Physiological roles of CIDEs CIDEA deficient mice exhibit lean phenotype and are obesity resistant

PHYSIOLOGICAL ROLES OF CIDES: CIDEA DEFICIENT MICE EXHIBIT LEAN PHENOTYPE AND ARE OBESITY RESISTANT ZHOU ZHIHONG INSTITUTE OF MOLECULAR AND CELL BIOLOGY NATIONAL UNIVERSITY OF SINGAPORE 2004 PHYSIOLOGICAL ROLES OF CIDES: CIDEA DEFICIENT MICE EXHIBIT LEAN PHENOTYPE AND ARE OBESITY RESISTANT ZHOU ZHIHONG (M.Sc. Tsinghua Univ.) A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY INSTITUTE OF MOLECULAR AND CELL BIOLOGY NATIONAL UNIVERSITY OF SINGAPORE 2004 Acknowledgments Acknowledgments I would like to express my sincere gratitude to my supervisor, Dr. Peng Li for providing me the opportunity to pursue my Ph.D. research work in her laboratory. I am grateful to Dr. Li for her guidance, support throughout my graduate studies. I am thankful to my graduate supervisory committee, Drs. Xiaohang Yang, Victor Yu, and Sathival Ponniah for their constructive suggestions and critical comments. Thanks Dr. Sathival Ponniah for his guidance and collaboration with generating the gene targeting mice for both Cidea and Cideb. Also thanks Esther Wong and all the other staffs of in vivo unit for providing excellent technical support and working environment for animal model generation and animal phenotype analysis. I would like to thank past and present members of the LP laboratory for their helpful discussion, technique assistance, cooperation and friendship. Especially thank Le-Ann Hwang, Hao Lu, Hilda Ng, and Boon Tin Chua for their technical support. Special thanks go to Dr. Ke Guo, Dr. Zhengming Chen and Mr. Shen Yon Toh for helping with the Cidea knock-out mice phenotype analysis. Thanks also go to Ms. Jie Li and Ms. Lixia Xin for their technical support on histological analysis. I appreciate very deeply for Mr. Heinz Horstmann and Mr. Ng Cheepeng who provided very good EM pictures. Many thanks go to the members in CMJ’s lab Dr. Guisheng Zeng, Ms. Xianwen Yu and Ms. Jun Wang on helping with the yeast construct and culture technical support. I thank Dr. Shabbir Moochhala in Defence Medical Research Institute in Singapore for providing the animal metabolic facility. I gratefully acknowledge Dr. i Acknowledgments Fredric Kraemer (Standford University) for HSL antibodies and Dr. Wolfgang Hofmann from Dr. Leslie Kozak’s laboratory for his suggestions. I am deeply grateful to Drs. Bor Luen Tang and Victor Nurcombe for their critical comments on my thesis writing. I appreciate very much the friendship with Dr. Tong Zhang, Dr. Jormay Lim and Ms Lei Li. The beautiful time we spent in IMCB together will be good memories for me forever. My heartfelt appreciation goes to my parents and sister for their constant support and encouragement, without whom this would have remained but a dream. Finally, my deepest gratitude goes to my husband for his unconditional love, understanding and support through the years. ii List of Publications List of Publications Zhou, Z., Toh, S.Y., Chen, Z., Guo, K., Ng, C.P., Ponniah, S., Lin, S.C., Hong, W., Li, P. (2003). Cidea deficient mice have lean phenotype and are resistant to obesity. Nat. Genet. 