sp c structure and function

Tài liệu Báo cáo khoa học: Interaction between very-KIND Ras guanine exchange factor and microtubule-associated protein 2, and its role in dendrite growth – structure and function of the second kinase noncatalytic C-lobe domain docx

Tài liệu Báo cáo khoa học: Interaction between very-KIND Ras guanine exchange factor and microtubule-associated protein 2, and its role in dendrite growth – structure and function of the second kinase noncatalytic C-lobe domain docx

... Japanese Ministry of Education, Culture, Sports, Science and Technology; the Japan Society for the Promotion of Science; and the Japan Science and Technology Agency References 13 14 15 Pawson T ... CD2-1-4 CD2-1-5 735 CD2-1-6 702 CD2-1-7 668 CD2-1-8 635 CD2-1-6-1 702 CD2-1-6-2 CD2-1-6-3 Interaction PD Input GST CD2-1-1 CD2-1-2 CD2-1-3 CD2-1-4 CD2-1 767 250 150 PD 734 Input GST CD2-1-5 CD2-1-6 ... EGFP fluorescence and immunocytochemical staining with anti-Flag or anti-HA sera Cell images were acquired by confocal microscopy (LSM510; Carl Zeiss, Inc., Oberkochen, Germany) Morphometric analysis...

Ngày tải lên: 14/02/2014, 19:20

11 659 0
Báo cáo khoa học: NMR solution structure and function of the C-terminal domain of eukaryotic class 1 polypeptide chain release factor pdf

Báo cáo khoa học: NMR solution structure and function of the C-terminal domain of eukaryotic class 1 polypeptide chain release factor pdf

... chain factors, eukaryotic class polypeptide chain release factor (eRF1) and eukaryotic class polypeptide chain release factor (eRF3) The major functions of eRF1 include recognition of each of the ... NMR structure and function of the eRF1 C- domain Fig Slices from a 15N-HSQC-NOESY spectrum measured at 298 K The NOEs involving protons of residues from the open conformer (A, C) and closed conformer ... NMR spectroscopy All spectra were acquired on Varian INOVA 600 and 800 MHz and Bruker AVANCE 600 and 700 MHz spectrometers equipped with triple-resonance z-gradient probes The 700 and 800 MHz spectrometers...

Ngày tải lên: 06/03/2014, 11:20

17 491 0
Tài liệu Báo cáo khoa học: Structure and function of active chromatin and DNase I hypersensitive sites pdf

Tài liệu Báo cáo khoa học: Structure and function of active chromatin and DNase I hypersensitive sites pdf

... 6, repressed CG islands are likely to be maintained in an inactive state DNMT3L Tet1 Cfp1 MLL1 CXXC CG CXXC CG CXXC CG CG TF? Tet2 Me3K4 H3 Ac Set1 Pol II CCCCGCCCC Sp1 H3 CG CXXC K36 KDM2A TAF ... compilation ª 2011 FEBS P N Cockerill Active chromatin and DNase I hypersensitive sites Active CG island TDG OH meC + meC ? DNMT3L Set1 Tet1 CXXC CG DNMT3 MLL1 CXXC CG OH Me CG Cfp1 CXXC CG CG ... CG CXXC H3 Ac TF K36 KDM2A ? Tet2 H3 MBD4 Me Repressed CG island HMT CXXC DNMT KDM2A HMT HP1 OH Me CG Me3K9 H3 Me CG Me CG Me CG HP1 Me3K9 MBD Me CG H3 Me CG HDAC TF Tet2 CXXC Ac HDAC MLL1 Active...

Ngày tải lên: 14/02/2014, 18:20

29 743 0
Tài liệu Body Size: The Structure and Function of Aquatic Ecosystems pptx

Tài liệu Body Size: The Structure and Function of Aquatic Ecosystems pptx

... variation (phenotypic plasticity and changes during ontogeny) to differences among ecological functional groups that affect ecosystem function and biogeochemistry Specifically, the chapter first outlines ... Kerr & Dickie, 2001) Nearly all characteristics of organisms, from their structure and function at molecular, cellular and whole-organism levels to ecological and evolutionary dynamics, are correlated ... Hydropsyche siltalai and the accuracy of capture efficiency estimates Freshwater Biology, 50, 113–126 Cardinale, B J., Palmer, M A & Collins, S L (2002) Species diversity enhances ecosystem functioning...

