rus and the rise of muscovy c 900 1462

Territorial law and the rise of the state

Territorial law and the rise of the state

... century, the Court of Star Chamber was also born of King’s Council, which followed the Continental inquisitorial form of procedure used by the council.63 The doctrines and procedures of the Chancellor’s ... development of European kingdoms61 and the common legal science.62 By the end of the fifteenth century, the King’s Council, which had come to handle more of the judicial business of the type which had ... in their ability to act independently of each other, with their own laws, councils and bureaucracies In the absence of a society of states, the papacy was otherwise the appropriate arbiter of the...

Ngày tải lên: 01/11/2013, 08:20

29 653 0
ROUTLEDGE STUDIES IN SCIENCE, TECHNOLOGY AND SOCIETY: Human-animal relations and the rise of veterinary medicine pot

ROUTLEDGE STUDIES IN SCIENCE, TECHNOLOGY AND SOCIETY: Human-animal relations and the rise of veterinary medicine pot

... reduced—animal use within the biomedical and life sciences remains commonplace Irrespective of changes in attitudes and scientific practices, the scientific and medical research community still have ... SCIENCE, TECHNOLOGY AND SOCIETY SCIENCE AND THE MEDIA Alternative routes in scientific communication Massimiano Bucchi ANIMALS, DISEASE AND HUMAN SOCIETY Human-animal relations and the rise of ... research has cast considerable doubt on whether such drought and the Domestication, dependency and disease 21 creation of oases actually occurred at the end of the Pleistocene (Cohen 1977:8) Since...

Ngày tải lên: 06/03/2014, 16:20

204 432 0
hindenburg power myth and the rise of the nazis nov 2009

hindenburg power myth and the rise of the nazis nov 2009

... era, such as the myths of Bismarck or Hermann the Cherusker in the Weimar years, are confined to the realm of discourse and commemoration Thus, their capacity as projection screens for contemporary ... for the war on August 1914 was the logical consequence of their repugnance of tsarist autocracy, a cornerstone of Marxist ideology and a Social Democratic ‘article of faith’, as well as the result ... polyvalent in their form.⁴³ Their function is not always clear-cut It can, in fact, vary considerably depending on the respective social and political context in which they surface Myths can thus create...

Ngày tải lên: 11/06/2014, 05:38

342 1,1K 0
religious rivalries in the early roman empire and the rise of christianity apr 2006

religious rivalries in the early roman empire and the rise of christianity apr 2006

... without the prior written consent of the publisher or a licence from The Canadian Copyright Licensing Agency (Access Copyright) For an Access Copyright licence, visit www.accesscopyright.ca or call ... practices of ancient paganism Nonetheless, Nock is quite untrustworthy, in my opinion, in his evaluation of the significance of the difference between these concerns and practices and those of the ... fifth and final chapter of this section, whether the explicit focus on rivalry, in fact, does not skew or obscure our understanding of ancient social life This includes, of course, the practice of...

Ngày tải lên: 11/06/2014, 13:29

345 308 0
Báo cáo y học: "Introduction of oral vitamin D supplementation and the rise of the allergy pandemic" docx

Báo cáo y học: "Introduction of oral vitamin D supplementation and the rise of the allergy pandemic" docx

... rickets Connecting the dots A temporal coincidence of an exposure and outcome like the reported association above cannot provide any proof of causality although it may be seen as another piece ... or cure of coughs and colds in both the old and young" - effects rediscovered only in 1941 [12] and again in 2006 [13] Rickets was a common disease in Europe and North America at the end of the ... Greenland, and Iceland according to a historical review [11] The reason may be the way cod liver oil was produced Because cod livers and gall-bladders could not be sold on the fish market, the...

Ngày tải lên: 08/08/2014, 21:20

5 517 1
Hindu nationalism and the rise of caste based parties in north india (1984 2004)

Hindu nationalism and the rise of caste based parties in north india (1984 2004)

... progress of the BJP, and the character of Hindu nationalism Primarily, the discourse has centered on the discrepancy between the upper-caste nature of the BJP’s character and composition, and the ... The impact of these factors on the party’s strategy and functioning, and the depth of these changes helps to better understand the multi-faceted nature of the caste challenge, and the BJP’s calibre ... of religious solidarity This was on account of the continued dependence on the rhetoric of the “Other” and Hindu-Muslim antagonism, the constricted focus of which was challenged by the rise of...

Ngày tải lên: 22/10/2015, 21:08

139 710 0
Báo cáo khoa học: The essential tyrosine-containing loop conformation and the role of the C-terminal multi-helix region in eukaryotic phenylalanine ammonia-lyases docx

Báo cáo khoa học: The essential tyrosine-containing loop conformation and the role of the C-terminal multi-helix region in eukaryotic phenylalanine ammonia-lyases docx

... [33] and Bacillus subtilis [34], respectively On the basis of the functional similarity of HAL and PAL, of the same electrophilic prosthetic group at the active sites, and of the sequence conservation ... Results and discussion Modeling the active conformation of the essential Tyr110-loop of parsley PAL Because of the uncertainty of the arrangement and the role of the essential Tyr110-loop in recent ... isolated microsomes from tobacco stems or cell suspension cultures, it has been proposed that metabolic channeling of (E)-cinnamic acid requires the close association of speci c forms of PAL with C4 H...