35(1): 49-56. Chen, Z., Guo, K., Toh S.Y., Zhou, Z., Li, P. (2000) Mitochondria localization and dimerization are required for CIDE-B to induce apoptosis. J. Biol. Chem. (Communication). 275: 22619-22622. iii Table of Contents Table of Contents Acknowledgments i List of Publications iii Table of Contents . iv Summary ix List of Figures xi List of Oligonucleotides .xiii Chapter Introduction to cell death-inducing DFF45-like effectors (CIDEs) . 1.1 Apoptosis and DNA fragmentation 1.2 DNA fragmentation factors (DFF) discovery and known facts 1.3 Physiological roles of DFF . 1.4 Discovery of CIDEs 1.5 Background information on obesity and adipose tissue . 11 1.5.1 Obesity . 11 1.5.2 Body weight regulation 12 1.5.3 The liver plays a central role in lipid transport and metabolism 17 1.5.4 Adipose tissue is the main store of triglycerides in the body 19 1.5.5 Adipose tissue as an endocrine organ 21 1.5.6 Hormones regulate fat mobilization in adipose tissues 22 1.5.7 Brown adipose tissue promotes thermogenesis . 25 1.5.8 Control of energy expenditure-adaptive thermogenesis by BAT 27 1.6 Rationale and aim of research . 30 iv Table of Contents Chapter Materials and Methods . 31 2.1 Chemicals and reagents . 32 2.1.1 General list of cell culture medium and reagents . 32 2.1.2 Mouse embryonic fibroblast (MEF) culture medium 32 2.1.3 Embryonic stem (ES) cells culture medium 32 2.1.4 Genomic DNA extraction buffer . 33 2.1.5 Blood chemistry reagent 33 2.1.6 Antibodies List . 33 2.1.7 Embryonic Stem Cells and Mice Strains . 33 2.2 Molecular Biology Techniques and Methods . 34 2.2.1 Expression constructs . 34 2.2.2 Preparation of E.coli competent cells 34 2.2.3 DNA transformation 35 2.2.4 DNA preparation 35 2.2.5 Restriction enzyme digestion of DNA . 36 2.2.6 Purification of DNA fragments 36 2.2.7 DNA ligation 37 2.2.8 Polymerase chain reaction (PCR) 37 2.2.9 RNA extraction 37 2.2.10 Northern & Southern blotting 38 2.2.11 Dot blotting 38 2.2.12 Reverse transcriptase –polymerase chain reaction (RT-PCR) . 38 2.2.13 Mouse-tail genomic DNA extraction . 39 2.2.14 In situ cell death assay . 39 2.2.15 In situ hybridization . 39 v Table of Contents 2.2.16 Site-directed mutagenesis 40 2.2.17 SDS-polyacrylamide gel electrophoresis . 40 2.2.18 Immunoprecipitation (IP) . 41 2.2.19 Western blot analysis . 41 2.2.20 End labeling of oligonucleotides . 42 2.2.21 Random prime labeling of double-stranded DNA fragments 43 2.2.22 TCA precipitation for yeast protein extraction 43 2.2.23 Transfection of mammalian cells . 44 2.2.24 Heavy membrane preparation from brown adipose tissue . 44 2.3 Gene targeting procedure 45 2.3.1 General procedures for targeted gene disruption in mice 45 2.3.2 Mouse genomic DNA library screening 46 2.3.2.1 Preparation of Cidea and Cideb cDNA probe 46 2.3.2.2 Preparation of bacterial host . 46 2.3.2.3 Titration of λ phage library . 47 2.3.2.4 Primary screening of genomic DNA library . 47 2.3.2.5 Secondary and tertiary screening of genomic DNA library 48 2.3.3 Phage DNA preparation . 49 2.3.4 Mapping of Cidea and Cideb locus and construction of the targeting vector . 49 2.3.5 Transfection of targeting vectors into embryonic stem (ES) cells . 