Physiological roles of CIDEs CIDEA deficient mice exhibit lean phenotype and are obesity resistant 3

Chapter Chapter Materials and Methods 31 Chapter 2.1 Chemicals and reagents 2.1.1 General list of cell culture medium and reagents DMEM (no pyruvate, high glucose formulation, GIBCO/BRL#11965-084), L-glutamine (200mM, GIBCO/BRL#25030-081) Non-essential Amino acids (NEAA, 10mM each, GIBCO/BRL#11140-050) Penicilin/Streptomycin (pen/strep, 10,000 U each, GIBCO/BRL#15140-122) Trypsin/EDTA (0.05%/1mM, GIBCO/BRL#25300-047) PBS (calcium and magnesium free, GIBCO/BRL#14190-136) ESGRO (Leukemia Inhibitory Factor (LIF) GIBCO/BRL#13275-029) HEPES buffer solution (pH 7.05, 1M, GIBCO/BRL#15630-080) β-Mercaptoethanol (Sigma# M-7522) Dimethyl Sulfoxide (DMSO, Sigma #D-5879) Geniticin sulfate (G418, Sigma#9516) Mitomycin C (Sigma #M-0503) Fetal Calf Serum (FCS, Hyclone#A-1115-L) (FCS is heat inactivated at 56°C for 30 minutes before use). 2.1.2 Mouse embryonic fibroblast (MEF) culture medium DMEM 435 ml supplemented with FCS 50 ml, L-glutamine ml, NEAA 5ml, Pen/Strep ml, DMSO µl and HEPES pH 7.05, ml. 2.1.3 Embryonic stem (ES) cells culture medium DMEM supplemented with 12% FCS, 2mM l-glutamine and 100-units/ml Pen/Strep, 1X NEAA, 100 units/ml LIF and 0.1mM β-Mercaptoethanol 32 Chapter 2.1.4 Genomic DNA extraction buffer 100 mM Tris-HCl pH 8.5, mM EDTA pH 8.5, 0.2% SDS 200mM NaCl, stored at room temperature (RT). For ES cell lysis, 100 µg/ml proteinase K was added before use. For mouse-tail lysis, SDS concentration is increased to 0.5% and 500 µg/ml proteinase K was added before use. 2.1.5 Blood chemistry reagent Glucose strips (ROCHE) NEFA (NEFA C, Wako Pure Chemical Industries, Ltd., #279-75401) Glycerol (Boehringer Mannheim, #0148270) Insulin (Ultra sensitive Rat Insulin ELISA Kit, Crystal CHEM INC., #90060) Leptin (Mouse Leptin Elisa Kit, Crystal CHEM INC., # 90030) Lipase activity (Total Lipase Test, Progen Biotechnik GMBH, #PR2003) 2.1.6 Antibodies List Rabbit anti mouse Uncoupling protein 1(RDI-MUCP19abrx, RDI) Rabbit anti mouse CIDE-A (AB16922, Rbt X CIDE-A, CHEMICON) Goat anti CDC28 polyclonal IgG (#G131, Santa Cruz, Saint Louis, MO, USA) Monoclonal anti cytochrome c (#56432, BD Biosciences, Pharmingen) Monoclonal anti β-Actin (#A544, Sigma, USA) Rabbit anti HA polyclonal IgG (#K2002, Santa Cruz, Saint Louis, MO, USA) Flag (M2) Sigma (#F7425, Sigma, USA). 2.1.7 Embryonic Stem Cells and Mice Strains RW4 mouse embryonic stem cells (Genome Systems Inc., USA) 129AJ mice (blastocyst donor) 33 Chapter C57BL/6J mice (chimeric mice surrogate mother) 2.2 Molecular Biology Techniques and Methods 2.2.1 Expression constructs Expression constructs for murine Cidea and the UCP1 were prepared by inserting the respective coding sequences into pXJ40-FLAG, a FLAG-tagged expressions vector (from Dr. Z. Zhao, Glaxo-IMCB, Singapore) or pXJ40-GST, a vector for expression of Glutathione S-transferase (GST) fusion protein (from Dr. E. Manser, Glaxo-IMCB, Singapore) was used (Manser et al., 1998) for proteins expression in mammalian cells. A series of N- or C-terminal deletion mutants of Cidea were generated by PCR using primers containing a BamHI site at the 5’ end and a XhoI site at the 3’ end. The respective PCR products were cloned either into pXJ40-FLAG or pXJ40-GST. The internal deletion mutants of UCP1, ∆9 and ∆3, were obtained by site directed mutagenesis as described in section 2.2.16 2.2.2 Preparation of E.coli competent cells The DH5α E. coli strain was streaked onto an Luria-Bertani (LB) (pH 7.5) agar plate (containing 