Ngày tải lên: 17/02/2014, 19:20

357 2K 0
Tài liệu Báo cáo khoa học: Structure and function of plant aspartic proteinases pptx

Tài liệu Báo cáo khoa học: Structure and function of plant aspartic proteinases pptx

... the C- terminal region Nucellin-like Acidic-hydrophobic-DTG-serine-acidic Cys-rich sequence between Asp32 and Tyr75 QCYDE before Tyr75 Atypical Hydrophobic-hydrophobic-DTG-serine-acidic Cys-rich ... (solid line) and the plant speci c insert (shaded grey) are highlighted The catalytic aspartic acid residues are boxed Cardosin A and cardosin B were purified from C carduncu25 lus L (accession numbers: ... Kolaczkowska, M.K., Wieczorek, M & Wilimowska-Pelc, A (1985) Purification and characterization of aspartic proteinases from Cucumis sativus and Cucurbita maxima seeds In Aspartic Proteinases and...

Ngày tải lên: 19/02/2014, 12:20

9 605 0
Tài liệu Báo cáo khoa học: a-Conotoxins as tools for the elucidation of structure and function of neuronal nicotinic acetylcholine receptor subtypes doc

Tài liệu Báo cáo khoa học: a-Conotoxins as tools for the elucidation of structure and function of neuronal nicotinic acetylcholine receptor subtypes doc

... structure and function Sequencea GCCSDPRCAWR C ACCSDRRCRWR C GCCSLPPCAANNPDYC GCCSLPPCALNNPDYC GCCSLPPCAASNPDYC GCCSLPPCALSNPDYC GCCSDPRCNMNNPCYC GCCSNPVCHLEHSNLC a-Conotoxin ImI ImII PnIA [A10L]PnIA ... GGCCSHPACAANNQDYC IRDcCCSNPACRVNNOHVC GID AnIB GCCSHPACAGNNQHIC GIC RDPCCSNPVCTVHNPQIC GCCSYPPCFATNPD -C AuIB (ribbon) PIA GCCSYPPCFATNPD -C [125I]MII AuIB [125I]YGCCSNPVCHLEHSNLC a-Conotoxin Table (Continued) ... [61] Consensus sequence Side chain in position 10 CAGNNQ CAANNQ –H –CH3 CAANNP CAASNP CAVNNO CRVNNO –CH–(CH3)2 CALNNP CALSNP –CH2–CH–(CH3)2 CNMNNP –CH2–CH2–S–CH3 2312 A Nicke et al (Eur J Biochem...

Ngày tải lên: 19/02/2014, 12:20

15 758 0
Tài liệu Báo cáo khoa học: Cold survival in freeze-intolerant insects The structure and function of b-helical antifreeze proteins pdf

Tài liệu Báo cáo khoa học: Cold survival in freeze-intolerant insects The structure and function of b-helical antifreeze proteins pdf

... temperature cause changes in the structure of the insect AFPs and to further characterize the TXT face of these proteins, the backbone dynamics of TmAFP and sbwAFP were measured at 30 C and C [38,40] ... (supported by CIHR and Natural Science and Engineering Research Council of Canada through the Protein Engineering Network of Centres of Excellence, Inc.; B D S) S P G is the recipient of a CIHR Fellowship ... antifreeze and mechanism of adsorption to ice Biochim Biophys Acta 495, 388–392 20 Knight, C. A., Cheng, C. C & DeVries, A.L (1991) Adsorption of alpha-helical antifreeze peptides on speci c ice crystal...

Ngày tải lên: 19/02/2014, 16:20

12 717 0
Báo cáo khoa học: Evolutionary changes to transthyretin: structure and function of a transthyretin-like ancestral protein doc

Báo cáo khoa học: Evolutionary changes to transthyretin: structure and function of a transthyretin-like ancestral protein doc

... (E .C 3.5.2) Other cyclic amidohydrolases include hydantoinase, allantoinase and dihydrooratase [32] Cyclic amidohydrolases share a number of physicochemical characteristics These characteristics ... Chromohalobacter salexigens DSM3034 Acinetobacter sp (strain ADP1) Pseudomonas fluorescens Pf5 ATCC BAA-477 Actinobacteria, Actinobacteria Proteobacteria, Alphaproteobacteria Proteobacteria, Alphaproteobacteria ... the remarkable conservation of the prealbumin-like fold (as described by SCOP, http://scop.mrc-lmb.cam.ac.uk), which consists of an eight-stranded b-sandwich (strands A-H) with each sheet adopting...