50 2.3.5.1 ES cells culture . 50 2.3.5.2 ES cells transfection 50 2.3.6 ES cells cloning 51 vi Table of Contents 2.3.7 Screening of homologus recombinant clones by PCR and Southern analysis . 51 2.3.8 Generation of Cidea and Cideb null mice 51 2.4 Histological analysis of mice tissue 52 2.4.1 Paraffin section & cryosection . 52 2.4.2 Haematoxylin & eosin (H&E) staining 52 2.4.3 Electron microscopy (EM) . 53 2.5 Blood chemistry 53 2.6 Hormone-sensitive lipase (HSL) assays . 54 2.7 Mice physiology 54 2.7.1 Core body temperature . 54 2.7.2 Glucose tolerance test (GTT) and insulin tolerance test (ITT) 55 2.7.3 Mice metabolism and food intake experiments and measurements . 55 2.7.4 Mice adiposity index 55 2.7.5 Adipose tissue lipolysis assay 56 2.7.6 Preadipocyte isolation and differentiation . 56 2.8 Statistics 57 2.9 Plasmid construction, expression of UCP1∆3 and Cidea in yeast and measurement of mitochondria potential 57 Chapter Generation of Cidea and Cideb null mice 58 3.1 Introductions to gene targeting . 59 3.1.1 History 59 3.1.2 Embryonic stem cells . 59 3.1.3 Gene targeting vectors . 60 vii Table of Contents 3.2 Mouse Cideb genomic mapping and cloning 62 3.3 Generation of Cideb null mice 66 3.4 Mouse Cidea genomic map and gene targeting strategy 67 Chapter Phenotype analysis of Cidea null mice 71 4.1 Cidea expression is restricted to brown adipose tissue (BAT) . 72 4.2 Cidea expression increases in adult and aged mice 75 4.3 Cidea null mice not exhibit a difference in differentiation and cell death compared to wild type mice. . 79 4.4 Higher core body temperature and metabolic rate in Cidea-null mice . 83 4.5 Enhanced lipolysis in BAT of Cidea-null mice 86 4.6 Less adiposity and lean phenotype in Cidea-null mice 94 4.7 Levels of glucose, FFA and triglycerides in Cidea-null mice 98 4.8 Cidea interacts with and inhibits uncoupling protein (UCP1) . 100 Chapter Discussion 106 References . 116 viii Summary Summary Fragmentation of genomic DNA is an evolutionarily conserved event associated with apoptotic cell death, and it is mediated by DNA fragmentation factor (DFF). DFF is composed of two subunits, DFF40 (also named caspase-activated DNAse or CAD, and caspase-activated nuclease or CPAN) and DFF45 (also called inhibitor of CAD or ICAD). DFF45 is the chaperon and a DNAse inhibitor of DFF40. The CIDE (cell death-inducing DFF45 like effectors) proteins were identified as proteins with homology to DFF45. They include Cidea, Cideb, and FSP27, which is a 27-kDa fat cell specific-protein with unknown function. The CIDE proteins are highly homologous. A CIDE-N domain at their amino terminus has significant homology to the regulatory domains of DFF40 and DFF45. The carboxyl terminal domain of CIDE proteins is an effector domain designated as CIDE-C. Over expression of Cidea or Cideb alone induced not only nuclear condensation and DNA fragmentation, but also membrane blebbing and cellular fragmentation, which implies that the mechanism of CIDE function is different from that of DFF45. The project aims at investigating the in vivo physiological roles of CIDEs. It was shown