1% bacto-tryptone, 0.5% bacto-yeast extract, 1% NaCl, and 1.5% agar) without antibiotics and incubated at 37°C overnight. A single colony was inoculated into ml of LB broth and grown at 37°C overnight with shaking. The overnight culture was inoculated into 400 ml of LB (OD600 < 0.1) and grown for approximately 3-4 h at 37°C to OD600 of 0.3-0.6. The cells were harvested by centrifugation at 4000 rpm (SV TA 20 Rotor) for at 4°C. The pellet was resuspended on ice in one-twentieth volume of TSS buffer (LB broth (pH 6.1), 10% polyethylene glycol (PEG, molecular 34 Chapter weight 3350 or 8000), 5% dimethyl sulfoxide (DMSO), 10 mM MgCl2, 10 mM MgSO4, pH 6.5-6.8), followed by a further incubation on ice for 10 min. Competent cells are stored at -80°C in 50 µl aliquots. 2.2.3 DNA transformation The ligated DNA (5 µl) or pure plasmid DNA (10-100 ng) was mixed with 50100 µl KCM solution (100 mM KCl, 30 mM CaCl2, and 50 mM MgCl2) and 50-100 µl of competent cells, which were pre-thawed on ice. After the mixture was incubated on ice for 30-60 min, the cells were pelleted by centrifugation at 14,000 rpm for at room temperature. Half of the supernatant was discarded and the cells were resuspended in the remaining supernatant. For ampicillin-resistant plasmids, the resuspended cells were directly spread onto the LB agar plates containing 50 µg/ml ampicillin. For plasmids with other drug resistance genes, ml of LB and 20 mM glucose were added to the resuspended cells. This is followed by shaking at 37°C for h, before the cells were spread on the LB plates containing the appropriate antibiotic. 2.2.4 DNA preparation Small-scale plasmid DNA isolation from E. coli cultures was carried out using the STET boiling method (Sambrook J, 1989). The plasmid DNA was eluted in an appropriate amount of TE buffer or nuclease-free water. Large-scale plasmid DNA isolation was carried out using the QIAGEN Plasmid Maxi Kit (QIAGEN, Germany) according to the manufacturer’s instructions. Large volume of bacteria culture was pelleted, resuspended, lysed and neutralized using the buffers supplied in the kit. After clarification of the bacteria lysate by a 12,000g 35 Chapter centrifugation, the supernatant was subjected to the pre-equilibrated QIAGEN-tip 500 column, followed by washing with Buffer QC (1 M NaCl, 50 mM MOPS pH 7.0 and 15% isopropanol). The plasmid DNA was eluted by Buffer QF (1.25 M NaCl, 50 mM TrisCl pH 7.0 and 15% isopropanol) and precipitated by 0.7 volumes of isopropanol. The DNA pellet was washed with 70% ethanol, air-dried, and redissolved in a suitable volume of TE buffer or nuclease-free water. 2.2.5 Restriction Enzyme digestion of DNA Restriction endonuclease digestion of DNA was carried out as recommended by the manufacturers. Typically, 2µg of DNA in the appropriate reaction buffer was digested with 10 Units of a restriction enzyme for 1-3 hr at 37°C (or as recommended) (Boehringer Mannheim or New England Biolabs) in a total volume of 20 µl reaction mixture. To reduce the number of false positive colonies in the transformation, calf intestinal alkaline phosphatase (CIAP/ CIP) was used to remove the phosphate group from the 5’ end of linearized vector DNA to prevent singly digested vectors from self-ligation. The reaction was carried out either with the recommended buffer for CIP or directly in the restriction enzyme reaction by adding µl CIP (1 Unit) followed by incubation at 37°C for 30 min. 2.2.6 Purification of DNA fragment Recovery of DNA fragments from agarose gel was carried out according to the instructions of the Qiaquick Gel Extraction Kit (QIAGEN). The DNA bands of interest were located using a long-wavelength (312 nm) UV-transilluminator, and excised from the agarose gel using a sharp scalpel. After mixing with volumes of dissolving buffer, 36 Chapter the gel slice was melted completely by incubation in a 55°C waterbath. The mixture was then applied to the Qiaquick column, followed by a washing step with the washing buffer. The DNA was then eluted with deionized water or TE buffer. 