... Clinically significant oroantral communications a study of incidence and site Int J Oral Maxillofac Surg 1994;23:19-21 Haas R, Watzak G, Baron M, Tepper G, Mailath G, Watzek G A preliminary study of ... characteristics of OAC/OAF; the apexes of tooth 26 were in extremely close approximation to the maxillary sinus, and an area of periapical rarefaction was evident (Fig 1) After the failure of the endodontic ... and clavulanic acid g The fixed partial prosthesis was removed and the contiguous mucosa appeared healthy A buccal full thickness flap was harvested and the presence of a small OAF was verified...
Ngày tải lên: 25/10/2012, 11:48
... substrates Final membrane thickness can be adjusted by simply altering the amount of solution applied About 5–10 μl of polyimide solution was found to be appropriate for a silicon substrate of 0.5 ... nanowires with various diameters of ~50, 90, 150 and 220 nm synthesized from Au nanoparticles with diameter of ~ 30, 50 100 and 150 nm, respectively Fig a, b, and c show polyimide membranes fabricated ... expected to increase the ranges of the pore diameters and densities formed Conclusions Our studies indicate that silicon nanowires can be used as sacrificial templates for the fabrication of porous polyimide...
Ngày tải lên: 16/03/2014, 15:10
Báo cáo Y học: The reactivity of a-hydroxyhaem and verdohaem bound to haem oxygenase-1 to dioxygen and sodium dithionite pdf
... used (Iwatani, Fukuoka, Japan) All other chemicals used were of analytical grade Formation of a- hydroxyhaem-rHO-1 complex Scheme The resonance structure of a- hydroxyhaem Unless otherwise stated, ... 2A, a slight decrease in absorbance between 300 and 600 nm (compare spectra a and b) was probably due to the precipitation of free a- hydroxyhaem These observations indicated that a- hydroxyhaem ... dithionite was added gradually to the verdohaem complex under anaerobic conditions, decreases in absorbance at 400, 535 and 690 nm took place and broad bands appeared at 431 and 795 nm (Fig 4A, spectrum...
Ngày tải lên: 23/03/2014, 21:20
Báo cáo Y học: Activation of a covalent outer membrane phospholipase A dimer pptx
... interface, e.g the Leu32 fi Ala/Leu71 fi Ala/Leu73 fi Ala and Gln94 fi Ala variants These changes are intro˚ duced at a distance of at least 15 A from the active centre and catalytic calcium site Most likely, ... Leu32 fi Ala/Leu71Ala/Leu73Ala variant; lane and 5, Gln94Ala variant; lane and 7, Phe109 fi Met variant The samples in even lanes were incubated at mM EDTA before cross-linking, whereas the samples ... CAATCCGTTCACGGCGTATCCGTACGACACCAA CTACC-3¢) and its complement RK61 for the introduction of the Leu32 fi Ala mutation (restriction site BsiWI), RK62 (5¢-GGATGAAGTAAAGTTTCAAGCTTCCGC AGCATTTCCGC-3¢) and its...
Ngày tải lên: 24/03/2014, 03:21
Báo cáo hóa học: "Reference values and physiological characterization of a specific isolated pig kidney perfusion model" doc
... interrelation of the following parameters can be analyzed: creatinine U/P quotient (U/Pcrea), urine-flow (VU), creatinine-clearance (Clcrea) As a fourth parameter, the fractional reabsorption of water ... special grapho-analytical method (figure 1) This separating analysis is crucial since the Clcrea is commonly used as the approximation of the glomerular filtration rate and thus can be taken as ... the x, y data are transformed into logarithmic scaling and linear lines instead of curves are resulting for constant values of the creatinine clearance In that way figure was constructed and the...