that both Cidea and Cideb were localized in the mitochondria. Northern blot analysis revealed that Cideb was expressed at high levels in liver and spleen, and at moderate levels in the kidney. FSP27 was detected in white adipose tissue, brown adipose tissue (BAT) and muscle tissue. In situ hybridization analysis suggested that Cidea is expressed specifically in BAT. The specific expression patterns of the CIDE family members indicate that their in vivo roles could also be related to the regulation of metabolism other than apoptosis. In order to resolve the physiological functions of ix Summary CIDEs, targeted gene-disruption animal models for Cidea and Cideb were generated. The phenotypes of the Cidea knock-out mice were analyzed in detail. Cidea is expressed at high levels in the BAT. BAT plays an important role in adaptive thermogenesis and energy expenditure. Its thermogenic activity is mediated through the mitochondrial uncoupling protein (UCP1) that uncouples ATP generation and dissipates the energy as heat. It was observed that the core body temperature for Cidea-/- mice was consistently higher than that of wild-type mice of the same genetic background when subjected to cold treatment. The BAT of Cidea-/- mice also exhibited increased lipolysis with increasing age or cold exposure. Most strikingly, Cidea-/- mice are much leaner than wild type mice, with a 64% weight reduction in white adipose tissue (WAT). The Cidea-/- mice are resistant to diet-induced obesity and diabetes. Further, it was found that the role of Cidea in regulating thermogenesis, lipolysis and obesity is mediated at least in part through its direct suppression of UCP1 activity. The data demonstrate a role for Cidea in regulating energy balance and adiposity and suggest Cidea as a novel target for the development of anti-obesity therapy. x List of figures List of Figures Figure Page Figure Apoptotic pathways and caspase activation. Figure Solution structure of CIDE-N domain [19] Figure Mechanisms of activation of DFF Figure 4A Schematic structure of mouse Cidea, Cideb, FSP27 and DFF45 Figure 4B Sequence alignments of CIDEs family members. . Figure Leptin’s physiologic function as a signal reporting the body’s status of energy store in adipose tissue . 14 Figure Liver plays a central role in lipid transport and metabolism 19 Figure Key metabolic cycles in the adipose tissue. . 20 Figure The mechanism of hormonally induced uncoupling of oxidative phosphorylation in brown fat mitochondria 24 Figure Paraffin sections of adult mice BAT (upper) and WAT (lower) stained with hemotoxylin & eosin . 26 Figure 10. A simple gene targeting vector and screening strategy. 61 Figure 11. Targeted disruption of the Cideb Gene . 63 Figure 12A Genomic DNA sequence of the 5’ region of Cideb gene 64 Figure 12B Genomic DNA sequence of the 3’ region of Cideb gene 65 Figure 13 Inactivation of Cideb in mouse . 67 Figure 14 Targeted disruption of the Cidea Gene 68 Figure 15 Deletion of Cidea in mice . 69 Figure 16 High levels of Cidea expression in BAT 73 Figure 17 In situ hybridization analysis of Cidea expression . 