... Parkway P.O Box 1346 Ann Arbor, MI 48106-1346 The < /b> undersigned, appointed by the < /b> Dean of the < /b> Graduate School, have examined the < /b> thesis A < /b> FURTHER ANALYSIS OF THE < /b> CAUSAL LINK BETWEEN < /b> ABORTION AND < /b> ... year; thus, the < /b> 1975 AFDC benefits affect the < /b> 1976 abortion rate The < /b> Unemp and < /b> Incomeper variables are unemployment rate and < /b> state per capita indexed by state and < /b> year The < /b> other terms are state ... plateau than before The < /b> third analysis is that of the < /b> staggered nature of the < /b> states’ legalization; New York, California, Washington, Alaska, and < /b> Hawaii all lifted the < /b> abortion ban before the < /b> Supreme...
... agreements for the < /b> Baltic, the < /b> northeast Atlantic and < /b> the < /b> Antarctic85); a < /b> stand-alone convention on Arctic land-based pollution; and < /b> a < /b> broader sustainable development and < /b> environmental protection ... polycyclic aromatic hydrocarbons (PAHs) as well as dioxins and < /b> furans.25 Substantial amounts of POPs may be reaching the < /b> Arctic, transported on air masses from Europe, Russia, North America and < /b> Asia, and < /b> ... Land-Based Activities, Draft Canada’s National Programme of Action (NPA) for the < /b> Protection of the < /b> Marine Environment from Land-Based Activities (March 1999), p 3; available at www.ec.gc.ca/nat_action...
... upon bad health In Bound (1991) and < /b> Stern (1990) reporting errors are SG modelled as a < /b> relationship between < /b> H and < /b> the < /b> wage rate rather than the < /b> labour market status S In the < /b> Netherlands the < /b> unemployment ... rate of up to 30 percent for some income sources The < /b> CERRA data were compared to data from the < /b> Netherlands Central Bureau of Statistics and < /b> found to be comparable based on age, sex, labour market ... that income streams in alternative exit routes (DI, UI and < /b> ER) are compared in the < /b> retirement decision and < /b> that these alternative exit routes act as substitutes The < /b> Netherlands may be an extreme...
... primers P4 (5¢-atgtagccattgtatttgaaaatgagcaact) and < /b> P5 (5¢- agttgctcattttcaaatacaatggctacat), and < /b> P6 (5¢- gaacagc cgtatttggccgcttattttgtatc) and < /b> P7 (5¢- gatacaaaataagcggccaaa tacggctgttc), respectively, ... genomic DNA of Bacillus brevis ATCC 9999 using the < /b> primers P1 (5¢- tatccatggtaaacagttctaaaagtatattg) and < /b> P2 (5¢- tatagatctctcacttcttcttttactatc) The < /b> PCR product was subcloned into a < /b> pQE60 vector ... during the < /b> closing of the < /b> subdomains However, the < /b> flexible linker between < /b> the < /b> AC subdomain and < /b> the < /b> PCP domain, and < /b> the < /b> absence of a < /b> contact surface between < /b> these two folded units [19], argue for a...
... and < /b> B ∈ B( G) is a < /b> matrix such that rank (B) = α(G) We can assume that B= Iα(G) XT X < /b> Y , where Iα(G) is the < /b> identity α(G) × α(G)-matrix Applying block Gauss elimination, B reduces to the < /b> matrix ... Iα(G) B = We have or X < /b> Y − XT X < /b> Y − XT X < /b> = Yuv − Xwu Xwv = 0, u, v ∈ S (1) w∈S since rank (B ) = rank (B) = α(G) Equation (1) gives us further information about < /b> the < /b> graph G (i) If v ∈ S then exists ... adjacency matrix of G Then χ(G) = 32 and < /b> the < /b> electronic journal of combinatorics (1997), #R19 and < /b> α(G) < min{ rank (B) |B ∈ B( G)} by theorem Acknowledgement The < /b> author is grateful to the < /b> anonymous...
... the < /b> hyperoctahedral arrangement Again, the < /b> two active mappings α and < /b> α1 are equal, and < /b> equivalent to the < /b> classical bijection between < /b> permutations and < /b> increasing trees The < /b> hyperoctahedral arrangement, ... Classical examples of supersolvable real arrangements are the < /b> braid arrangement, related to the < /b> Coxeter group An (see Section below), and < /b> the < /b> hyperoctahedral arrangement, related to the < /b> Coxeter ... aj > aj and < /b> the < /b> definition of aj Hence aj = aj , and < /b> so the < /b> active partitions or R and < /b> −ω R are equal The < /b> two implications above prove the < /b> two equivalences in the < /b> lemma Finally, we assume that...
... It has been shown that the < /b> anti-diabetic and < /b> anti-obesity effects of PPARδ activation are brought about,< /b> in part, by a < /b> decrease in fatty acid synthesis and < /b> fat storage within synthesized TAG depots ... in the < /b> mitochondrial b- oxidation pathway and < /b> the < /b> peroxisomal fatty acid b- oxidation pathway was increased in PPARδ agonist-treated cells Alongside these changes were an increase in the < /b> transcription ... Glucose alpha-glycerophosphoric acid Oxaloacetate Control Glutamate Aspartate Asparagine Alanine Glutamine Citrate Malate Isocitrate Fumarate 2-Oxoglutarate Succinate 0.004 Glutamate Succinyl Co-A...