Ngày tải lên: 07/03/2014, 12:20

16 502 0
By Pike and Dyke: A Tale of the Rise of the Dutch Republic pdf

By Pike and Dyke: A Tale of the Rise of the Dutch Republic pdf

... English Character set encoding: ASCII *** START OF THE PROJECT GUTENBERG EBOOK, BY PIKE AND DYKE: A TALE OF THE RISE OF THE DUTCH REPUBLIC *** By Pike and Dyke: A Tale of the Rise of the Dutch Republic ... altars and carvings, and tore up the vestments, and threw down the Manes and the saints, and then did the same in the other churches in the town and in the country round, they behaved worse than children, ... defensive, and relying solely upon the justice of their cause, their own stout hearts, their noble prince, and their one ally, the ocean Cruelty, persecution, and massacre had converted this race of...

Ngày tải lên: 08/03/2014, 12:20

186 489 0
Báo cáo " Long-term sediment distribution calculation taking into account sea level rise and the development of Day estuary " potx

Báo cáo " Long-term sediment distribution calculation taking into account sea level rise and the development of Day estuary " potx

... by 4258cm at the end of the century To the scenario B2, the sea level could rise by 20-24cm and by 49-65cm, respectively Under high emissions scenario A1FI, sea level could rise by 22-27 cm by ... Journal of Science, Natural Sciences and Technology 28, No 3S (2012) 57-62 According to the low emission scenario (B1), sea level in the Day estuary could rise by 19-23 cm by middle 21st century, and ... Figure shows the increasing trend of water level (red line) Magnitude of the increase is consistent with the increase projected in the sea level rise scenarios in section 5.4 Calculation of sediment...

Ngày tải lên: 10/03/2014, 18:20

6 463 0
Quantum information theory and the foundations of quantum mechanics  c  timpson

Quantum information theory and the foundations of quantum mechanics c timpson

... known technical concept of information, the Shannon information, along with some closely related concepts from classical and quantum information theory The technical concepts of these other flavours ... associated with individual messages, but rather characterises the source of the messages The point of characterising the source is to discover what capacity is required in a communications channel ... all the messages the source produces; and it is for this that the concept of the Shannon information is introduced The idea is that the statistical nature of a source can be used to reduce the capacity...

Ngày tải lên: 17/03/2014, 14:42

250 1,3K 0
RISE OF THE AESTHETIC EXPERIENCE AND THE PROCESS OF GLOBALIZATION ppt

RISE OF THE AESTHETIC EXPERIENCE AND THE PROCESS OF GLOBALIZATION ppt

... caused, on the one hand, the subjectivization of the aesthetic object and, on the other, the specialization of aesthetics in issues of aesthetics of art Namely, art, just like the beautiful and ... with a certain proliferation of aesthetic contents we cannot conclude that this at the same time means the rise of aesthetic values or the success of aesthetic education or the flourishing of art, ... epigonic, mass-produced and heteronymous production of the aesthetic artifacts The rise of aesthetic experience can, therefore, be seen through the prism of aestheticization, which is, simply, the...

Ngày tải lên: 23/03/2014, 13:20

8 499 0
Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx

Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx

... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCA CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTGACCATTGTCCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTTCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTTCCTATGTGCTGACTCAGCCACC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCACGTTATACTGACTCAACCGCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGGCTGTGCTCACTCAGCCGTC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCA ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGCTCGTGTTGACGCAGCCGCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGTCTGCCCTGACTCAGCCTGC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTTCTTCTGAGCTGACTCAGGACCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTTCCTATGTGCTGACTCAGCCACC...

Ngày tải lên: 23/03/2014, 13:20

11 680 0
THE RISE OF CANADA, FROM BARBARISM TO WEALTH AND CIVILISATION potx

THE RISE OF CANADA, FROM BARBARISM TO WEALTH AND CIVILISATION potx

... Burton—District of St Francis 383 The Civil List 384 "Times" Libel—Emptiness of the Public Chest 385 The Finances the Receiver General 386 The Lachine and Chambly Canals 387 The prorogation—Union of the ... by the Crown, and for a council of advice he had a Vicar Apostolic and five others, one of whom was a kind of Inspector General, and another a Receiver General To this Governor and Council the ... thousand pages of foolscap and brought to a conclusion the first rebellion Then the work of printing was begun, and the correction of all the proofs together with the editorial management of a...

Ngày tải lên: 29/03/2014, 02:21

364 340 0
Designation: C 183 – 97 - Sampling and the Amount of Testing of Hydraulic Cement1 pps

Designation: C 183 – 97 - Sampling and the Amount of Testing of Hydraulic Cement1 pps

... masonry cement (Specification C 91), portland cement (Specification C 150), blended hydraulic cement (Specification C 595), and expansive hydraulic cement (Specification C 845) 4.3 Most building codes and ... and the vertical scale will be the range Where the range chart indicates lack of control (points beyond the upper control limit), the critical limit, C, may need to be recalculated Consider the ... and construction specifications require that hydraulic cement to be used in the work meet the applicable requirements of the relevant purchase specifications, such as Specifications C 91, C 150, C...