Ngày tải lên: 07/03/2014, 00:20

13 390 0
Báo cáo khoa học: Structure and function of KH domains docx

Báo cáo khoa học: Structure and function of KH domains docx

... PCB1 KH2 PCB1 KH3 PCB2 KH1 PCB2 KH2 PCB2 KH3 PCB3 KH1 PCB3 KH2 PCB3 KH3 PCB4 KH1 PCB4 KH2 PCB4 KH3 PCB1 KH1 PCB1 KH2 PCB1 KH3 PCB2 KH1 PCB2 KH2 PCB2 KH3 PCB3 KH1 PCB3 KH2 PCB3 KH3 PCB4 KH1 PCB4 ... crystal structures Specifically, the binding cleft is occupied by the tetrad 5¢-CCCT-3¢, with direct water-mediated contacts stabilizing the last two bases, and protein nucleic acid contacts to two additional ... SF1–DNA complex and the hnRNP K KH3 domain–DNA complex are lm and lm, respectively [22,23] The clustering of KH domains increases nucleic acid recognition and specificity [24]; the four tandem KH...

Ngày tải lên: 07/03/2014, 05:20

15 405 0
Báo cáo khoa học: Structure and function of N-acetylglucosamine kinase Identification of two active site cysteines pptx

Báo cáo khoa học: Structure and function of N-acetylglucosamine kinase Identification of two active site cysteines pptx

... C2 11S 5¢-GATGGCTCCGAGAGTGGCAGTGGAGGCTGGGG 5¢-CCCATTTGTATAGGGACTTTGATAAAAGTAAG C2 17S 5¢-GCTGGATTTAGTCAGAAAATTGCAGAAGGTG C2 68S 5¢-CCCATTCTGAGTGTGGGCTCAGTGTGG TGATGG TTTGCTGGATTTTGCCAGAAAATTGC CACATCAGGG ... kinase cysteine mutants by site-directed mutagenesis Mismatches with the template are underlined Name Sequence C4 5S C1 31S 5¢-GGCACAGACCAGAGTGTGGAGAGGATCAATGAG 5¢-GGAACAGGCTCCAACAGTAGGCTTATCAACCC C1 43S ... sequence homology, but always within the common secondary structure: C4 5GlcNAc kinase – C1 29Glucokinase (a-helix); C1 31GlcNAc kinase – C2 33Glucokinase (b-sheet); C1 43GlcNAc kinase – C2 52Glucokinase...

Ngày tải lên: 08/03/2014, 10:20

7 421 0
Day one nucleic acid structure and function

Day one nucleic acid structure and function

... GATCGTCCAGAATGCGCCATGGACTCTGTCCGATGAATTCATCGCCGACAACAAAATCGACTT TGTGGCCCACGACGACATTCCGTATGTAACCGATGGCATGGACGACATCTATGCTCCTCTCAA GGCGCGCGGCATGTTTGTGGCCACGGAGCGCACTGAGGGTGTGTCCACCTCGGACATCGTAGC CCGGATCGTCAAGGATTACGATCTGTATGTGCGTCGTAATCTGGCCAGAGGCTATTCGGCCAA ... PCR sequences htgs High Throughput Genomic Sequences Nucleic Acid Sequence What does it encode? CGTGATGAACGGCTTCGAGCGATACGAGGGAGTGCGTCACTGCCGCTATGTGGACGAGTTGCA GATCGTCCAGAATGCGCCATGGACTCTGTCCGATGAATTCATCGCCGACAACAAAATCGACTT ... 5’-TACGGTACTGTGCTCGAGCACTGCTGTACT-3’ 3’-ATGCCATGACACGAGCTCGTGACGACATGA-5’ central axis Protein – DNA interaction Proteins often bind to specific sequences of DNA Example: Restriction enzyme EcoRI...