2.2.7 DNA ligation For DNA ligation, the purified vector and DNA fragment were mixed at a molar ratio of 1:3 in 1X ligation buffer in a total volume of 20 µl. The reaction was carried out with the addition of Unit of T4 DNA ligase (Boehringer Mannheim) in a 16°C waterbath overnight. A µl aliquot of the resultant mixture was used for bacterial transformation. 2.2.8 Polymerase chain reaction (PCR) PCR was performed using the ExpandTM Long Template PCR System (Boehringer Mannheim) and the primers of the required sequences were synthesized by Genset Inc., Singapore. Typically, 20-50 ng of cDNA template in the PCR buffer is supplemented with 1.75 mM MgCl2, and mixed with 250 µM each of deoxy-adenine, deoxy-cytosine, deoxy-guanine and deoxy-thymidine nucleotides (New England Biolabs), 50 pM of the sense and anti-sense primers, and 2.5 Units of the ExpandTM DNA polymerase. The PCR reaction was carried out using 30 cycles of denaturation at 94°C for and primer annealing at 50°C for 30 sec, followed by DNA extension at 68°C for min. A final cycle of DNA extension was carried out at 68°C for min. 2.2.9 RNA extraction Total RNA was isolated from different adult mouse tissues using the Qiagen RNA kit (Qiagen, Germany) according to the manufacturer’s guide. The tissues were 37 Chapter homogenized in lysis buffer and subsequentially centrifuged to get rid of the debris. The supernatant was applied onto the Qiagen column and washed; RNA was eluted by Rnase free water. 2.2.10 Northern & Southern Blotting Northern and Southern blots were performed with Hybond –N nylon membranes according to the manufacture’s instruction. RNA or DNA samples were resolved by agarose gel electrophoresis. After that the DNA or RNA were transferred from agarose gel slops onto Hybond –N nylon membranes by capillary transfer overnight. The membranes were baked at 80°C for 20 minutes and UV-cross linked and probed using specifically labelled probes. 2.2.11 Dot blotting 20 µl of purified phage or plasmid DNA was denatured in 0.3 M NaOH at 4550°C for 30 minutes to hour and neutralized by an equal volume of 2M NH4OAC (pH 7.0). 5µl of the denatured DNA was spotted onto Hybond-N nylon membrane, which was subsequently baked at 80°C for 20 minutes and UV-cross linked and hybridized with γ32P-ATP end labeled oligonucleotide probes. 2.2.12 Reverse Transcriptase –polymerase chain reaction (RT-PCR) Total RNA (2 µg) was used for first-strand cDNA synthesis. Gene specific primers for Cidea, GAPDH (loading control) and other adipose tissue markers (listed in the oligonucleotides list) were used with Superscript II (Gibco BRL) reverse transcriptase. The PCR reaction conditions for Cidea is as follows: 94 °C for min; 40 cycles of 94 °C for 20 s, 65°C for 30 s, 72 °C for 30 s; 72 °C for min, using the 38 Chapter primers 5´–ATGGAGACCGCCAGGGACTAC–3´, CATGAACCAGCCTTTGGTGCTAGG–3´. and 5´– The PCR reaction conditions for GAPDH is as follows: 95 °C for min, 49 cycles of 94 °C for 20 s, 55 °C for 20 s, 72 °C for 30 s; 72 °C for min, using the primers 5´–ATGGTGAAGGTCGGTGTGAA– 3´, and 5´–ACCAGTAGACTCCAACGACAT–3´. 