Ngày tải lên: 10/07/2014, 23:20

6 380 0
Báo cáo khoa học: "Ethnic and geographical differences in HLA associations with the outcome of hepatitis C virus infection" pot

Báo cáo khoa học: "Ethnic and geographical differences in HLA associations with the outcome of hepatitis C virus infection" pot

... presenting cells or on infected cells such as hepatocytes CD8 or CD4 T cells can recognize the complex of HLA- class I peptides or class II peptides and act as either effector T cells, helper T cells, ... comparisons, the persistent HCV-infected group was treated as cases and the clearance group as controls Caucasians comprised 46.9% of the clearance group and 58.9% of the persistent group, respectively ... Americans, including the protective association of HLA-A*03, A*11, B57, Cw*01, Cw*05 and the risk association of Cw*04 to HCV infection were statistically significant in both Caucasians and non-Caucasians...

Ngày tải lên: 12/08/2014, 04:21

8 499 0
Báo cáo y học: "Endogenous plasma activated protein C levels and the effect of enoxaparin and drotrecogin alfa (activated) on markers of coagulation activation and fibrinolysis in pulmonary embolism." ppt

Báo cáo y học: "Endogenous plasma activated protein C levels and the effect of enoxaparin and drotrecogin alfa (activated) on markers of coagulation activation and fibrinolysis in pulmonary embolism." ppt

... such as occurrence of bleeding The incidence of major bleeding was low and within the expected range for therapeutic dose enoxaparin alone One of the two cases of severe bleeding occurred in the ... thrombolytic drugs, surgical or catheter embolectomy, occurrence of allergic reactions, diagnosis or heparin-induced thrombocytopenia type (HIT-2), other types of thrombocytopenia, worsening of symptoms ... endogenous activated protein C, despite a high level of coagulation activation and presence of intact endothelium • Treatment with therapeutic dose enoxaparin reduces the level of coagulation activation,...

Ngày tải lên: 14/08/2014, 07:21

10 335 0
Cambridge.University.Press.Gender.Race.and.the.Writing.of.Empire.Public.Discourse.and.the.Boer.War.Sep.1999.pdf

Cambridge.University.Press.Gender.Race.and.the.Writing.of.Empire.Public.Discourse.and.the.Boer.War.Sep.1999.pdf

... the concept of public opinion was shifting, as class dynamics changed, as the franchise was extended, and as access to education expanded The most concrete example of the shift in ways of accounting ... –) While The War in South Africa approached the particulars of the Boer War with the eye of a journalist, concerned with the specifics on the spot, such as the role of the Boer police in the Witwatersrand ... marks the powerful beginning of the New Journalism at the same time as it marks the beginning of the end of the New Imperialism The coincidence of these occasions arises from the nature of the...

Ngày tải lên: 21/09/2012, 10:54

221 932 3
Cambridge.University.Press.War.and.the.Law.of.Nations.A.General.History.Sep.2005.pdf

Cambridge.University.Press.War.and.the.Law.of.Nations.A.General.History.Sep.2005.pdf

... of the crumbling of older conceptions of legitimacy and the rise of new aspirations for democracy and the self-determination of peoples The result was the emergence of a body of law on the recognition ... approach, the concern will not be so much with the substance of just-war doctrine as with its general character – and particularly, of course, with the conception of war which both underpinned it and ... authors, the patience of readers and the economics of the publishing industry conspire to keep this account at the level of grand theme or contour rather than of exacting detail It is therefore...

Ngày tải lên: 21/09/2012, 11:02

456 938 7
 Circuit theory of finance and the role of incentives in financial sector reform

Circuit theory of finance and the role of incentives in financial sector reform

... policy implications of circuit theory of finance Section I.2 discusses the special role of the financial system as the core of the circuit process, and reports on recent empirical evidence Part ... of the pure macroeconomic approach of monetary circuit theory It creates a greater scope for studying the role of marketcompatible incentives in reconciling microeconomic behavior and macroeconomic ... funds and, at the end of the process, it determines the condition for the closure of the circuit As discussed, the conditions under which one circuit round succeeds or fails to close affect the...

Ngày tải lên: 24/10/2012, 09:33

55 666 0
Ensuring Financial Stability: Financial Structure and the Impact of Monetary Policy on Asset Prices

Ensuring Financial Stability: Financial Structure and the Impact of Monetary Policy on Asset Prices

... since, if this were to be the case, the resulting macroeconomic cycles could lead the public to question the central bank’s commitment to price stability Fifth, the effects of monetary policy ... the macro economic effects of the collapse of the bubble).2 Of course, it is by no means clear that central banks are better able to judge the appropriate level of asset prices and the risk of ... asset prices, whether they are large relative to the effects of monetary policy on inflation and economic activity and whether they occur faster Thus, it is not clear that any of the five criteria...

Ngày tải lên: 24/10/2012, 09:40

35 801 0
w