Báo cáo khoa học: Biochemical evidence for conformational changes in the cross-talk between adenylation and peptidyl-carrier protein domains of nonribosomal peptide synthetases ppt

Biochemical evidence for conformational changes in the cross-talk between adenylation and peptidyl-carrier protein domains of nonribosomal peptide synthetases Joachim Zettler and Henning D. Mootz Technische Universita ¨ t Dortmund, Germany Introduction A myriad of bioactive peptides is assembled by non- ribosomal peptide synthetases (NRPSs). Examples of such nonribosomal peptides (NRPs) include the immu- nosuppressant cyclosporine A, the antibiotic vancomy- cin, and the iron-chelating siderophore enterobactin. During the stepwise biosynthesis of the NRP, the intermediates are covalently attached to the NRPS template [1–4]. Genetic and biochemical analysis of NRPSs have revealed the modular organization of these multifunctional mega-enzymes. The incorpora- tion of one building block into the growing peptide chain requires one module consisting of several spe- cialized catalytic domains [2–4]. Figure 1A shows the interplay of individual domains during a catalytic cycle at an elongation module. In step 1, the adenylation (A) domain selects a cognate amino acid and activates it by forming the corresponding amino acyl adenylate. Then, as shown in step 2, the 4¢-phosphopantetheine moiety (Ppant) of the peptidyl-carrier protein (PCP) domain binds the activated acyl group as a thioester. Keywords A-domain inhibitor; conformational change; domain interaction; nonribosomal peptide synthetase (NRPS); peptide antibiotics Correspondence H. D. Mootz, Technische Universita ¨ t Dortmund, Fakulta ¨ t Chemie – Chemische Biologie, Otto-Hahn-Str. 6, 44227 Dortmund, Germany Fax: +49 0 231 755 5159 Tel: +49 0 231 755 3863 E-mail: Henning.Mootz@tu-dortmund.de (Received 31 August 2009, revised 15 December 2009, accepted 16 December 2009) doi:10.1111/j.1742-4658.2009.07551.x Nonribosomal peptide synthetases serve as multidomain protein templates for producing a wealth of pharmaceutically important natural products. For the correct assembly of the desired natural product the interactions between the different catalytic centres and the reaction intermediates bound to the peptidyl carrier protein must be precisely controlled at spatial and temporal levels. We have investigated the interplay between the adenylation (A) domain and the peptidyl carrier protein in the gramicidin S synthetase I (EC 5.1.1.11) via partial tryptic digests, native PAGE and gel-filtration analysis, as well as by chemical labeling experiments. Our data imply that the 4¢-phosphopantetheine moiety of the peptidyl carrier protein changes its position as a result of a conformational change in the A domain, which is induced by the binding of an amino acyl adenylate mimic. The produc- tive interaction between the two domains at the stage of the amino acyl transfer onto the 4¢-phosphopantetheine moiety is accompanied by a highly compact protein conformation of the holo-protein. These results provide the first biochemical evidence for the occurrence of conformational changes in the cross-talk between A and peptidyl carrier protein domains of a multi- domain nonribosomal peptide synthetase. Abbreviations A domain, adenylation domain; ANL, aryl and acyl CoA synthetases, NRPS A domains and firefly luciferases; A-PCP(D-4Cys), the gramicidin S synthetase I A domain and the PCP domain (C60F, C331A, C376S, C473A); A-PCP, the gramicidin S synthetase I A domain and the PCP domain; ApCpp, adenosine-5¢-[(a,b)-methyleno] triphosphate; C domain, condensation domain ; E domain, epimerisation domain; eq., equivalent; GrsA, gramicidin S synthetase I; NRP, nonribosomal peptide; NRPS, nonribosomal peptide synthetase; PCP domain, peptidyl carrier protein domain; Ppant, 4¢-phosphopantetheine moiety; PP i, pyrophosphate; Sfp, 4¢-phosphopantetheine transferase involved in surfactin production; TAMRA, tetramethyl-rhodamine; TE domain, thioesterase domain; TycA, tyrocidine synthetase I; TycB, tyrocidine synthetase II. FEBS Journal 277 (2010) 1159–1171 ª 2010 The Authors Journal compilation ª 2010 FEBS 1159 During steps 3 and 4, peptide-bond formation is cata- lyzed at the acceptor position of an upstream conden- sation (C) domain and at the donor position of a downstream C domain. In the case of an initiation module, the upstream C domain is omitted, whereas in the case of the last module of an NRPS assembly line a thioesterase (TE) domain usually replaces the down- stream C domain. Additional domains can be included within a module to achieve further diversification (e.g. epimerization, N-methylation and oxidation domains). For most NRPSs, the arrangement of the modules on the primary sequence is co-linear with the assem- bled NRP. However, modules can also be used itera- tively, or the relationship between the module and domain compositions and the NRP can be more complex [5]. Crystallographic studies and NMR investigations have revealed the 3D structures of representative members of each essential NRPS domain in an iso- lated form [6–11]. For example, A domains belong, together with acyl-CoA synthetases, aryl-CoA synthe- tases and firefly luciferases, to the ANL superfamily of adenylating enzymes. Congeners of this class con- tain two subdomains, the larger N-terminal sub- domain (A N ) (400–500 amino acids in size) and the smaller C-terminal subdomain (A C ) (100–150 amino acids in size). Consistent with this enzyme class, crys- tallographic and mutational studies (for a review see [12]) have revealed that A domains probably adopt three different conformations during the catalytic cycle and use large-scale domain rotations [12] to catalyze the two half reactions, namely amino acyl adenylate formation and thioesterification onto the Ppant group of the C-terminal PCP (steps 1 and 2 in Fig. 1A and see Fig. S1A for representative structures of the different conformations) [12–15]. These three conformations include an open conformation with lit- tle contact between the subdomains when no sub- strates are present [12,13]. Binding of ATP and the amino acid substrate results in a rotation of the subdomains towards the ‘adenylation conformation’ and closes the active site from bulk solvent [12,13]. Breaking of the a,b-phosphodiester