74 Figure 18 Increased levels of Cidea expression in adult and aged mice. . 77 xi List of figures Figure 19 Differentiation markers RNA levels in BAT and WAT . 79 Figure 20 BAT protein expression levels . 80 Figure 21 Light micrograph of liver sections of 9-month-old Cidea+/+ and Cidea-/mice . 81 Figure 22 Genomic DNA content of BAT 82 Figure 23 TUNEL staining of BAT paraffin sections. . 82 Figure 24 Core body temperature before and after placement at ºC from 22 ºC. 84 Figure 25 Indirect calorimetry methods for measuring mice energy expenditure 85 Figure 26 Cidea null mice had increased metabolic rate. . 85 Figure 27 Images of transmission electron microscopy of BAT. . 87 Figure 28 Quantification of lipid volume density . 87 Figure 29A Images of H&E stained BAT . 90 Figure 29B Images of H&E stained BAT . 91 Figure 30 Increased lipolysis in BAT of Cidea null mice. . 93 Figure 31 Reduced adiposity and a lean phenotype in Cidea null mice. 95 Figure 32 Less lipid content in the WAT of Cidea null mice 96 Figure 33 Glucose tolerance and insulin tolerance test. . 99 Figure 34 Cidea co localizes with UCP1 and interacts with UCP1 101 Figure 35 Cidea inhibits UCP1 mitochondrial uncoupling activity in yeast 104 Figure 36 Schematic diagram showing how Cidea regulates BAT metabolism. . 114 Table Metabolic parameters of wild-type and Cidea null mice . 85 xii List of Oligonucleotides List of Oligonucleotides HIndIII-UCP-2 5’: 5’ cccaagcttatggttggtttcaaggccaccg-3’ XhoI-UCP-2 3’: 5’ ccgctcgagtcaaaagggtgcctcccgggattc-3’ R276Q5’: 5’gggtttgtggcttcttttctggaactcgggtcctggaacgtcatcatg-3’ R276Q3’: catgatgacgttccaggacccgagttccagaaaagaagccacaaaccc-3’ M45-2 NCOI: 5’gctcctataggcaaactatccccagg-3’ F-Y5’: 5’-ggaaggaccgacggccttttacaaagggtttgtggcttcttttctg-3’ F-Y3’: 5’-cagaaaagaagccacaaaccctttgtaaaaggccgtcggtccttcc-3’ DFKG5’: 5’ccaaggaaggaccgacggccttttttgtggcttcttttctgcgactcg-3’ DFKG3’: 5’cgagtcgcagaaaagaagccacaaaaaaggccgtcggtccttccttgg-3’ D95’: 5’-gcgatgtccatgtacaccaagtttgtggcttcttttctgcgactcggg-3’ D93’: 5’-cccgagtcgcagaaaagaagccacaaacttggtgtacatggacatcgc-3’ PGAL1: 5’-caaatgtaataaaagtatcaac-3’ PTER: 5’-gtttcgttcaagtcgacaacc-3’ MUCP-1 in1: 5’-gcctctgaatgcccgcaggc-3’ MUCP-1 in2: 5’-gcctctctcggaaacaagatc-3’ xiii List of Oligonucleotides MUCP-1 in3: 5’-ctctctgccaggacagtatcc-3’ MUCP-15’ SacI: 5’-cgagctcgatggtgaacccgacaacttccgaag-3’ MUCP-13’XhoI: 5’-ccgctcgagcggttatgtggtacaatccactgtctgcct-3’ MUCP-15’BamHI: 5’-cgggatccatggtgaacccgacaacttccgaag-3’ MUCP-13’XbaI: 5’-gctctagagcttatgtggtacaatccactgtctgcct-3’ UCP-15’NCOI: 5’-catgccatggcaatggggggcctgacagcctcggac-3’ Ucp13’XbaI: 5’-gctctagagcttatgtggcacagtccatagtctg-3’ Probe1: 5’cagagtgtataatttcaaataaattg-3’ Probe2: 5’-catcaattttgtaggcgtgtaggg-3’ Probe3: 5’-gtttaaaacaacagagttgaaacatag-3’ Probe4: 5’-gcagaggcatgtcaacctacatacag-3’ Probe5: 5’-ctgaatagactggttcttcaaccttg-3’ Neo5’: 5’-cccagcgtcttgtcattggcgaattc-3’ Neo3’: 5’-ccgaacaaacgacccaa M45-25’NdeI: 5’-ggaattccatatggagaccgccagggactacgcgggagccctcatcaggcccc-3’ M45-23’BamHI: 5’-cgggatcccgttacatgaaccagcctttggtgc-3’ M45-2PstI-3’-1: 5’-ccacagtaccttgctgataagttcc-3’ xiv List of Oligonucleotides M45-2PstI-3’-2: 5’-gccccaggcctggactctgagctag-3’ M45-2 E6.0T7-1: 5’-ggcacagaaccaaaaccccgaagtg-3’ M45-2 