Ngày tải lên: 20/06/2014, 00:20
The roles of a global ph sensor protein chvg in homologous recombination and mutation of agrobacterium tumefaciens
... (exonuclease I ) SbcCD SSB DNA topoisomerase I DNA gyrase DNA ligase DNA polymerase I Helicase II Helicase IV Chi (χ) Activity DNA strand exchange; DNA renaturation; DNA dependent ATPase; DNA- and ATP-dependent ... recombination, mutagenesis is also fundamental to all organisms, because it generates variability that conditions all evolutionary change (Drake, 1991) During growth of an organism, DNA can be damaged ... to a dsDNA break As in DNA strand invasion model, the generation of ssDNA can occur by a few alternative means A simple means is to use strand-specific dsDNA exonuclease to degrade one strand and...
Ngày tải lên: 14/09/2015, 17:48
Physiological roles of CIDEs CIDEA deficient mice exhibit lean phenotype and are obesity resistant 6
... Sakahira, H., Enari, M., and Nagata, S (1998) Cleavage of CAD inhibitor in CAD activation and DNA degradation during apoptosis Nature 391, 96-99 Sakahira, H., Enari, M., Ohsawa, Y., Uchiyama, ... H., Fukuda, Y., Inazawa, J., Toh, H., and Nagata, S (1998) Molecular cloning and characterization of human caspase-activated DNase Proc Natl Acad Sci U S A 95, 9123-9128 Nagata, S (1997) Apoptosis ... receptor Adenyl cyclase AMPK AMPKK Activation AMPK-P ACC cAMP ATP HSL ACC-P R2C2 (inactive PKA) 2C (active PKA) R2(cAMP)4 Triglyceride HSL-P (active) FFA Malonyl-CoA Acetyl-CoA Fatty acyl-CoA CPT1...
Ngày tải lên: 17/09/2015, 17:19
Physiological roles of CIDEs CIDEA deficient mice exhibit lean phenotype and are obesity resistant 5
... mice analyzed by Northern blot analysis Sample loading: lane1: BAT, lane2: liver, lane3: Kidney, lane4: skeletal muscle, lane5: heart, lane6: WAT, Lane7: Lung 30µg of total RNA was loaded in each ... amount of mitochondria in each yeast strain Yeast CDC28p was used as a loading control Western-blot analysis of mitochondria membrane fractions showed that both Cidea and UCP1∆3 are associated ... of Cidea expression were associated with aging; a state characterized by lower metabolic rates and increased risk of obesity A hypothesis that emerges at this stage is that Cidea may have a role...
Ngày tải lên: 17/09/2015, 17:19
Physiological roles of CIDEs CIDEA deficient mice exhibit lean phenotype and are obesity resistant 4
... using Cidea cDNA as a probe and β-Actin for normalization of RNA loading Western: The functional inactivation of Cidea gene was further demonstrated by Western blot analysis using anti-Cidea antibody, ... recombination, but short enough to be cloned and maintained in a bacterial vector, with reliable options for PCR and Southern blot analysis for the screening of clones A PCR analysis is rapid and can ... were loaded in each lane Anti-tublin was used for protein loading normalization (lower panel) 3.4 Mouse Cidea genomic map and gene targeting strategy To elucidate the biological role of Cidea in...
Ngày tải lên: 17/09/2015, 17:20
Physiological roles of CIDEs CIDEA deficient mice exhibit lean phenotype and are obesity resistant 3
... coli strain was streaked onto an Luria-Bertani (LB) (pH 7.5) agar plate (containing 1% bacto-tryptone, 0.5% bacto-yeast extract, 1% NaCl, and 1.5% agar) without antibiotics and incubated at 37°C ... 5´–ATGGTGAAGGTCGGTGTGAA– 3´, and 5´–ACCAGTAGACTCCAACGACAT–3´ 2.2.13 Mouse-tail Genomic DNA extraction Mice genomic DNA is isolated from mice tails The tails were lysed in genomic lysis buffer as ... Rabbit anti-flag (Affinity Bioreagents, USA), anti-HA (Santa Cruz, USA), anti-Cidea (Chemicon, USA), anti-UCP1 (Research Diagnostic, USA), anti-mouse or yeast COX IV (Molecular Probe, USA), anti-cytochrome...