bond of ATP, and the subsequent release of pyrophosphate, induces a 140° rotation of A C with respect to A N , giving a conformation where thioester formation takes place [12,13]. However, a structure of an A domain in this ‘thioester-conformation’ with an interacting PCP is not available. PCP domains can also exist in different, intercon- verting conformations [8]. Previous studies have shown that the structure of the PCP domain is dependent not AB Fig. 1. (A) Scheme of the reactions catalyzed by a minimal NRPS elongation module. From a functional perspective, the PCP is the central domain in each module. The 4¢-phosphopantetheine prosthetic group (Ppant) must interact in a minimal elongation cycle with the A-domain to become acylated by the amino acyl adenylate intermediate, with the upstream C domain receiving the amino acyl or peptidyl group from the preceding module for peptide bond formation, and with the downstream C domain, or alternatively with the TE domain at the last mod- ule of the NRPS template, to deliver the peptidyl moiety and free the Ppant for the next elongation cycle. Additionally, optional domains, which also need to specifically interact with the amino acylated PCP, might be incorporated in the module. (B) Chemical structures of the A-domain inhibitors used in this study (5¢-O-[N-( L-phenyl)-sulfamoyl] adenosine) (1) and (5¢-O-[N-(L-prolyl)-sulfamoyl] adenosine) (2). Biochemical studies of NRPS domain interactions J. Zettler and H. D. Mootz 1160 FEBS Journal 277 (2010) 1159–1171 ª 2010 The Authors Journal compilation ª 2010 FEBS only on its post-translational state (apo or holo) but also on the presence or absence of PCP-interacting domains or external enzymes [8,16] (for reviews see [17,18]). Besides these intradomain dynamics, different intramodular positions of the PCP domain, relative to other NRPS domains, seem likely considering the over- all architecture of an NRPS module. Marahiel and co-workers [19] recently reported a crystal structure of the 144 kDa termination module, SrfA–C, involved in the biosynthesis of surfactin, which is composed of four domains (C-A-PCP-TE). In this structure, the C domain and the A N form a structured platform onto which the A C and the PCP domain are tethered. Fur- thermore, this SrfA–C construct lacks the attachment site of the Ppant group (S1003A mutant) and shows the PCP on the acceptor site of the C-domain. The dis- tance of the S1003A residue to the active-site histidine of the C-domain is 16 A ˚ , making it within the reach of the missing Ppant arm (capable of reaching 20 A ˚ dis- tance at full linear extension). However, the distances to the other catalytic centres of the SrfA–C module, namely the A domain and the TE domain, are 57 and 43 A ˚ , respectively, too large to support the proposed ‘swinging arm model’. This model suggests that the length and flexibility of the 18–20 A ˚ Ppant arm is itself sufficient to translocate the intermediates into active sites from a central position [20,21]. This finding sug- gested that, in order to interact with another domain, the PCP domain needs to translate relative to the C–A N platform. Similar domain translocations have been suggested for the fatty acid synthase acyl carrier proteins, which share a similar four a-helix bundle topology with the PCPs [22]. During catalysis, these ACPs must travel distances of 50–80 A ˚ between the active centers [23–25]. Although the conformational changes of the PCP domains seem convincing and were postulated in previous studies, to our knowledge no direct biochemical evidence for these PCP move- ments in a minimal elongation or initiation module could be obtained until now. In this work, we provide the first biochemical evi- dence for conformational changes of the PCP domain relative to the A domain, which were dependent on the reaction stage of the latter in an NRPS initiation mod- ule. We have investigated an A–PCP didomain model construct by partial proteolytic digestion, gel filtration and native gel electrophoresis, and studied the accessi- bility of the sulfhydryl group of the Ppant-PCP from the bulk solvent. Taken together, our results support significant conformational changes in the crosstalk between A domains and PCP domains that reflect dif- ferent states of the PCP domain in the catalytic cycle of an NRPS module. Results Amino acyl sulfamoyl adenosine inhibitors induce conformational changes in the A-PCP protein that are comparable to the effect of the native substrates To investigate conformational changes in a catalyti- cally competent NRPS protein, we chose, as a model protein, a truncated construct of gramicidin S synthe- tase I (GrsA; EC 5.1.1.11), which consisted of the first two functional domains, namely the phenylalanine- specific A domain and the PCP domain. The terminal E domain was excised (the exact amino acid composi- tion of the investigated protein is shown in Fig. S1B). With this protein, referred to herein as A-PCP, the first two reaction steps shown in Fig. 1A can be studied [26]. The latter reaction step must involve a productive domain–domain interaction between the A domain and the PCP domain. To trap the holo- enzyme in such a conformation, the natural substrates ATP and phenylalanine are not suitable because their use would lead to the formation of the amino acyl thioester on the Ppant of the PCP domain and prime the enzyme for the next step in the reaction sequence. Therefore, we turned to the sulfamoyl-based inhibi- tor 1, which is a nonhydrolyzable analog of the phen- ylalanyl adenylate (see Fig. 1B) and probably arrests the enzyme in a state destined for the productive interaction. Previous studies determined the K i values of this inhibitor class to be in the nanomolar range [27,28]; hence, NRPS A domains bind these cognate inhibitors around two to three orders of magnitude more tightly than their amino acid or ATP substrates [29]. We first aimed to establish that binding of 1 induced similar effects on the conformation of the A domain in solution as the substrates ATP and l-Phe. To this end, we used a partial proteolytic digest, previously reported by Dieckmann et al. [30] for the investigation of the highly homologous protein tyrocidine synthetase I (TycA) in its apo-form. They found that the addition of the substrates slowed down the