E6.0T7-2: 5’-cagctcagcggcagaatactgacc-3’ M45-2PCR1: 5’-ggtctctgacaaagctcatgattc-3’ Neo-5: 5’-ccatcttgttcaatggccgatccc-3’ M45-3NCOI: 5’-ctgacagctgccagcctccaagaac-3’ GTNeo: 5’-gctacccgtgatattgctgaagag-3’ ALBP5’: 5’-gtgtgatgcctttgtggg-3’ ALBP3’: 5’-catgccctttcataaactc-3’ Adipsin5’: 5’-gcacagctccgtgtacttcg-3’ Adipsin3’: 5’-caggatgtcatgttaccatttg-3’ Pparg5’: 5’-ggttgacacagagatgccattc-3’ Pparg3’: 5’-caagtccttgtagatctcctgg-3’ ALBP: 5′ primer, CTCCTG TGCTGCAGCCTTTCTC And 3′ primer, CGTAACTCACCACCACCAGCTTGTC; CoxII: 5′ primer, CCATTCCAACTTGGTCTACAA And 3′ primer, GGAACCATTTCTAGGACAATG; xv List of Oligonucleotides Adipsin: 5′ primer, GAGGCCGGATTCTGGGTGGCCAG And 3′ primer, CGATCCACATCCGGTAGGATG; PPARγ: 5′ primer, GGTTGACACAGAGATGCCATTC And 3′ primer, CAAGTCCTTGTAGATCTCCTGG; CIDE-A 5′ primer, atggagaccgccagggactacgcg And 3′ primer, CAGAAGAGCAGCCATCCCCCAAGC; FSP27: 5′ primer, ATGGACTACGCCATGAAGTC And 3′ primer TCATTGCAGCATCTTCAGAC; HSL: 5′ primer, ATGGATTTACGCACGATGAC And 3′ primer, TCAGTTCAGTGGTGGTGCAGCAG; LPL: 5′ primer, ATGGAGAGCAAAGCCCTGCT And 3′ primer, TCAGCCAGACTTCTTCAGAG M45-2p1: 5’-cgctgctcgcaggagcgcacgctg-3’ M45-2p2: 5’-gacagaaatggacaccgggtag-3’ M45-2p3: 5’-ccacgcagttcccacacactccgc-3’ M45-2p4: 5’-atggagaccgccagggactacgcg-3’ M45-2p5: 5’-catgaatgtcaggggcctgatgag-3’ xvi List of Oligonucleotides M45-2p6: 5’-cagaagagcagccatcccccaagc-3’ M45-2p7: 5’-catgaaccagcctttggtgctagg-3’ M45-3p1: 5’-ccatccctctgcatggagtacc-3’ M45-3p2: 5’-gccagagctggagccccaagagtg-3’ M45-3p3: 5’-gtcacatggaaccagtctttcagc-3’ M45-3p4: 5’-atggagtacctttcagccttcaac-3’ M45-3p5: 5’-cggcttaactccgagctcacagtg-3’ M45-3p6: 5’-ccactgccatcgatcagccccctc-3’ M45-3p7: 5’-cactcttggggctccagctctggc-3’ M45-3p8: 5’-ggagtacctttcagccttcaaccc-3’ M45-3p9: 5’-gcagttcttggaggctggcagctg-3’ M45-3 p10: 5’-cggagttaagccgtagggtctgg-3’ M45-3p11: 5’-ggcttccttgttctaggaacccag-3’ xvii [...]... (WAT) The Cidea- /- mice are resistant to diet-induced obesity and diabetes Further, it was found that the role of Cidea in regulating thermogenesis, lipolysis and obesity is mediated at least in part through its direct suppression of UCP1 activity The data demonstrate a role for Cidea in regulating energy balance and adiposity and suggest Cidea as a novel target for the development of anti -obesity therapy... of Cidea expression in BAT 73 Figure 17 In situ hybridization analysis of Cidea expression 74 Figure 18 Increased levels of Cidea expression in adult and aged mice 77 xi List of figures Figure 19 Differentiation markers RNA levels in BAT and WAT 79 Figure 20 BAT protein expression levels 80 Figure 21 Light micrograph of liver sections of 9-month-old Cidea+ /+ and Cidea- /mice. .. Images of H&E stained BAT 90 Figure 29B Images of H&E stained BAT 91 Figure 30 Increased lipolysis in BAT of Cidea null mice 93 Figure 31 Reduced adiposity and a lean phenotype in Cidea null mice 95 Figure 32 Less lipid content in the WAT of Cidea null mice 96 Figure 33 Glucose tolerance and insulin tolerance test 99 Figure 34 Cidea co localizes with UCP1 and interacts... ATP generation and dissipates the energy as heat It was observed that the core body temperature for Cidea- /- mice was consistently higher