Ngày tải lên: 17/09/2015, 17:20
Physiological roles of CIDEs CIDEA deficient mice exhibit lean phenotype and are obesity resistant 2
... membrane breakdown, DNA fragmentation, chromatin condensation, and formation of apoptotic bodies (Takahashi, 1999) DNA fragmentation is often considered a hallmark of apoptosis, a result of the activation ... caspases, activation is achieved in presumably an autocatalytic fashion Subsequently, activated initiator caspases proteolytically activate downstream effector caspases such as caspase-3 and ... Apaf-1, procaspase 9, cytochrome c) Avtive caspase Pro-effector caspases Active effector caspase 3,6,7 Vital substrates like DFF Apoptosis Figure Apoptotic pathways and caspase activation Death...
Ngày tải lên: 17/09/2015, 17:20
Physiological roles of CIDEs CIDEA deficient mice exhibit lean phenotype and are obesity resistant
... 5’cgagtcgcagaaaagaagccacaaaaaaggccgtcggtccttccttgg-3’ D95’: 5’-gcgatgtccatgtacaccaagtttgtggcttcttttctgcgactcggg-3’ D93’: 5’-cccgagtcgcagaaaagaagccacaaacttggtgtacatggacatcgc-3’ PGAL1: 5’-caaatgtaataaaagtatcaac-3’ ... 5’-catcaattttgtaggcgtgtaggg-3’ Probe3: 5’-gtttaaaacaacagagttgaaacatag-3’ Probe4: 5’-gcagaggcatgtcaacctacatacag-3’ Probe5: 5’-ctgaatagactggttcttcaaccttg-3’ Neo5’: 5’-cccagcgtcttgtcattggcgaattc-3’ ... ccgctcgagtcaaaagggtgcctcccgggattc-3’ R276Q5’: 5’gggtttgtggcttcttttctggaactcgggtcctggaacgtcatcatg-3’ R276Q3’: catgatgacgttccaggacccgagttccagaaaagaagccacaaaccc-3’ M45-2 NCOI: 5’gctcctataggcaaactatccccagg-3’...
Ngày tải lên: 17/09/2015, 17:20
TÀI LIỆU TIẾNG ANH NGÀNH MAY roles of a merchandiser in garment industry vai trò của nhân viên quản lý đơn hàng trong ngành công nghiệp may
... others not accept extra quantities Quality Department: A garment merchandiser should be aware of the company goals and quality standards along with the quality standards acceptable limit to each buyer ... time frame available There are many software packages available e.g SAP for this work Role of garment merchandiser with HR Department: A garment merchandiser should inform the HR [Human Resource] ... accessories manager and the garment merchandiser Generally an extra 3% is ordered than the actual required quantity but this can vary organization to organization and the size of the order Role of garment...
Ngày tải lên: 13/11/2015, 00:22
Tài liệu Báo cáo khoa học: Purification and characterization of a membrane-bound enzyme complex from the sulfate-reducing archaeon Archaeoglobus fulgidus related to heterodisulfide reductase from methanogenic archaea pdf
... of AF499 was identified as an archaeal promoter element by sequence analysis The sequence AAAGGTTAATATA shows a high level of identity with the consensus sequence ()35 to )23, AAANNNTTATATA); ... the gel (lane B2) This behavior is typical of integral membrane proteins The polypeptide with an apparent molecular mass of 53 kDa appears as a double band in unboiled samples (lanes A1 and B1) ... arrow indicates the absorption maximum of the a band at 557 nm absorption maxima at 420 nm (c band), 530 nm (b band) and 557 nm (a band) are characteristic of cytochrome b Heme was extracted from...