proteolysis of the protein, mostly by decreasing the rate of cleavage between the two subdomains of the A domain. These findings were later explained with the structural model that the smaller subdomain A C of the A domain rotates upon substrate binding and changes from an open conformation to a more compact one [11,12]. To identify the resulting protein fragments obtained from the partial tryptic digest, we performed in-gel tryptic digests and subsequent MALDI-TOF MS of the major protein bands (see Table S1). Additionally, J. Zettler and H. D. Mootz Biochemical studies of NRPS domain interactions FEBS Journal 277 (2010) 1159–1171 ª 2010 The Authors Journal compilation ª 2010 FEBS 1161 we prepared a tetramethyl-rhodamine (TAMRA)- loaded holo-protein through the Sfp-catalyzed reaction of TAMRA-CoA with apo-A-PCP [31–33] (see the Materials and methods). Because of the fluorescent labeling of the PCP domain, the PCP-containing frag- ments of the tryptic digest (A C -PCP and PCP) can be visualized under UV illumination (see Fig. S3). In agreement with this previous work [30], we found that trypsin cleaved the apo-A-PCP construct predomi- nantly between the two subdomains of the A domain (see Fig. S2). The addition of the substrates ATP and l-Phe dramatically changed the susceptibility of the apo-protein to proteolysis by decreasing the rate of cleavage, indicating that the complex with the amino acyl adenylate shows less accessibility for the protease- recognition sites at the solvent-exposed linkers (see Fig. S2). Control reactions revealed that addition of pyrophosphate, AMP, or ATP alone changed neither the rate nor the pattern of the proteolysis to a detect- able extent (data not shown). The latter finding also indicated that the protein preparations used in this study were free of residual bound phenylalanine [34]. Addition of l-Phe slowed down the rate of the proteol- ysis, an effect that was enhanced in the additional presence of AMP and the nonhydrolyzable ATP analog adenosine-5¢-[(a,b)-methyleno] triphosphate (ApCpp) (data not shown). A comparison of the effect of compound 1 with that of the natural substrates ATP and l-Phe on the apo- and holo-forms of the A-PCP construct in the partial tryptic digest is shown in Fig. 2. The apo-form and the holo-form yielded similar results in this assay, but sig- nificant differences were observed in the absence of substrates (Fig. 2A), and in the presence of ATP and l-Phe or compound 1 (Fig. 2B & C, respectively). The addition of 1 resulted in tryptic digest patterns that were qualitatively similar to those observed for ATP and l-Phe addition (compare Fig. 2B and 2C). Inter- estingly, however, we had to increase the amount of trypsin four-fold to observe a reasonable degree of degradation in the former case. These findings indi- cated, within the resolution of this assay, that 1 induced the same conformational changes as the sub- strates ATP and l-Phe, and is therefore suitable to mimic the amino acyl adenylate. The significantly higher resistance to proteolysis of the protein–inhibitor complex could be a result of the low K i =61nm of compound 1 [27] that results in a more effective freez- ing of the conformation of the A domain in a com- pact, closed state. As the inhibitor lacks the b and c phosphate groups, and release of the pyrophosphate (PP i ) is believed to precede domain alternation from the adenylation into the thioester conformation, this closed state is probably the thioester-forming confor- mation [13]. Although similar digest patterns were observed for the apo- and holo-forms of A–PCP we cannot rule out a potentially different orientation or localization of the PCP domain relative to the A domain from these results. The trypsin assay is probably not suitable to resolve such differences because the effect of the modi- fication on the susceptibility of trypsin-cleavage sites between the two domains might be too small. Further- more, the fast degradation of the A domain into the two subdomains in the absence of substrates compli- cated quantitative interpretations with regard to the cleavage site(s) between the A domain and the PCP domain, because a PCP-domain fragment can originate from a complete didomain protein or from a previ- ously generated A C -PCP fragment. Evidence for different conformational states of the PCP domain relative to the A domain obtained from native PAGE and gel-filtration analysis Next, we developed new assays, based on native PAGE and gel-filtration analysis, to monitor larger conformational changes, such as those predicted from the domain-alternation mechanism [12,13] in the A-PCP protein. In contrast to the partial tryptic digest, these assays leave the protein intact. Native PAGE can resolve different conformational states of a protein if these states exhibit different electrophoretic mobilities and are sufficiently stable under the electrophoretic conditions used. Similarly, conformational changes can be monitored via gel-filtration experiments if the over- all size and shape of the protein changes. Before the analysis, we incubated the apo- and the holo-forms of the A-PCP protein with inhibitor 1, or without any ligand. As shown in Fig. 3, in the absence of ligands the electrophoretic mobility in native PAGE was slightly higher for the holo-form than for the apo-form (left lanes). This difference might reflect minor confor- mational changes but could also be explained by con- sidering the different chemical composition of the proteins. Modification with Ppant introduces an extra negative charge into the protein, which should result in a higher electrophoretic mobility (the calculated charge of the apo-protein under the conditions of the native PAGE is approximately )20). Gel-filtration experi- ments supported the latter explanation because the apo-protein and the holo-protein eluted within the error margins at identical retention times (see Table 1; see Fig. S5 for representative gel-filtration chromato- grams). Importantly, pre-incubation of the proteins Biochemical studies of NRPS domain interactions J. Zettler and H. D. Mootz 1162 FEBS Journal 277 (2010) 1159–1171 ª 2010 The Authors Journal compilation ª 2010 FEBS with the cognate inhibitor 1 changed the migration and retention behaviors of the complexes compared with the free proteins