2.2.13 Mouse-tail Genomic DNA extraction Mice genomic DNA is isolated from mice tails. The tails were lysed in genomic lysis buffer as mentioned in section 2.1 overnight and purified by phenol extraction. The DNA was dissolved in 10 mM Tris buffer (pH 8.0) at 37°C overnight. 2.2.14 In situ cell death assay This was performed using the TUNEL assay kit (#1684795, ROCHE) according to the product guide with paraffin sections. Sections were dewaxed by heating to 60°C followed by washing in xylene and rehydrated through a graded series of ethanol and water. Tissue sections were then incubated with proteinase K (20µg/ml in 10 mM Tris/HCL, pH7.4-8.0) for 15-30 at 37°C, and rinsed twice with PBS. 50 µl TUNEL reaction mixture was then added to the sample, and the slides incubated in a dark humidified chamber for 60 at 37°C. The slides were then rinsed 3X with PBS, mounted with Vectashield and viewed under a Zeiss Axioplan fluorescence microscope. 2.2.15 In situ hybridization To generate a Cidea specific RNA probe, a 600-bp fragment of mouse Cidea cDNA was subcloned into pBluescript II KS plasmid (Stratagene). This plasmid was 39 Chapter either linearized with KpnI and transcribed with T7 RNA polymerase to generate an antisense probe, or linearized with Not I and transcribed with SP6 RNA polymerase to generate a sense probe. Probes were labeled with α-S35-UTP (Boehringer Mannheim, Indianapolis, IN). Hybridization was conducted with sagittal sections of wild type mice embryos according to the manufacturer’s recommended protocol (RNA labeling kit RPN 3100, Amersham Pharmacia Biotech UK limited). The slides were then dipped in photographic emulsions (LM-1, RPN40, Amersham UK) and exposed at oC for days. The slides were developed using a developer (D-19, Kodak) and fixed in a fixing solution (Unifix, Kodak). 2.2.16 Site-directed mutagenesis Point mutations were introduced into the plasmid cDNAs by PCR using the pfu DNA polymerase (Promega, MADISON, WISCONSIN, USA). Complementary primers with point mutations were designed and used for PCR reactions to generate mutant from the wild-type plasmid template. The temperature-cycling conditions are 16 cycles of denaturation at 95°C for 30 sec, primer annealing at 50°C for min, and extension at 68°C for 14 (based on min/kb of plasmid length). The methylated wild-type template was removed from the newly synthesised, non-methylated plasmids by DpnI restriction digest at 37°C for 1h. The mutant plasmids were transformed in E. coli for clonal isolation and mutations were confirmed by standard dideoxy DNA sequencing. 2.2.17 SDS-polyacrylamide gel electrophoresis The Bio-Rad Mini-PROTEAN II system was used for routine discontinuous SDS-polyacrylamide gel electophoresis (SDS-PAGE). Separating gels are composed of 40 Chapter 8.4), 192 mM glycine, and 20% methanol for h at 4°C. The membrane was then incubated in blocking buffer (PBS containing 1% (w/v) BSA and 0.1% (v/v) polyoxyethylene-sorbitan monolaurate (Tween-20, Sigma)) for at least h. The membrane was then incubated with the relevant antibodies diluted in blocking buffer to optimized working concentrations for h at room temperature. Unbound antibodies were removed by extensive washing in PBS containing 0.2% Tween-20. After incubation with the secondary antibody and washing with PBS containing 0.2% Tween 20, the bound antibodies were detected using an enhanced chemiluminescence (ECL) kit (Pierce Chemical Co.). For reprobing of the same membrane with a different antibody, the blot was stripped with stripping buffer (62.5 mM Tris (pH 6.8), 100 mM β-mercaptoethanol, and 2% SDS) for 30 at 60°C to remove the previous antibody. The membrane was then re-blocked with BSA and incubated with another antibody. 