Ngày tải lên: 21/02/2014, 03:20
Báo cáo khoa học: Characterization of a membrane-bound aminopeptidase purified from Acyrthosiphon pisum midgut cells A major binding site for toxic mannose lectins pptx
... APN3 AAX39865 Tni APN3 AAN75694 Har APN2 AAF37560 Hpu APN3 AAF99701 Epo AAD31183 Ldi APN1 AAC36148 Pin AAK58066 Hvi AAL83943 Bmo APN3 AAF37559 Hpu APN2 AAB70755 Pxy AAK69605 Sli AAF08254 Hvi AAX39866 ... Tni APN4 AAN75693 Har APN1 AAF37558 Hpu APN1 BAA33715 Bmo Family Family AAX39863 Tni APN1 AAC33301 Bmo Q11001 Mse CAA10950 Pxy P91885 Mse APN2 BAA32140 Bmo 0.1 AAD31184 Ldi APN2 A pisum APN CAA66467 ... mammalian APN, a family showing a broad specificity towards aminoacyl b-naphthylamides Chemical modification experiments revealed that a metal ion, a carboxylic group, and the lateral chains of...
Ngày tải lên: 16/03/2014, 12:20
Báo cáo Y học: High pressure-induced changes of biological membrane Study on the membrane-bound Na+/K+-ATPase as a model system pdf
... subunits, disassembly of transmembrane a helices, and a separation in the contact surface of membrane and protein due to the thickening and shrinkage of lipid bilayer For the last case, a quantitative ... 40 Tsuda, T., Kaya, S., Yokoyama, T., Hayashi, Y & Taniguchi, K (1998) ATP and acetyl phosphate induces molecular events near the ATP binding site and the membrane domain of Na+, K+-ATPase: The ... concentration of Na+ activates pyruvate kinase without K+ [27] The reaction was initiated by an addition of lg enzyme K+-activated phosphatase activity was determined as K+-dependent pNPPase activity...
Ngày tải lên: 24/03/2014, 00:21
Báo cáo khoa học: Characterization of a membrane-bound angiotensin-converting enzyme isoform in crayfish testis and evidence for its release into the seminal fluid ppt
... failed to exhibit any signal (not shown) A leptodactylus testicular ACE activity assays To determine the enzymatic activity of the testicular A leptodactylus ACE, an activity assay with a radioactive ... catalytic domains, such as somatic mammalian ACE, whereas Asl-tACE, with less than 700 residues, is likely to display only one catalytic domain, such as mammalian gACE Interestingly, data mining and reconstruction ... show that ACE mRNA is mainly present in spermatogonia (i.e in the early stages of spermatogenesis), whereas only a small amount or even an absence of RNA was detected in mature spermatozoids, and...
Ngày tải lên: 30/03/2014, 01:20
báo cáo khoa học: " A membrane-bound matrix-metalloproteinase from Nicotiana tabacum cv. BY-2 is induced by bacterial pathogens" pdf
... CAT GGA CGA GCT GTA CAA GTC TAA CCC AAA TTT TAC TGG G-3') and NtMMP-Cterm_rev (5'-TCT AGA TTT AAA TTA AAT GGA GAA ATG ATA AG-3') Introduced restriction sites are shown in italic The three fragments ... Preincubation of all recombinant forms with APMA, a metallo-organic activator of metalloproteases [16], did not enhance casein degradation, indicating that recombinant NtMMP1 is already present in an active ... Zymography Protease activity was visualized by in-gel assays using casein as a substrate [45] The substrate was co-polymerized with the acrylamide at a final concentration of 0.1% (w/v) SDS-PAGE was...
Ngày tải lên: 12/08/2014, 03:20
Báo cáo y học: " Generation of H9 T-cells stably expressing a membrane-bound form of the cytoplasmic tail of the " pps
... a 4aa spacer to the membrane- spanning (TMD) and CT domains of the HIV BH10-Env protein (aa 684–851) The 4aa spacer consists of HIV-Env aa (Thr, Glu) C-terminal to the HIVSP cleavage site and ... drafting the manuscript TP carried out FACS, Western blot and membrane fractionation analyses VB participated in the design of the study and in drafting the manuscript All authors read and approved ... Western blot analysis of equivalent amounts of these fractions demonstrated that the Env-TMD-CT protein was localised predominantly in the membrane fraction and only a minor amount remained in the...
Ngày tải lên: 13/08/2014, 09:21