in the native PAGE and in the gel-filtration assays, respectively. The binding of 1 to the A domain was tight enough to survive both sepa- ration processes (data not shown). In the native PAGE, both complexes with the inhibitor, apo- and holo-, migrated significantly faster than the ligand-free protein (Fig. 3, middle lanes). In the gel-filtration anal- ysis, the complexes clearly eluted later (see Table 1). Thus, the binding of 1 seemed to cause a conforma- tional change leading to a more compact folding of A-PCP. This conformational change probably includes the closing of the A C subdomain relative to the A N subdomain, previously suggested in the literature [12,13] and in agreement with our data from the par- tial proteolytic digests. The native PAGE assay and the gel-filtration analysis are thus useful means to monitor these changes with intact proteins in solution. Furthermore, a close inspection of the results showed differences between the apo-protein and the holo-pro- tein. Interestingly, the presence of 1 led to a larger increase in the electrophoretic mobility of the holo- form compared to the effect seen for the apo-form (Fig. 3, compare left and middle lanes). Likewise, in the gel-filtration experiments the elution volume of the holo-protein in the presence of 1 was significantly lar- ger than the corresponding value of the apo-form in the presence of 1 (t-test with a significance level of 5%). The calculated shift differences to higher elution A B C Fig. 2. Partial tryptic digests of apo-A-PCP and holo-A-PCP under different conditions. Digests are shown for the apo-A-PCP (left) and holo-A-PCP (right). (A) Reactions were performed in the absence of substrates at a protein ⁄ protease ratio of 250:1 (w ⁄ w), (B) under saturating conditions (2 m M each) of ATP and L-Phe at a protein ⁄ protease ratio of 100:1 (w ⁄ w), and (C) in the presence of inhibitor 1 (100 l M) at a protein ⁄ protease ratio of 25 : 1 (w ⁄ w). J. Zettler and H. D. Mootz Biochemical studies of NRPS domain interactions FEBS Journal 277 (2010) 1159–1171 ª 2010 The Authors Journal compilation ª 2010 FEBS 1163 volumes were 0.172 ± 0.034 mL for the apo-A-PCP and 0.209 ± 0.029 mL for the holo-A-PCP. Taken together, these findings suggest that binding of the inhibitor to the holo-form caused an additional confor- mational change that further decreased the Stokes’ radius of the protein compared with the apo-form. This conformational change could be the result of the PCP adopting a different position relative to the A domain where the Ppant moiety is positioned to reach the amino acyl adenylate and renders the overall structure of the protein more compact. This interpreta- tion is in accordance with the logic of the nonriboso- mal synthesis that only a Ppant-PCP is a substrate for an A domain and also with the idea that binding of the PCP to the A domain in a productive manner increases the compactness of the protein. Further control reactions with a noncognate inhibi- tor 2 of the A domain [(5¢-O-[N-(L-prolyl)-sulfamoyl] adenosine) see Fig. 1B] showed that this molecule had no effect either on the electrophoretic mobilities in native PAGE (Fig. 3, compare left and right lanes) or on the elution volume in the gel filtration (see Table 1). Furthermore, a similar construct from a truncated proline-activating module, tyrocidin synthe- tase II (TycB1), A Pro -PCP, was subjected to native PAGE after incubation with 1 or 2. In this case, only inhibitor 2 changed the electrophoretic mobility of this didomain protein (data not shown). Pre-incubation of apo-A-PCP and holo-A-PCP with l-Phe, together with ATP, AMP or ApCpp, did not change the electropho- retic mobilities of the proteins in the native PAGE (data not shown), presumably because the complexes formed are not stable under the electrophoretic condi- tions. Chemical modification reveals different spatial localizations of the Ppant, depending on the reac- tion state of the A domain The model deduced from the above results suggested that the inhibitor 1 induced a significant conforma- tional change that leads to a compact holo-A-PCP protein. Here, the holo-PCP domain interacts in a pro- ductive way with the A domain. We decided to further test this model through the use of thiol-modifying agents. In the productive conformation the Ppant is in the active site and therefore its thiol-group should be less accessible to the bulk solvent compared with a conformation in which the PCP is not destined to interact with the A domain. A less-accessible Ppant moiety should be less prone to chemical modification by thiol-modifying agents and therefore react more slowly. To avoid undesired background labeling of sulfhydryl groups of cysteines, we first eliminated all cysteines in the protein by site-directed mutagenesis. The PCP domain in our construct was free of cyste- ines; however, the A domain of GrsA contained four cysteine residues. A sequence alignment with related A domains revealed that two cysteine residues (Cys60 and Cys331) are not conserved in related A domains. We mutated Cys60 to phenylalanine because this is the most prominent residue at this position in the closely related A domains of the tyrocidine and bacitracin NRPS. Cys331 is part of the binding pocket of the amino acid in the active site [11]. The mutation Cys331Leu decreased the activity of the isolated GrsA A domain to 26% compared with the wild-type protein [35]. We performed the mutation Cys331Ala, which probably does not alter the activity or the specificity dramatically. Cys376 is part of the sequence motif A6 and is conserved among NRPS A domains [2]. How- ever, mutation of the corresponding cysteine residue to serine in the highly homologous TycA NRPS had no Table 1. Elution volumes and apparent molecular weights of different incubated A-PCP constructs in gel-filtration experiments. Protein Elution volume (mL) m apparent (kDa) apo-A-PCP 14.560 ± 0.028 74.2 holo-A-PCP 14.567 ± 0.023 73.9 apo-A-PCP + 1 14.732 ± 0.019 67.8 holo-A-PCP + 1 14.776 ± 0.017 66.3 apo-A-PCP + 2 14.567 ± 0.013 73.9 holo-A-PCP + 2 14.551 ± 0.015 74.5 Fig. 3. Electrophoretic mobility of A-PCP monitored by native PAGE. A-PCP in the apo-form and in the holo-form was pre-incu- bated without inhibitor or with compounds 1 and 2 (at 100 l M each) and then subjected to