pumps for zn ii pb ii and cd ii
Heavy Metals in the Environment - Chapter 15 pps
... ATPases FOR DIVALENT SOFT METALS: PUMPS FOR Zn( II) , Pb (II) , AND Cd (II) The second branch of the soft metal P-type ATPases are those for divalent soft metal ions, including Zn( II) , Pb (II) , and Cd (II) ... resistance to Cu (II) nor catalyzed uptake of 64 Cu in vesicles Thus both ZntA and CadA are extrusion pumps for the divalent soft metal ions Zn( II) , Pb (II) , and Cd (II) ZntA has been purified and shown ... transporters and pumps that catalyze metal extrusion One is the superfamily of P-type ATPases, which includes Cu(I) and Ag(I) pumps, and ZntA and CadA for divalent soft metals ions such as Zn( II) , Pb (II) ,...
Ngày tải lên: 11/08/2014, 15:20
centrifugal pumps for petroleum, heavy duty chemical, and gas industry services
... Nozzle Forces and Moments 2.4.1 Steel and alloy steel horizontal pumps, and their baseplates, and vertically suspended pumps shall be designed for satisfactory performance when subjected to the forces ... seals and glands for all pumps, except vertically suspended pumps shipped without drivers mounted, shallbe installed in the pump before shipment and shall be clean and ready initial service On pumps ... lead-in static O-rings and a for b For overhung and between bearings radially pumps, split minimum 2mm (0.08 in.) chamfered lead-in for dynamic 0multistage horizontal pumps and double casing vertically...
Ngày tải lên: 02/04/2014, 15:32
Nghiên cứu điều chế và sử dụng một số hợp chất chitosan biến tính để tách và làm giàu các nguyên tố hóa học (U(VI), Cu(II), Pb(II), Zn(II) và Cd(II))
... NỒNG ĐỘ CÁC ION U(VI), Cu (II) , Pb (II) , Zn( II) VÀ Cd (II) TRONG MỘT SỐ MẪU NƯƠC 124 3.8 KẾT QUẢ XÁC ĐỊNH HIỆU SUẤT TÁCH LOẠI CÁC ION U(VI), Cu (II) , Pb (II) , Zn( II) VÀ Cd (II) TRONG MẪU NƯỚC THẢI ... Cu (II) , Pb (II) , Zn( II) Cd (II) mẫu nước 52 Sơ đồ 2.6 Quy trình thí nghiệm tách loại U(VI) mẫu nước thải 53 Sơ đồ 2.7 Quy trình thí nghiệm tách loại Cu (II) , Pb (II) , Zn( II) Cd (II) ... liệu ion kim loại U(VI), Cu (II) , Pb (II) , Zn( II) Cd (II) môi trường nước Giới hạn: Nghiên cứu đặc tính hấp phụ giải hấp ion kim loại U(VI), Cu (II) , Pb (II) , Zn( II) Cd (II) môi trường nước tự pha...
Ngày tải lên: 18/04/2014, 17:43
Preparation of chitosan magnetite composite beads and their application for removal of Pb(II) and Ni(II) from aqueous solution
... T (K) Ni (II) – Ni (II) Pb (II) Ni (II) Pb (II) 7.8 – – – 75.71 [5] 299 5.5435 [12] – 114.94 [15] – 140.84 Ni (II) Ni (II) Pb (II) 298 303 303 Fig Langmuir isotherm of the Ni (II) (a) and Pb (II) (b) adsorption ... used as magnetic adsorbents for the adsorption of Ni (II) and Pb (II) The adsorption behaviors of Pb (II) and Ni (II) ions were investigated in aqueous solutions at pH 4–6 and at room temperature as ... capacities qmax are 63.33 and 52.55 mg/g and percentages of ion recovery % r are 90.47 and 75.07% for Pb (II) and Ni (II) respectively at a fixed contact time of 120 and C0 = 70 mg/l Also, it should...