2.2.20 End labeling of oligonucleotide Oligonucleotides were diluted to pmol/µl with ddH2O, and 13.3 µl ddH2O was added to 25 µl of pmol/µL oligonucleotides in 1.5 ml microfuge tube. The solution was heated to for minute and placed on ice. 5.0 µl of 5X forward buffer was then added to solution followed by 4.0 µl γ32pATP (40µCi) (following all radioactive work safety procedures). The reaction was initiated by the addition of 0.2 µl of T4 kinase to the mixture, allowed to proceed at room temperature for 30 minutes and terminated by heating at 95oC for minutes. Labelled probes were stored at -20oC in properly labelled Perspex container. 42 Chapter 2.2.21 Random prime labeling of double stranded DNA fragments DNA fragments was labelled by α32pdCTP using the High Prime DNA Labeling Kit (#1585584, ROCHE) according to the manufacturer’s protocol. Briefly 25 ng of DNA in 8µl of RO water was firstly denatured by heating the solution in a boiling water bath for 10 minutes and chilling quickly on ice. 4µl high prime reaction mixture and 3µl dATP, dGTP, dTTP were then added, followed by 5µl (50µCi) α32pdCTP, 3000 Ci/mmol. The reaction is incubated for 10 minutes at 37°C and stopped by the addition of µl 0.2M EDTA (pH 8.0). The probe was purified using G-50 sephadex columns (#1273973, Roche) and used immediately. 2.2.22 TCA precipitation for yeast protein extraction An over night culture was grown at 30°C. An equivalent of OD600 = of cells were pelleted by centrifugation and washed once with ice-cold water. The cells were resuspended in 200 µl ice-cold water and 200 µl YEX lysis buffer (1.85M NaOH, 7.5 % β-mercaptoethanol, stored in dark at 4°C) was added. The mixture is left on ice for 10 minutes. 400µl of 50%TCA (trichloroacetic acid, W/V in water, stored at 4°C) was then added and the mixture centrifuged at full speed using a tabletop microcentrifuge at 4°C for minutes. Pellets were washed with PBS once and resuspended in 100 µl 1X gel loading buffer. 10 µl 1M Tris solution (pH 8.0) was then added and 10-20µl is usually used for SDS-PAGE analysis. 43 Chapter 2.2.23 Transfection of mammalian cells Procedures for transfection, immunoprecipitation, western blot analysis and Cidea mitochondria localization analysis were carried out as described previously by Chen et al (Chen et al., 2000). Typically, µg of total DNA and 24 µg of DOSPER (Roche Diagnostic, Switzerland) were used for transfection in 60 mm plates. For immuno-precipitation, 10 µl of Anti-Flag M2-Agarose Affinity Gel (Sigma, USA) was used. For western blot analyses, Rabbit anti-flag (Affinity Bioreagents, USA), anti-HA (Santa Cruz, USA), anti-Cidea (Chemicon, USA), anti-UCP1 (Research Diagnostic, USA), anti-mouse or yeast COX IV (Molecular Probe, USA), anti-cytochrome c (Pharmagen, USA), anti-β-actin (Sigma, USA), anti HSL (a kind gift from Dr. F.Kraemer, Stanford University) and goat anti-rabbit secondary antibody (Bio-Rad, USA) were used. For mitochondria localization, µg of GFP-Cidea DNA was transfected into COS-1 cells grown on a 22x22mm cover slip using DOSPER. Twentyfour hours post-transfection, cells were incubated with 100 nM Mitotracker-Red (Molecular Probes, USA) for 30 at 37°C. Treated cells were fixed with 4% paraformaldehyde in PBS for 20 and permeabilized using 0.2% Triton X-100 for 10 min. Cells were visualized using a Zeiss Axiophot fluorescent microscope equipped with the Bio-Rad MRC1024 confocal system. 