native PAGE. The gel was stained with Coomassie Brilliant Blue. Inh., inhibitor. Biochemical studies of NRPS domain interactions J. Zettler and H. D. Mootz 1164 FEBS Journal 277 (2010) 1159–1171 ª 2010 The Authors Journal compilation ª 2010 FEBS effect on activity in previous studies [36]. Therefore, we also introduced a serine at this position. Finally, Cys473 is located in the subdomain A C of the A domain and is moderately conserved. Tyrosine and alanine are the other amino acids frequently found at this position; therefore, the mutation Cys473Ala was used. Introduction of the four mutations (C60F, C331A, C376S and C473A) had little effect on the activity of the A domain, as determined by the ATP ⁄ PP i exchange assay. As shown in Table 2, the K m of the resulting construct A-PCP(D-4Cys) for l-Phe was increased by  two-fold, while the k cat was reduced by  1.5-fold. Importantly, the mutant protein, A-PCP (D-4Cys), also showed a tryptic digest pattern compa- rable to the reference construct A-PCP (data not shown) and behaved similarly in native PAGE as the reference construct (see Fig. S4). Together, these results indicated that the four mutations in A-PCP (D-4Cys) had only a minor effect and thus this protein was suitable for our studies. The only thiol group in holo-A-PCP(D-4Cys) belongs to the Ppant moiety. Addition of fluorescein-maleimide and fluorescein-iodacetamide showed fast and quantita- tive labeling, both when the protein was pre-incubated with inhibitor 1 as well as in the absence of the small molecule, indicating that the reactions were too fast to observe any differences (data not shown). We therefore tested the chemically less reactive and sterically more demanding Texas-Red bromoacetamide, which indeed resulted in differences in labeling velocity (see Fig. 4). The degree of labeling was determined from the inten- sity of the fluorescent signal on an SDS ⁄ PAGE gel. MS analysis confirmed that the chemical labeling took place at the Ppant moiety (see Fig. S6A). The chemical modi- fication with the fluorophore proceeded most quickly for holo-A-PCP(D-4Cys), without any ligands, and was used as a relative reference. In striking contrast, in the presence of 1, the labeling reaction occurred at a signifi- cantly slower rate (compare lanes 2 and 3 in Fig. 4A at the different reaction time-points and see Fig. 4B for the time-courses of the reactions). Substitution of 1 with substrates ATP and l-Phe led to only a low degree of labelling, which was consistent with the formation of the l-Phe-thioester blocking the Ppant group. Each of the two substrates alone decreased the labeling velocity only slightly, with l-Phe having a slightly stronger effect than ATP. This finding is in agreement with the observed effect of these substrates in our partial proteolysis experiments (see above). A negative control with the noncognate inhibitor 2 showed that this molecule had no effect. In another negative control, incubation of apo-A-PCP(D-4Cys) with Texas-Red bromoacetamide resulted only in the expected back- ground incorporation of the fluorophore, presumably because of minor unspecific reactions of the bromo- acetamide with other residues such as His or Met side chains. We conducted a further control experiment to rule out another possible mechanism of chemical labeling of the Ppant thiol group. Given a potential affinity of the aromatic fluorophore to the ATP-binding pocket, Table 2. Kinetic parameters of the ATP-PP i exchange reaction for L-Phe. Enzyme K m (lM) k cat (min )1 ) A-PCP (reference) 6.2 ± 0.7 23 ± 1 A-PCP(D-4Cys) 14.6 ± 0.8 15 ± 1 A B Fig. 4. Chemical labeling of apo-A-PCP(D-4Cys) and holo-A-PCP (D-4Cys) with Texas-Red â C 5 Bromoacetamide. (A) A representa- tive SDS gel of the labeling reaction at different time-points under UV-light (top) and stained with Coomassie Brilliant Blue (below). Lane 1: apo-A-PCP(D-4Cys); lane 2: holo-A-PCP(D-4Cys); lane 3: holo-A-PCP(D-4Cys) + 100 l M 1; lane 4: holo-A-PCP(D-4Cys) + 7.5 m M ATP and L-Phe; lane 5: holo-A-PCP(D-4Cys) + 100 lM 2. (B) Densitometric analysis of band intensities after normalization with the total protein content. J. Zettler and H. D. Mootz Biochemical studies of NRPS domain interactions FEBS Journal 277 (2010) 1159–1171 ª 2010 The Authors Journal compilation ª 2010 FEBS 1165 as observed for the smaller fluorescein [37], it was con- ceivable that the alkylation reaction itself took place in the active site of the A domain (instead of in the freely accessible solvent). In this case, the effect of inhibitor 1 would only be competitive (displacing the labeling reagent) and conclusions would be complicated. As a control we therefore performed the labeling assay in the absence of inhibitor or substrates, but in the pres- ence of increasing amounts of the free Texas-Red fluorophore, which should compete with the Texas- Red bromoacetamide for the binding site and slow down the modification reaction. However, the addition of up to 16 eq. of Texas-Red (compared with the label- ing reagent) had no influence on the reaction velocity of the labeling reaction (see Fig. S6B), thus excluding this alternative interpretation. From these experiments it cannot be completely ruled out that the difference in accessibility of the Ppant thiol group for the chemical labeling reagent was a result of alternative pathways (e.g. the opening and closing of protein channels leading to the active site without the necessity of PCP movement). How- ever, considering the bulkiness of the labeling reagent, such an interpretation seems very unlikely. Taken together, these results support the idea that the Ppant sulfhydryl group is in two distinct locations, which are dependent on the reaction stage of the A domain. Discussion The interaction of the PCP with its neighbouring domains in NRPS systems is crucial in the catalytic cycle and in the directed product assembly in these complex biosynthetic machineries. How these interac- tions are controlled has just recently begun to emerge and the complete picture is still far from being under- stood. Mutational analysis, Ala-scanning mutagenesis and directed protein evolution determined the residues participating in the recognition interfaces on the PCP domain for the interaction with the Ppant transferase, adjacent TE domain and upstream C domain [38–41]. The same techniques were used to investigate the rec- ognition interface of PCP domains with in trans-acting A domains of siderophore-producing NRPS and revealed a region of about eight amino acids N-termi- nal to the Ppant attachment site as part of this interac- tion [39]. Interactions of the PCP domain with the TE domain, as well as the trans-acting Ppant transferase and TEII enzymes, were also studied by NMR spec- troscopy [8,16–18]. These latter studies showed that the PCP domain is intrinsically mobile and can adopt multiple conformations, also dependent on the pres- ence or absence of its post-translational modification. For the interaction with another domain or external enzyme, one of these pre-existing conformational states is selected and stabilized. It can be assumed that such conformational changes also play an important role in the productive interaction between the A domain and the PCP domain. The recently reported crystal structure of a termina- tion module from the surfactin NRPS, consisting of the domains C-A-PCP-TE, suggested that a movement of the PCP is required to bridge the 57 A ˚ distance between the Ppant attachment site on the PCP and the catalytic centre of the A domain; too far for the 18– 20 A ˚ Ppant moiety [19]. This structure also revealed a long linker of 15 amino acids, with little secondary structure, between the A domain and the PCP, which probably allows the PCP to travel between different catalytic centres. In fact, this linker constituted the only connection between the two domains in the observed structure as there is no common protein– protein interaction surface. A potential caveat for the interpretation of these structural findings is that the investigated termination module was crystallized in its inactive apo-form and that it provides only a single snapshot during the catalytic cycle. In this work, we have therefore collected biochemi- cal data from catalytically competent proteins in solu- tion. Our key findings are that (a) in our holo-A-PCP protein the thiol group of the Ppant cofactor can be present in at least two different environments that strongly differ in terms of the accessibility from bulk solvent, and that (b) the switch between these two positions is dependent on the reaction stage of the A domain. In the enzyme primed for amino acyl trans- fer, the Ppant thiol group is more shielded from the solvent. Based on these data, we propose the following model. Binding of inhibitor 1 induces the thioester conformation of the A domain, and the solvent- protected Ppant thiol points simultaneously into the catalytic centre of the A domain awaiting amino acyl transfer. To adopt this conformation, the PCP domain has to dock on the A domain in an orientation whereby the Ppant attachment site faces the channel for this prosthetic group. This specific conformation of the two domains is a highly compact form observed for the holo-form in our native PAGE and gel-filtra- tion analyses. In contrast, in the absence of inhibitor 1, the Ppant moiety is labeled significantly faster, probably because it is oriented towards the bulk solvent. This represents the open conformation of the A domain. An open conformation of an A domain was observed in the above-mentioned structure of the C-A-PCP-TE module [19]. Here, the residue corre- sponding to the Ppant attachment site points away Biochemical studies of NRPS domain interactions J. Zettler and H. D. Mootz 1166 FEBS Journal 277 (2010) 1159–1171 ª 2010 The Authors Journal compilation ª 2010 FEBS from the A domain, consistent with the idea that the Ppant arm should be accessible to bulk solvent. Furthermore, we collected evidence that the apo-PCP domain does not interact in the same way with an A domain poised for thioester formation, as if the bind- ing interface between A and PCP domains is only cre- ated for the holo-PCP. This would be in agreement with a critical contribution of the Ppant in the interaction of A and PCP domains, as well as with the model of differ- ent conformational states of the PCP domain predicting that only one holo-state can support the binding to the A domain [17]. However, because this interpretation is based on the difficult-to-resolve differences observed in assays that only interrogate the globular structure of the proteins, alternative techniques will be required in the future to further investigate this point. Taken together, this work presents, to our knowl- edge, the first biochemical evidence that changing the reaction stage of the A domain (achieved by binding of an inhibitor) affects the relative conformation of the in cis interacting PCP domain. It is conceivable that most of this change is coordinated through a common movement with the A C subdomain during the closing of the subdomains. However, the flexible linker between the A C subdomain and the PCP domain, and the absence of a contact surface between these two folded units [19], argue for a certain degree of flexibil- ity and mobility of the PCP domain relative to the A domain. Understanding these conformational changes with higher atomic resolution will require further structural or spectroscopic studies using catalytically competent proteins. We used a tightly binding inhibi- tor of the A domain to achieve synchronization of the protein ensemble. This strategy appears to be promis- ing for capturing the proteins at the desired stage in the reaction cycle. Recently, the synthesis of hydrolyti- cally stable phosphopantetheinyl analogs was reported [42]. These analogs might prove useful in fixing the next reaction stage in the catalytic cycle of an initia- tion or elongation module (i.e. the interactions between the PCP and condensation or modifying domains) in multidomain NRPS enzymes. Materials and methods General Standard procedures were applied for PCR amplification, purification of DNA fragments and cloning of recombinant DNA [43]. Oligonucleotides were from Operon (Cologne, Germany). Unless otherwise stated, chemicals were pur- chased from Applichem GmbH (Darmstadt, Germany) and Roth (Karlsruhe, Germany). Inhibitors 1 (5¢-O-[N-(l-phenyl)- sulfamoyl] adenosine) and 2 (5¢-O-[N-(l-prolyl)-sulfamoyl] adenosine) were kind gifts of M. Hahn and M. Marahiel [27]. Plasmid construction The gene fragment encoding GrsA A-PCP was PCR ampli- fied from