Ngày tải lên: 02/07/2014, 14:14
tóm tắt luận án tiến sĩ hóa học nghiên cứu điều chế và sử dụng một số hợp chất chitosan biến tính để tách và làm giàu các nguyên tố hóa học (u(vi), cu(ii), pb(ii), zn(ii) và cd(ii))
... Instruments and Methods in Physics Research A 723, pp 99–101 [2] N N Duy, L H Khiem, S Kubono, D Kahl et al (2013), “Exotic beam for direct measurement of the 22Mg+α”, Journal of Physical Science and ... “Measurement of the 30 S+a system for type I X-ray bursts”, XII International Symposium on Nuclei in the Cosmos, pp - Các công trình công bố nước [10] N.N.Duy and L.H Khiem (2011), “Feasibility ... N.N.Duy and L.H Khiem (2011), “Design of experiment for (α,p) reaction induced by 22Mg radioactive ion beam”, Proceedings of the topical conference on Nuclear Physics, High energy Physics and Astrophysics,...
Ngày tải lên: 25/07/2014, 09:04
Báo cáo vật lý: "SIMULTANEOUS SPECTROPHOTOMETRIC DETERMINATION OF Pb(II) AND Cd(II) USING ARTIFICIAL NEURAL NETWORKS" potx
... Pb (II) and Cd (II) after reaction with PAR at different concentration of Pb (II) and Cd (II) Figure 2: Absorption spectra for (a) Pb (II) -PAR complex, (b) Cd (II) -PAR complex, and (c) mixture of Pb (II) ... simulation RESULTS AND DISCUSSION Pb (II) and Cd (II) reacted with PAR to form a complex Figure shows the spectra of these complexes The absorption maximum for Pb (II) -PAR and Cd (II) -PAR is 518 and 409 nm, ... obtain Pb (II) and Cd (II) concentrations over this respective determination ranges 1–15 mg/l for Pb (II) and 2–16 mg/l for Cd (II) Then 0.6 ml buffer solution (boric acid and borax (0.2 M)) and 1.5...
Ngày tải lên: 07/08/2014, 14:20
Tóm tắt Luận án Tiến sĩ Hóa học: Nghiên cứu điều chế và sử dụng một số hợp chất Chitosan biến tính để tách và làm giàu các nguyên tố hóa học (U(VI), Cu(II), Pb(II), Zn(II) và Cd(II))
... ion Cu (II) , Pb (II) , Zn( II) Cd (II) 3.7 Kết xác định nồng độ ion U(VI), Cu (II) , Pb (II) , Zn( II) Cd (II) số mẫu nước Bảng 3.5 trình bày kết xác định nồng độ ion U(VI), Cu (II) , Pb (II) , Zn( II) Cd (II) mẫu ... Cu (II) , Pb (II) , Zn( II) Cd (II) pH mà trình hấp phụ CTSK đạt hiệu suất cao ion U(VI) 5, Cu (II) , Pb (II) Zn( II) , Cd (II) Thời gian đạt trạng thái cân hấp phụ U(VI) 660 phút, ion Cu (II) , Pb (II) , Zn( II) ... Giá trị pH tối ưu trình hấp phụ Cu (II) Pb (II) 6, Zn( II) Cd (II) 7, U(VI) - 10 - HS hấp phụ (%) U(VI) 100mg/L Cu (II) 40 mg/L Pb (II) 40 mg/L Zn( II) 20 mg/L Cd (II) 40 mg/L 200 400 600 Thời gian (phút)...