... acquisition, analysis and < /b> interpretation of data and < /b> drafting the < /b> manuscript BB and < /b> BL performed the < /b> histological and < /b> morphometrical analyses, and < /b> contributed to the < /b> interpretation of the < /b> results EC and < /b> ... data GL conceived and < /b> coordinated the < /b> study, participated in the < /b> design of the < /b> study, analysis and < /b> interpretation of data and < /b> drafting the < /b> manuscript All authors read and < /b> approved the < /b> final manuscript ... fibrotic areas appear to be mainly of the < /b> paracicatricial type (A < /b> and < /b> B) Nevertheless, several areas of emphysema can be detected quite distant from the < /b> fibrotic zones (C) (A)< /b> and < /b> (C): Hematoxylin-eosin...
... combines ab initio quantum mechanical calculations with molecular dynamics and < /b> thermodynamic analysis In particular, we use the < /b> GAUSSIAN [13] software together with GROMACS and < /b> AMBER molecular dynamics ... with a < /b> large body of experimental data Also, there has been an intense debate behind the < /b> mechanism for α- and < /b> -glycine crystal growth (i.e monolayer vs bilayer growth) and < /b> their associated growth ... on the < /b> random manipulation of external factors such as temperature, solvent, level of supersaturation, and < /b> solution purity The < /b> exact molecular mechanism played by these external factors at the...
... lipoarabinomannan (LAM) and < /b> lipomannan (LM), and < /b> proteoglycans such as arabinogalactan A < /b> B C Figure 1.1 Bacterial cell surface PAMPs (A)< /b> Schematic representations of the < /b> general structure of the < /b> ... convertase) The < /b> mannosebinding lectin pathway is initiated by binding of the < /b> complex of MBL and < /b> MASP 1and < /b> MASP2 to arrays of mannose groups on the < /b> bacterial cell surface MASP2 acts as a < /b> protease ... et al., 2002) TAK1 is activated by ubiquitination and < /b> subsequently activate the < /b> I B kinase (IKK) complex made up of the < /b> catalytic subunits IKK and < /b> IKK, and < /b> a < /b> regulatory subunit NF- B essential...
... hierarchy, and < /b> are geared 33 Chapter Literature Review towards standardization and < /b> efficiency On the < /b> other hand, organic organizations are flexible, flat, and < /b> open (Burns and < /b> Stalker, 2001) In this thesis ... on the < /b> TQM practices and < /b> organizational performances between < /b> Singapore and < /b> Australia The < /b> comparison is mainly based on the < /b> self-evaluation results of each organization The < /b> answers of some objective ... given by Harari (199 3a)< /b> and < /b> Harari (199 3b) and < /b> are listed in Table 1.1 In addition, large number of failures existed (Harari, 199 3a)< /b> In fact, these failures were largely due to the < /b> misunderstanding...
... containing BamHI and < /b> XhoI restriction sites, 5’-GGA TCC AAC GAA GTG AAT TTA TTG GAT TCA CGC -3’ (forward) and < /b> 5’-CTC GAG TCA AGA AGG CGC TTC TTT ATA GTA TAC -3’(reverse) The < /b> PCR fragment was cloned ... in the < /b> structures of the < /b> A-< /b> and < /b> B- class molecules result in different architectural arrangements of ligands and < /b> receptors in the < /b> Aand B- subclass complexes Figures and < /b> illustrate that the < /b> B- class ... activated by different ephrins throughout the < /b> animal kingdom Eph receptors and < /b> their ligands are both anchored to the < /b> plasma membrane, and < /b> are subdivided into two subclasses (A < /b> and < /b> B) based on their...
... that once a < /b> Y-linked gene is lost during evolution, its X-< /b> linked partner would Expression level 1.5 X < /b> XA < /b> X < /b> A < /b> X < /b> 0.5 X < /b> A < /b> AX < /b> XX < /b> A < /b> AX < /b> Xa A < /b> X < /b> A < /b> X < /b> A < /b> X < /b> Xi Soma Germline Drosophila Soma C elegans ... testes (X;< /b> AA) but also XX;AA ovaries and < /b> X;< /b> AA sex-transformed ovaries all centered on (Figure 1) Having validated their approach, Gupta et al [8] compared expression of the < /b> X < /b> chromosome with that ... (in the < /b> region that has three copies in Dp/+ flies and < /b> one in Df/+ flies) female soma and < /b> gonads; that is, the < /b> expression ratios between < /b> X < /b> chromosomes and < /b> autosomes of XX;AA female soma and < /b> X;< /b> AA...
... between < /b> the < /b> studied objects in terms of MiCA and < /b> MaCA basing on the < /b> theoretical background As far as MiCA was concerned, these two verbs are analyzed and < /b> contrasted in respects of grammatical features, ... • What are the < /b> grammatical and < /b> semantic features of each verb and < /b> how are they similar and < /b> different in terms of these features? • What are their synonyms and < /b> idioms? • What are the < /b> implications ... distribution of forms and < /b> meanings of their native language and < /b> culture to the < /b> foreign language and < /b> culture- both productively and < /b> when attempting to speak the < /b> language and < /b> to act in the < /b> culture and...
... Database and < /b> can be accessed at http://jjj.biochem.sun.ac.za/ database/curien/index.html free of charge Fig Phser branch-point in the < /b> aspartate-derived amino acid biosynthetic pathway in plants ... amino-acids pathway and < /b> aromatic amino-acids pathway in plant and < /b> in microorganisms are such that ux coordination could also be obtained The < /b> distribution of the < /b> carbon skeleton toward the < /b> various ... 52-kDa monomer mass basis) Such data are lacking for TS, however, the < /b> ratio [CGS]/[TS] can be calculated as follows: ELISA assays were carried out using rabbit antibodies raised against the < /b> recombinant...