the genomic DNA of Bacillus brevis ATCC 9999 using the primers P1 (5¢- tatccatggtaaacagttctaaaagtatattg) and P2 (5¢- tatagatctctcacttcttcttttactatc). The PCR product was subcloned into a pQE60 vector using NcoI and BglII sites to introduce a C-terminal His 6 -Tag. The NcoI–HindIII fragment of this vector was then ligated into pET16b, result- ing in vector pJZ06. Site-directed mutagenesis was performed according to the Quick change protocol (Stratagene, La Jolla, CA, USA). Plasmid pJZ06 served as a template for two successive point mutations. C60F and C473A were intro- duced using primers P4 (5¢-atgtagccattgtatttgaaaatgagcaact) and P5 ( 5¢- agttgctcattttcaaatacaatggctacat), and P6 (5¢- gaacagc cgtatttggccgcttattttgtatc) and P7 (5¢- gatacaaaataagcggccaaa tacggctgttc), respectively, to give pJZ12. In the same manner, the plasmid pJZ11, encoding the mutations C331A and C376S, was generated using primers P8 (5¢-ccctacggaaacaac gatcgctgcgactacatgggta) and P9 (5¢-tacccatgtagtcgcagcgatcg ttgtttccgtaggg), and P10 (5¢-tgaagctggtgaattatcgattggtggagaa ggg) and P11 (5¢-cccttctccaccaatcgataattcaccagcttca), respec- tively. In order to combine all four mutations, an NdeI fragment containing the two mutations was excised from pJZ11 and ligated into pJZ12 to replace the corresponding NdeI fragment. The resulting plasmid, pJZ13, encoded the A-PCP(D-4Cys) construct. The correctness of the muta- tions in pJZ13 was confirmed by DNA sequencing (GATC, Konstanz, Germany) of the entire insert. Protein overproduction Escherichia coli BL21 (DE3) cells were transformed with the expression plasmids described above. The expression and purification of the C-terminally His 6 -tagged apo-pro- teins were conducted as previously described [44]. As judged by SDS ⁄ PAGE, the proteins could be purified to apparent homogeneity by a single Ni 2+ -affinity chromatog- raphy step. Fractions containing the recombinant proteins were pooled and dialysed against assay buffer [50 mm HE- PES (pH 8.0), 100 mm NaCl, 1 mm EDTA, 10 mm MgCl 2 ]. After the addition of 10% glycerine, the proteins were shock-frozen in liquid nitrogen and stored at )80 °C. The protein concentrations were determined using the calculated extinction coefficient at 280 nm. Synthesis of TAMRA-CoA The modification of CoA was carried out in accordance with a previously reported protocol [45]. In short, 17.3 mg J. Zettler and H. D. Mootz Biochemical studies of NRPS domain interactions FEBS Journal 277 (2010) 1159–1171 ª 2010 The Authors Journal compilation ª 2010 FEBS 1167 CoA trilithium salt dihydrate (21 lmol, 2.1 eq.) was dis- solved in 2 mL of a 100 mm phosphate buffer (pH 7.0). Five milligrams of tetramethylrhodamine-5-maleimide (10 lmol, 1 eq.; purchased from Anaspec Inc., Fremont, CA, USA) was dissolved in 800 lL of dimethylsulfoxide. The solutions were combined and the reaction mixture was agitated at room temperature for 1 h in the dark followed by purification with preparative HPLC on a reverse-phase C18 column with a gradient of 5–50% acetonitrile in 0.05% trifluoracetic acid ⁄ water over 30 min. The purified compound was lyophilized, and the identity was confirmed by MALDI-TOF MS (negative mode): [M-H] ) calculated 1247.3 gÆmol )1 , observed 1247.5 gÆmol )1 . Post-translational modification of the enzymes Conversion of the apo-enzymes into the holo-enzyme or the Ppant-TAMRA modified form was carried out in vitro by adding 40 eq. of CoA or 5 eq. of TAMRA-CoA in the pres- ence of 10 mm MgCl 2 and 0.02 eq. of the Bacillus subtilis Ppant-transferase Sfp [46] overnight at 4 °C. The excess of CoA ⁄ TAMRA-CoA was removed through dialysis. ATP-PP i exchange reaction The ATP-PP i exchange assay was used to confirm the ade- nylation domain activity [35]. Reaction mixtures (final vol- ume 100 lL) contained 50 mm HEPES (pH 8.0), 100 mm NaCl, 1 mm EDTA, 5 mm MgCl 2 , 400 nm apo-enzyme and 1 lm–10 mml-Phe. After 10 min of incubation at 37 °C, the reaction was started by the addition of 5 mm ATP, 25 lm Na 4 P 2 O 7 and 0.015 lm Ci [ 32 P-Na 4 P 2 O 7 ] (Perkin Elmer, Boston) and incubated at 37 °C for 45 s. Reactions were quenched by adding 0.5 mL of a stop mix [1.2% (w ⁄ v) activated charcoal, 0.1 m Na 4 P 2 O 7 and 0.35 m per- chloric acid]. Subsequently, the charcoal was pelleted by centrifugation, washed twice with 1 mL of water and resus- pended in 0.5 mL of water. After the addition of 3.5 mL of liquid scintillation fluid (Roth, Karlsruhe, Germany), the charcoal-bound radioactivity was determined by liquid scin- tillation counting using a 1900CA TriCarb liquid scintilla- tion analyzer (Packard, Meriden, CT, USA). The measured values were corrected using the value of the negative con- trol (without amino acid) and the maximal counts of the radioactive pyrophosphate used. Assuming that the amount of radioactive PP i could be neglected compared with nonra- dioactive PP i , the initial velocities of the reactions were cal- culated. The obtained values were analysed using a Michaelis–Menten approach. Partial tryptic digest The proteolysis reactions of the apo- and the holo-NRPS proteins (6–12 lm) were performed in assay buffer at 37 °C following a pre-incubation step of 10 min with substrates (ATP and l-Phe at a final concentration of 1 mm) or inhib- itors (final concentration 100 lm). The digest was started with the addition of a trypsin solution (0.08 lgÆlL )1 of modified trypsin; Promega, Madison, WI, USA) at a final protease ⁄ protein ratio of 1 : 250 (w ⁄ w). Aliquots were with- drawn at different time-points and the digest was stopped by the addition of SDS loading buffer. To yield a reason- able digest in the presence of the cognate inhibitor 1, the protease ⁄ protein ratio was raised to 1 : 25 (w ⁄ w). A control experiment using the unrelated protein, Sfp, for digestion with trypsin in the absence or presence of 1 ruled out that trypsin itself might be inhibited by 1 (data not shown). Native PAGE Discontinuous native gel electrophoresis was performed similarly to the standard Laemmli SDS ⁄ PAGE protocol, only without SDS [47]. A 5% stacking gel and an 8% sepa- ration gel were used. Before the loading buffer was added, proteins were pre-incubated for 15 min at 37 °C with or without substrates ⁄ inhibitors. The samples were not boiled before loading on the gel. Gel-filtration experiments A Superdex 