Ngày tải lên: 13/03/2014, 16:42

105 2,1K 0
Cell Structure and Function Functi

Cell Structure and Function Functi

... eukaryotic cells   Typical prokaryotic cell is Prokaryotic cells NOT have: • Nucleus • Membrane bound organelles Prokaryotic Cell Structure  Structures       Plasma membrane Cell wall Cytoplasm ... Nucleoid Capsule* Flagella* and pili* *present in some, but not all prokaryotic cells Prokaryotic Cell TEM Prokaryotic Cell Eukaryotic Cells  Structures in all eukaryotic cells      Nucleus ... Chapter Outline  Cell theory  Properties common to all cells    why are cells so small? Prokaryotic cells Eukaryotic cells Cell size and shape –    Organelles and structure in...

Ngày tải lên: 13/03/2014, 19:31

80 3,1K 0
CELLS Structure and Function Structure and Function

CELLS Structure and Function Structure and Function

... Functions of Eukaryotic Cell Features Structure Mitochondrion Function Captures energy from organic molecules, producing ATP Functions of Eukaryotic Cell Features Structure Function Chloroplast Photosynthesis: ... some cell types Functions of Eukaryotic Cell Features Structure Function Centriole Gives rise to basal bodies that produce cilia or flagella Functions of Eukaryotic Cell Features Structure Function( s) ... Prokaryotic Cells All prokaryotic cells contain Structure Plasma Membrane Function Regulates flow of substances into and out of cell Nucleoid Cytoplasmic region containing genetic material Cytoplasm Cytosol:...

Ngày tải lên: 13/03/2014, 19:31

31 1,3K 0
Báo cáo khoa học: Plant oxylipins: Plant responses to 12-oxo-phytodienoic acid are governed by its specific structural and functional properties ppt

Báo cáo khoa học: Plant oxylipins: Plant responses to 12-oxo-phytodienoic acid are governed by its specific structural and functional properties ppt

... Lipoxygenases: occurrence, functions and catalysis J Plant Physiol 163, 348–357 12 Schewe T (1998) Basic functions of lipoxygenases and their products in higher plants In Eicosanoids and Related Compounds ... development and response to biotic and abiotic stress Proc Natl Acad Sci USA 92, 4114–4119 Hause B, Demus U, Teichmann C, Parthier B & Wasternack C (1996) Developmental and tissue-speci c expression ... transgenic tobacco cell culture By contrast, JA–Ile treatment had no detectable effect on the cellular Ca2+ content of the examined cell culture system [44] Although OPDA and JA both contribute...

Ngày tải lên: 16/03/2014, 02:20

12 416 0
Báo cáo khoa học: Separation and characterization of caveolae subclasses in the plasma membrane of primary adipocytes; segregation of specific proteins and functions docx

Báo cáo khoa học: Separation and characterization of caveolae subclasses in the plasma membrane of primary adipocytes; segregation of specific proteins and functions docx

... microfilaments [28] HD-caveolae as sites of fatty acid uptake and triacylglycerol synthesis We have previously used biochemical analysis, fluorescence confocal microscopy and electron microscopy ... VHD-caveolae and HD-caveolae and LD-caveolae; and (e) closed caveolae without cell surface access have been demonstrated in the plasma membrane by electron microscopy [5] We not know the function ... identification [5] of two morphologically distinct classes of caveolae at the plasma membrane ) canonical caveolae that are open to the extracellular space and caveolae lacking access from the cell...

Ngày tải lên: 16/03/2014, 13:20

12 460 0
Báo cáo khóa học: S-(2,3-Dichlorotriazinyl)glutathione A new affinity label for probing the structure and function of glutathione transferases potx

Báo cáo khóa học: S-(2,3-Dichlorotriazinyl)glutathione A new affinity label for probing the structure and function of glutathione transferases potx

... the PCRs were as follows: Phe51Ala mutation, 5¢-CGGAACCCCGCAGGTCGAGTTTCC-3¢ and 5¢-GA CGAGGTGCTCGGGGCTCTT-3¢; Met121Ala mutation, 5¢-ATCAGTCCGGCACTTGGGGGAACC-3¢ and 5¢-GAGGACGTCGAAGAGGATGGGTTACAG-3¢ ... acetonitrile and 90% (v/v) water containing trifluoroacetic acid (0.1%, v/v) The purity of the product was assessed by ascending analytical TLC on silica gel 60 plates with a fluorescent indicator, ... was stored desiccated at )20 C The course of the reaction was followed and the products were analysed by ascending analytical TLC on silica gel 60 plates with a fluorescent indicator, using the...