Ngày tải lên: 22/12/2014, 08:43
Bước đầu nghiên cứu cơ bản về tính chất hấp thụ của đa ba zan phwcs long-việt nam với các ion Cu(II), Pb(II), Cd(II),Zn(II)
Ngày tải lên: 04/04/2015, 15:19
Nghiên cứu khả năng hấp phụ các ion kim loại Cu(II), Zn(II), Pb(II) của axit humic
... 1,4 1,2 Cu (II) 0,8 Zn (II) 0,6 Pb (II) 0,4 0,2 pH Hình 3.24 nh hư ng c a pH ñ n t i tr ng h p ph trung bình ion M2+ 100 Hi u su t h p ph (%) 90 80 70 60 Cu (II) 50 Zn (II) 40 Pb (II) 30 20 10 ... 0,8 Zn (II) 0,6 Pb (II) 0,4 0,2 T c ñ ch y (ml/phút) Hình 3.19 nh hư ng c a t c ñ ch y ñ n t i tr ng h p ph trung bình ion M2+ - 18 100 Hi u su t h p ph (%) 90 80 70 60 Cu (II) 50 Zn (II) 40 Pb ... phút ñ i v i Cu2+, 60 phút ñ i v i Zn2 + Pb2 +, khu y ñ u b ng máy khu y t K t qu ñư c trình bày hình 3.11 T i tr ng h p ph (m g/g) 30 25 20 Cu (II) 15 Zn (II) Pb (II) 10 5 pH Hình 3.11 nh hư ng c...
Ngày tải lên: 23/12/2013, 16:33
Tài liệu Báo cáo " synthesis, cloning and expression in escherichia coli of a gene coding for Mcoti-ii " ppt
... chitin gel before (N1) and after (N2) releasing MCoTI -II Fig 12 Changing in SDS-PAGE protein pattern of chitin gel before and after releasing ReMCoTI -II 1,2: N1, N2 (chitin gel before and after ... Expression of recombinant MCoTI -II (ReMCoTI -II) The expression conditions such as ampicillin and IPTG concentrations, temperature and time of induction were tested The growth and induction conditions ... on fig Forward primer: GAATTCCATATGAGCGGCAGCGATGGCGGCGTGTGCCCGA Reverse primer: CGGCTCGAGTTAGCCGCAATAGCCGTTGCCGCGGCAAAT Fig 3: The sequences of the forward and reversed primers for MCoTI -II gene...
Ngày tải lên: 12/02/2014, 10:20
Báo cáo khoa học: Thermosynechoccus elongatus DpsA binds Zn(II) at a unique three histidine-containing ferroxidase center and utilizes O2 as iron oxidant with very high efficiency, unlike the typical Dps proteins ppt
... distances between Zn( II) and the pro˚ tein ligands range between 2.0 and 2.2 A for His51, His63, and His78, whereas those pertaining to Zn( II) ˚ at the B-site and His164 range between 2.2 and 2.5 A in ... displacement of Zn( II) and the formation of Zn Fe complexes, as indicated by the ICP-AES and optical absorbance data Thus, upon addition of oxygen or H2O2, absorption bands at 320 and 370 nm appear, and ... aspartate fi histidine replacement is the basis for the unforeseen binding of Zn( II) at the ferroxidase center, and most likely for the high efficiency of O2 as Fe (II) oxidant These properties differentiate...
Ngày tải lên: 15/03/2014, 09:20
Báo cáo sinh học: " Replicative homeostasis II: Influence of polymerase fidelity on RNA virus quasispecies biology: Implications for immune recognition, viral autoimmunity and other "virus receptor" diseases" pot
... viral concentration and, therefore, viral forces fall between points A and B to D by 102–3 geq/ml (observation 1), the immune forces must also fall by >102–3 between A and B to D for equilibrium ... work and not stand to gain financially or otherwise from it Acknowledgements I thank my wife Sophie J Coleman, and sons Matt and Tim, for everything important, my parents Dick and Janet for extraordinary ... previously, and relates to the replicative kinetics of HCV, HIV and HBV [28] and other viruses causing persistent infection Briefly, and specifically for HCV, if immune functions are responsible for...
Ngày tải lên: 19/06/2014, 08:20
báo cáo hóa học:" Replicative homeostasis II: Influence of polymerase fidelity on RNA virus quasispecies biology: Implications for immune recognition, viral autoimmunity and other "virus receptor" diseases" doc
... viral concentration and, therefore, viral forces fall between points A and B to D by 102–3 geq/ml (observation 1), the immune forces must also fall by >102–3 between A and B to D for equilibrium ... work and not stand to gain financially or otherwise from it Acknowledgements I thank my wife Sophie J Coleman, and sons Matt and Tim, for everything important, my parents Dick and Janet for extraordinary ... previously, and relates to the replicative kinetics of HCV, HIV and HBV [28] and other viruses causing persistent infection Briefly, and specifically for HCV, if immune functions are responsible for...