than that of wild-type mice of the same genetic background when subjected to cold treatment The BAT of Cidea- /- mice also exhibited increased lipolysis with increasing age or cold exposure Most strikingly, Cidea- /- mice are much leaner than wild type mice, with a 64%... targeting vector and screening strategy 61 Figure 11 Targeted disruption of the Cideb Gene 63 Figure 12A Genomic DNA sequence of the 5’ region of Cideb gene 64 Figure 12B Genomic DNA sequence of the 3’ region of Cideb gene 65 Figure 13 Inactivation of Cideb in mouse 67 Figure 14 Targeted disruption of the Cidea Gene 68 Figure 15 Deletion of Cidea in mice 69... condensation and DNA fragmentation, but also membrane blebbing and cellular fragmentation, which implies that the mechanism of CIDE function is different from that of DFF45 The project aims at investigating the in vivo physiological roles of CIDEs It was shown that both Cidea and Cideb were localized in the mitochondria Northern blot analysis revealed that Cideb was expressed at high levels in liver and spleen,... of metabolism other than apoptosis In order to resolve the physiological functions of ix Summary CIDEs, targeted gene-disruption animal models for Cidea and Cideb were generated The phenotypes of the Cidea knock-out mice were analyzed in detail Cidea is expressed at high levels in the BAT BAT plays an important role in adaptive thermogenesis and energy expenditure Its thermogenic activity is mediated... development of anti -obesity therapy x List of figures List of Figures Figure Page Figure 1 Apoptotic pathways and caspase activation 3 Figure 2 Solution structure of CIDE-N domain [19] 5 Figure 3 Mechanisms of activation of DFF 6 Figure 4A Schematic structure of mouse Cidea, Cideb, FSP27 and DFF45 8 Figure 4B Sequence alignments of CIDEs family members 9 Figure 5 Leptin’s... content of BAT 82 Figure 23 TUNEL staining of BAT paraffin sections 82 Figure 24 Core body temperature before and after placement at 4 ºC from 22 ºC 84 Figure 25 Indirect calorimetry methods for measuring mice energy expenditure 85 Figure 26 Cidea null mice had increased metabolic rate 85 Figure 27 Images of transmission electron microscopy of BAT 87 Figure 28 Quantification of. .. homology to DFF45 They include Cidea, Cideb, and FSP27, which is a 27-kDa fat cell specific-protein with unknown function The CIDE proteins are highly homologous A CIDE-N domain at their amino terminus has significant homology to the regulatory domains of DFF40 and DFF45 The carboxyl terminal domain of CIDE proteins is an effector domain designated as CIDE-C Over expression of Cidea or Cideb alone induced . PHYSIOLOGICAL ROLES OF CIDES: CIDEA DEFICIENT MICE EXHIBIT LEAN PHENOTYPE AND ARE OBESITY RESISTANT ZHOU ZHIHONG INSTITUTE OF MOLECULAR AND CELL BIOLOGY. AND CELL BIOLOGY NATIONAL UNIVERSITY OF SINGAPORE 2004 PHYSIOLOGICAL ROLES OF CIDES: CIDEA DEFICIENT MICE EXHIBIT LEAN PHENOTYPE AND ARE OBESITY RESISTANT ZHOU ZHIHONG (M.Sc BAT of Cidea null mice. 93 Figure 31 Reduced adiposity and a lean phenotype in Cidea null mice 95 Figure 32 Less lipid content in the WAT of Cidea null mice 96 Figure 33 Glucose tolerance and