Ngày tải lên: 16/03/2014, 16:20

9 557 0
Báo cáo khoa học: Multiple effects of DiS-C3(5) on mitochondrial structure and function pot

Báo cáo khoa học: Multiple effects of DiS-C3(5) on mitochondrial structure and function pot

... of DiSC3(5) on the spontaneous acceleration of mitochondrial Ó FEBS 2004 Effects of DiS -C on mitochondrial structure and function (Eur J Biochem 271) 3577 Fig Inhibitory effects of a low concentration ... DiS -C3 (5) £ 10 lM caused deceleration of mitochondrial oxygen consumption but > 20 lM caused acceleration These actions of DiS -C3 (5) on Ó FEBS 2004 Effects of DiS -C on mitochondrial structure and ... of DiS -C3 (5) on mitochondrial structure and function in the absence of Pi Where Ca2+ had no effect on the mitochondrial oxygen consumption in the absence of Pi, DiS -C3 (5) moderately accelerated...

Ngày tải lên: 16/03/2014, 18:20

7 481 0
Báo cáo khoa học: Human haptoglobin structure and function – a molecular modelling study pptx

Báo cáo khoa học: Human haptoglobin structure and function – a molecular modelling study pptx

... (1993) PROCHECK: a program to check the stereochemical quality of protein structures J Appl Cryst 26, 283–291 Gaboriaud C, Rossi V, Bally I, Arlaud GJ & Fontecilla-Camps JC (2000) Crystal structure ... secondary -structure elements The HPT1 covalent dimer and the HPT2 covalent trimer were constructed using the molecular graphics package Discovery Studio visualizer 1.7 (Accelrys Software Inc., ... above-described procedure were stereochemically regularized through energy minimization using the CHARMM macromolecular mechanics package [41], c3 3b1 version, and the CHARMM27 parameters and force...

Ngày tải lên: 23/03/2014, 06:20

9 363 0
Báo cáo khoa học: Quaternary structure and functional properties of Penaeus monodon hemocyanin docx

Báo cáo khoa học: Quaternary structure and functional properties of Penaeus monodon hemocyanin docx

... Pan in B Pan in C Cal sa Can ma C I NS NS C I NS C I C* C* NS NS C NS C C NS I* C NS C C NS NS NS C C I NS NS C I + + NS C I I NS I* a and b [9] The two subunits exhibit 96% sequence similarity, ... Molecular cloning of hemocyanin cDNA from Penaeus vannamei (Crustacea, Decapoda): structure, evolution and physiological aspects FEBS Lett 407, 153–158 41 Mangum CP & Weiland AL (1975) The function ... Met-Asp Met-Asp Met-Asp Met-Asp Met-Asp Met-Asp Met-Asp Met-Asp Gln-Asp Thr-Ser Thr-Ser Thr-Asp Thr-Asp Thr-Asp Thr-Ser Thr-Ser Thr-Ser Thr-Ser Thr-Ser Thr-Glu Thr-Asp Thr-Asp Thr-Asp Thr-Asp Thr-Asp...

Ngày tải lên: 23/03/2014, 13:20

16 394 0
Báo cáo khoa học: N1 – IUBMB 50th Anniversary Symposium: Protein Structure and Function potx

Báo cáo khoa học: N1 – IUBMB 50th Anniversary Symposium: Protein Structure and Function potx

... and VEIDase activities, corresponding to caspase-3 and caspase-6 respectively Immunofluorescence microscopy revealed increased levels of caspase-6, and the active form of caspase-3, in speci c ... contrast, DCA and TDCA induced apoptosis but did not significantly change cyclin D1 and E-cadherin proteins, or cyclin D1 transcriptional activation In conclusion, cyclin D1 and E-cadherin may ... membrane loss, cytochrome c mitochondrial release, and caspase-9 activation, which tightly binds to Apaf-1 Active caspase-9 activates in turn cell death effector caspase-3, which cleaves PARP,...

Ngày tải lên: 23/03/2014, 15:20

64 544 0
w