Ngày tải lên: 20/06/2014, 04:20
Báo cáo khoa học: " Neoadjuvant chemoradiation compared to neoadjuvant radiation alone and surgery alone for Stage II and III soft tissue sarcoma of the extremitie" pps
... with NCR for Stage II and III extremity STS are limited A prospective, randomized trial comparing NCR to NR and SA is needed to provide more robust knowledge In the absence of such information, ... neoadjuvant radiation alone and surgery alone for Stage II and III soft tissue sarcoma of the extremities Radiation Oncology 2011 6:91 Submit your next manuscript to BioMed Central and take full advantage ... LE, UE after treatment The results of this analysis suggest that NCR and NR appear to be effective strategies for Stage II and III STS, perhaps with improved outcomes compared to SA, but NCR is...
Ngày tải lên: 09/08/2014, 09:20
nghiên cứu cấu trúc một số phức chất của zn(ii), cd(ii), pd(ii) với phối tử là dẫn xuất của quinolin bằng phương pháp phiếm hàm mật độ và phương pháp phổ
... với kim loại chuyển tiếp nhƣ Zn, Cd, Hg, Cr, Co, Fe,… Các phức chất đƣợc tổng hợp cách cho dung dịch muối ion kim loại (Zn( II) , Cd (II) , Hg (II) , Cr(III), Co (II) , Fe(III)) vào dung dịch phối tử Q ... : - Tổng quan tài liệu phức chất Zn( II) , Cd (II) , Pd (II) với phối tử dẫn xuất Quinolin - Nghiên cứu thành phần, cấu trúc phân tử phức chất Zn( II) , Cd (II) , Pd (II) với phối tử QAm số phƣơng pháp ... phức chất Zn( II) , Cd (II) , Pd (II) với phối tử dẫn xuất Quinolin phương pháp phiếm hàm mật độ phương pháp phổ’’ Mục tiêu nghiên cứu - Nghiên cứu cấu trúc số phức chất Zn( II) , Cd (II) , Pd (II) với phối...
Ngày tải lên: 18/12/2014, 20:38
nghiên cứu cấu trúc một số phức chất của zn(ii). cd(ii), pd(ii) với phối tử là dẫn xuất của quinolin bằng phương pháp chiếm hàm mật độ và phương pháp phổ
... với kim loại chuyển tiếp nhƣ Zn, Cd, Hg, Cr, Co, Fe,… Các phức chất đƣợc tổng hợp cách cho dung dịch muối ion kim loại (Zn( II) , Cd (II) , Hg (II) , Cr(III), Co (II) , Fe(III)) vào dung dịch phối tử Q ... : - Tổng quan tài liệu phức chất Zn( II) , Cd (II) , Pd (II) với phối tử dẫn xuất Quinolin - Nghiên cứu thành phần, cấu trúc phân tử phức chất Zn( II) , Cd (II) , Pd (II) với phối tử QAm số phƣơng pháp ... phức chất Zn( II) , Cd (II) , Pd (II) với phối tử dẫn xuất Quinolin phương pháp phiếm hàm mật độ phương pháp phổ’’ Mục tiêu nghiên cứu - Nghiên cứu cấu trúc số phức chất Zn( II) , Cd (II) , Pd (II) với phối...
Ngày tải lên: 19/12/2014, 08:53
Toward an Interactive Method for DMEA-II and Application to the Spam-Email Detection System
... by the user Rays ∗ Select a random parent Par ∗ If (the number of CD < nCD ) ∗ Generate a CD and then generate a solution S by perturbing Par with CD ∗ Add Add S and to M ∗ End if ∗ If (the number ... section II briefly describes the concepts and related works about multi-objective optimization interactive method using reference points In section III we have a short description for DMEA -II Section ... rules Before (left) and After (right) the interactive process Fig 22 Results for the proposal interactive method with Value Added Niching approach for SEDA in case of 30 rules Before (left) and After...