200 10 ⁄ 300 GL column (GE Healthcare, Chal- font St Giles, UK) was equilibrated with assay buffer [50 mm HEPES (pH 8.0), 100 mm NaCl, 1 mm EDTA, 2mm dithiothreitol, 10 mm MgCl 2 ]. Following pre-incuba- tion with or without inhibitors for 10 min at 37 °C, 200 lL of a 20 lm protein solution was applied onto the column and the absorption at 280 nm was recorded. Column cali- bration was performed using the Gel Filtration Calibration Kit – Low Molecular Weight (GE Healthcare). Chemical labeling of holo-A-PCP(D-4Cys) A 7.5-lm enzyme solution was mixed in assay buffer [50 mm HEPES (pH 7.0), 100 mm NaCl, 1 mm EDTA, 10 mm MgCl 2 ] with 2 mm tris(2-carboxyethyl) phosphine (TCEP) and either 1 mm of substrates (ATP and ⁄ or l-Phe) or 100 lm of the different inhibitors. This mixture was pre-incu- bated for 10 min at 37 °C, and then incubated for 10 min at 25 °C. The reaction was started through the addition of 8 eq. (compared to the enzyme) of Texas-Red C 5 Bromoacetamide (purchased from Invitrogen, Carlsbad, CA, USA; 1 mm stock solution in dimethylsulfoxide) and conducted at 25 °C. Aliquots were withdrawn at various time-points and the reaction was stopped with SDS ⁄ PAGE loading buffer containing 20% (v ⁄ v) mercaptoethanol. The amount of incorporated fluorophore was visualized by UV-illumination of the resulting SDS gel and analysed densitometrically using the program scion image (http://www.scioncorp.com). The Biochemical studies of NRPS domain interactions J. Zettler and H. D. Mootz 1168 FEBS Journal 277 (2010) 1159–1171 ª 2010 The Authors Journal compilation ª 2010 FEBS [...]... lL) was added and the sample was ultrasonicated for 45 min The resulting solution was applied to MALDI-TOF-MS analysis Acknowledgements We thank Martin Hahn and Mohamed Marahiel for the kind gift of the sulfamoyl inhibitors, Helena Janzen for help with statistical analysis and Tulika Dhar for proof-reading of the manuscript Funding was provided by the DFG and the Fonds der Chemischen Industrie References... domain of the fengycin biosynthesis cluster: a structural base for the macrocyclization of a non-ribosomal lipopeptide J Mol Biol 359, 876–889 11 Conti E, Stachelhaus T, Marahiel MA & Brick P (1997) Structural basis for the activation of phenylalanine in the non-ribosomal biosynthesis of gramicidin S EMBO J 16, 4174–4183 12 Gulick AM (2009) Conformational Dynamics in the Acyl-CoA Synthetases, Adenylation. .. Zettler and H D Mootz values obtained were corrected for the intensities obtained from the Coomassie Brilliant Blue-stained gels, which were also analysed using scion image MALDI-TOF-MS analysis After separation by SDS ⁄ PAGE, the protein band was excised and incubated in 300 lL of washing solution (200 mm NH4HCO3, 50% acetonitrile) for 30 min at 37 °C in an Eppendorf tube under shaking conditions The. .. Miller LM, Mazur MT, McLoughlin SM & Kelleher NL (2005) Parallel interrogation of covalent intermedi- 1170 35 36 37 38 39 40 41 42 43 44 45 46 47 ates in the biosynthesis of gramicidin S using highresolution mass spectrometry Protein Sci 14, 2702–2712 Stachelhaus T, Mootz HD & Marahiel MA (1999) The specificity-conferring code of adenylation domains in nonribosomal peptide synthetases Chem Biol 6, 493–505... Industrie References 1 Perham RN (2000) Swinging arms and swinging domains in multifunctional enzymes: catalytic machines for multistep reactions Annu Rev Biochem 69, 961–1004 2 Marahiel MA, Stachelhaus T & Mootz HD (1997) Modular Peptide Synthetases Involved in Nonribosomal Peptide Synthesis Chem Rev 97, 2651–2674 3 Schwarzer D, Finking R & Marahiel MA (2003) Nonribosomal peptides: from genes to products Nat... of hybrid peptidyl carrier proteins ⁄ Acyl carrier proteins in nonribosomal peptide synthetase modules by the 4 ‘-phophopantetheinyl transferases AcpS and Sfp J Biol Chem 277, 17023–17031 Zhou Z, Lai JR & Walsh CT (2007) Directed evolution of aryl carrier proteins in the enterobactin synthetase Proc Natl Acad Sci U S A 104, 11621–11626 Lai JR, Fischbach MA, Liu DR & Walsh CT (2006) Localized protein. .. structure of a non-ribosomal peptide synthetase Nature 454, 903–906 17 Koglin A & Walsh CT (2009) Structural insights into nonribosomal peptide enzymatic assembly lines Nat Prod Rep 26, 987–1000 18 Weissman KJ & Muller R (2008) Protein- protein interactions in multienzyme megasynthetases Chembiochem 9, 826–848 19 Tanovic A, Samel SA, Essen LO & Marahiel MA (2008) Crystal structure of the termination module of. .. inhibition of adenylation domains of nonribosomal peptide synthetases Chembiochem 4, 903–906 28 Ferreras JA, Ryu JS, Di Lello F, Tan DS & Quadri LE (2005) Small-molecule inhibition of siderophore biosynthesis in Mycobacterium tuberculosis and Yersinia pestis Nat Chem Biol 1, 29–32 29 Cisar JS, Ferreras JA, Soni RK, Quadri LE & Tan DS (2007) Exploiting ligand conformation in selective inhibition of non-ribosomal... Electrophoretic mobility of A-PCP(D-4Cys) monitored by native PAGE Fig S5 Gelfiltration runs of apo- and holo-A-PCP(D4Cys) Fig S6 Control experiments of the chemical labeling reaction Biochemical studies of NRPS domain interactions Table S1 Identification of the protein fragments resulting from the partial tryptic digest in solution This supplementary material can be found in the online version of this article... Assembly-line enzymology for polyketide and nonribosomal Peptide antibiotics: logic, machinery, and mechanisms Chem Rev 106, 3468–3496 5 Mootz HD, Schwarzer D & Marahiel MA (2002) Ways of assembling complex natural products on modular nonribosomal peptide synthetases Chembiochem 3, 490–504 6 Keating TA, Marshall CG, Walsh CT & Keating AE (2002) The structure of VibH represents nonribosomal peptide synthetase . Biochemical evidence for conformational changes in the cross-talk between adenylation and peptidyl-carrier protein domains of nonribosomal peptide synthetases Joachim Zettler and Henning. holo -protein. These results provide the first biochemical evidence for the occurrence of conformational changes in the cross-talk between A and peptidyl carrier protein domains of a multi- domain nonribosomal. protein changes. Before the analysis, we incubated the apo- and the holo-forms of the A-PCP protein with inhibitor 1, or without any ligand. As shown in Fig. 3, in the absence of ligands the electrophoretic