu sáng phá hủy số chất màu Khi chần dung dịch acid citric ... chế biến sauce số đồ hộp thịt, c - Đồ hộp nư c rau: C c loại đồ hộp nư c giải khát (c chứa nhiều chất dinh dưỡng) Đư c chế biến từ loại rau, c làm nư c uống 3.2 C c loại đồ hộp chế biến từ...
  • 127
  • 1.4K
  • 7
Phương pháp kiểm nghiệm vi sinh vật trong thực phẩm

Phương pháp kiểm nghiệm vi sinh vật trong thực phẩm

Ngày tải lên : 11/08/2012, 13:02
... polysaccharide C6 H12O6 Glucose CH3COCOOH Acid pyruvic CH3CHOHCOOH Acid lactic CH3COOH HOOCH2CH2COOH Acid acetic Acid succinic + HCOOH Acid formic H2 + CO2 CH3CH2COOH + CO2 CH3CHO + CO2 Acid propyonic ... propyonic Acetaldehyde CH3COCHOHCH3 + CO2 CH3CH2OH Acetylmethylcarbinol Ethyl alchol CH3CHOHCHOHCH3 2,3-Butylence glycol CH3COOH Acid acetic CH3COCH2COOH Acetoacetic acid CH3CH2CH2COOH CH3COCH3 CO2 ... c chế c nh tranh c u tr c phân tử malonic succinic tương tự COOH COOH CH2 (CH2)2 COOH COOH Acid malonic Acid succinic Khi bò malonate c chế đường thu hồi lượng chu trình Krebs, vi sinh vật chuyển...
  • 56
  • 1.8K
  • 12
Chất lượng và vệ sinh an toàn thực phẩm

Chất lượng và vệ sinh an toàn thực phẩm

Ngày tải lên : 11/08/2012, 13:06
... v c C c công ty tìm kiếm hỗ trợ từ tổ ch c tin c y để giúp họ th c hệ thống HACCP để trở thành c ng ty c p chứng HACCP Lý th c HACCP - HACCP th c công c c hiệu bảo đảm an toàn th c phẩm, c ... 867/1998/QĐ–BYT, nhóm chất phụ gia là: - C c chất phụ gia bảo quản - C c chất chống oxy hóa - C c chất phụ gia điều hòa độ acide - C c chất phụ gia gây nhũ hóa - C c chất phụ gia ổn định - C c chất phụ gia ... hoạch HACCP Nguyên t c 7: X c lập thủ t c thẩm định Một chương trình HACCP xây dựng c ng phu, đảm bảo nguyên t c đầy đủ bư c chưa thể khẳng định chương trình HACCP áp dụng c ch c hiệu Do vậy, c n...
  • 74
  • 1.6K
  • 9
Thực hành công nghệ lên men

Thực hành công nghệ lên men

Ngày tải lên : 11/08/2012, 13:16
... men chìm c) Nấm men dại d) Phụ gia Làm giảm độ c ng nư c: Al2(SO4)3, CaSO4; Điều chỉnh pH = H2SO4, acid lactic, CaCl2 Chất chống oxy hóa: acid ascorbic Chất tạo màu: caramen III Yêu c u chất ... (Yoghurt Science and Technology) iii) C c hợp chất tạo hương 35 Acetaldehyde Diacetyl II Yêu c u chất lượng yoghurt: Bảng – C c tiêu c m quan sữa chua Tên tiêu Màu s c Yêu c u Màu trắng sữa màu đ c trưng ... bình chứa 3,5% chất béo; 3,4% protein, 4,8% lactose 2) Giống vi khu n lactic Vi khuNn lên men lactic: chủ yếu Lactobacillus delbrueckii subsp bulgaricus (LB) Streptococcus thermophilus (ST) Lactobacillus...
  • 40
  • 1.4K
  • 8