Ngày tải lên: 13/08/2015, 10:00
Khảo sát điều kiện tối ưu xác định Cu(II), Zn(II), Co(II)
... Co (II) 0,5 – (ppb), Ni (II) 0,5– (ppb), Cu (II) 0,5 – 23 (ppb) Giới hạn phát hiện: Co (II) 6,7 (ppb), Ni (II) 3,2 (ppb), Cu (II) 3,9 (ppb) Cực đại hấp thụ: Co (II) 580 (nm), Ni (II) 570 (nm), Cu (II) ... 0,5 – (ppb) Giới hạn phát hiện: Co (II) 6,7 (ppb), Ni (II) 3,2 (ppb), Cu (II) 3,9 (ppb) Cực đại hấp thụ: Co (II) 580 (nm), Ni (II) 570 (nm), Cu (II) 555 (nm) pH xác định Co (II) , Ni (II) , Cu (II) 5; 5,5 ... ảnh hưởng nồng độ Cu (II) , Zn( II) , Co (II) 48 3.1.7 Khảo sát ảnh hưởng ion lạ 57 3.2 Xác định Cu (II) , Zn( II) , Co (II) hỗn hợp 61 3.2.1 Xác định Cu (II) , Zn( II) , Co (II) hỗn hợp phương...
Ngày tải lên: 10/04/2013, 10:22
Luận văn nghiên cứu xác định hàm lượng vết kim loại nặng zn, cu, pb, cd trong một số loại nấm linh chi bằng phương pháp von ampe hòa tan anot xung vi phân khóa luận tốt nghiệp đại học
... loại bị khử âm Cd (II) , Co (II) , Ni (II) , Zn( II) , Mn (II) …không gây ảnh hưởng đến việc xác định Cu Oxi hoà tan nước khử cách thêm vào lượng dư Natri sunfit Na2SO3 Cromat, Co(III), Tl(III) cho sóng ... hợp chất tan Pb + PbCl2 + Pb + PbSO4 + → 2HCl PbCl2 + H2 2HCl → H2PbCl4 H2SO4 → H2SO4 PbSO4 + H2 → Pb( HSO4)2 Với axit HNO3 nồng độ chì tương tác kim loại: 21 3Pb + 8HNO3 loãng → 3Pb( NO3)2 + 2NO ... hành ghi phổ xung vi phân Zn2 +, Cd2 +, Pb2 +, Cu2+, dung dịch đệm axetat pH=4,6 rút số kết luận sử dụng điều kiện tham số sau cho trình định lượng Zn( II) , Cd (II) , Pb (II) , Cu (II) là: - Điện cực làm...
Ngày tải lên: 20/12/2013, 18:07
Tổng hợp và nghiên cứu phức chất của Zn(II) với thíoemicacbazon glucozơ
... pseuđomonas phức Ni (II) cha đợc phát Trong số phức Zn (II) Cd (II) với Ac_4Ptsc: Zn( Ac_4Ptsc)SO4, Zn( Ac_4Ptsc)(OAc)2, Cd( (Ac_4Ptsc)(NO3)2, Cd( (Ac_4Ptsc)SO4 hoạt tính Phức Hg (II) nói chung có hoạt ... hợp thử hoạt tính sinh học nh: Zn( Ac 4Mtsc)SO4; Zn( Ac 4Mtsc)Cl2; Zn( Ac 4Mtsc)(NO3)2; Zn( Ac 4Mtsc)(OAc)2; Zn( Ac 2Mtsc)SO4; Zn( Ac 2Mtsc)Cl2; Zn( Ac 2Mtsc)(NO3)2; Zn( Ac 2Mtsc)(OAc)2 (Trong đó: ... ta gán cho phức cấu hình bát diện Các phức chất Cr (III), Co(III), Fe (II) với thiosemicacbazit đợc tổng hợp Việc nghiên cứu phức chất Fe (II) phơng pháp cộng hởng gama xác nhận hợp chất có cấu...
Ngày tải lên: 22/12/2013, 13:09