2.2.24 Heavy membrane preparation from brown adipose tissue The protocol for heavy membrane isolation is performed with minor modification to that previously discribed (Sambrook J, 1989). BAT was removed from interscapular region placed in a beaker on ice. Any white adipose tissue is trimmed away before the tissue is weighed and returned to the beaker. The tissue is minced into 1-2mm 44 Chapter slices using very sharp scissors, rinsed twice with homogenization buffer (1x MS: 210 mM mannitol, 70 mM sucrose, mM Tris/HCl (pH 7.5), 1mM EDTA (pH 7.5), 0.5% BSA, with 1mM PMSF, 5µg/ml aprotinin, 1µg/ml leupeptin and 1µg/ml pepstatin), and transferred to the homogenization tube. Enough homogenization buffers to prepare a 1:10 (w/v) homogenate were added. The extent of homogenization is monitored under the microscope and homogenization is done until most of the cells are broken. The homogenate is transferred to a centrifuge tube and centrifuged at 1300 g for 10 minutes to pellet unbroken cells, nuclei, plasma membranes, and fibers of the connective tissue. The supernatant was centrifuged at 17,000 g for 15 minutes to pellet the mitochondria. The supernatant is discarded and the inside of the tube is wiped with a lint free tissue paper to remove fat and other debris clinging to the inside of the tube. The mitochondria pellet was washed twice by resuspending in buffer and repelleting at 17,000 g for 15 minutes and the final pellet is resuspended in 1x SDS loading buffer. 2.3 Gene targeting procedure 2.3.1 General procedures for targeted gene disruption in mice Genomic clones for Cidea and Cideb were isolated from a P1 c129/SVJ genomic library (Genome Systems Inc., St. Louis, MO). A replacement targeting construct was prepared in which the Cidea genomic sequence between an EcoRI and PstI site, which includes half of the second exon was removed and replaced with a PGK-NEO-Poly (A) expression cassette (Adra et al., 1987). The targeting plasmid was linearized and electroporated into RW4 embryonic stem cells. Targeted ES cell clones were identified by Southern blot analysis of ES cell genomic DNA. Cells expanded from targeted ES clones were injected into C57BL/6J blastocysts. Germline transmittable chimeric animals were obtained. To generate inbred 129 mice, the germline transmitting chimeric 45 Chapter animals were mated with wild type 129 mice. The resulting heterozygotes were crossed to generate wild type (+/+), heterozygotes (+/-), and homozygotes (-/-). To generate inbred C57BL/6J mice the germline transmittable chimeric animals were mated with wild type C57BL/6J mice. The resulting heterozygotes were crossed with wild type C57BL/6J mice. This back cross was performed for at least generations before heterozygotes was used to generate working wild type (+/+), heterozygotes (+/-), and homozygotes (-/-). Unless otherwise indicated, animals were housed in a temperaturecontrolled room (24 oC) with a 12 hr light/dark cycle and ad libitum access to chow and water. 2.3.2 Mouse genomic DNA library screening 2.3.2.1 Preparation of Cidea and Cideb cDNA probe The mouse full-length cDNA for mouse Cidea and Cideb were released by restricted enzymatic digestion from their respective constructs and radioactively labeled by α32 pCTP using the High prime DNA labeling Kit (#1584584, ROCHE). 2.3.2.2 Preparation of bacterial host A single colony of XL1-blue E coli. was inoculated into 50 ml LB broth containing 0.2% maltose and 10 mM MgSO4. After overnight culture at 30°C, the cells were centrifuged at 2,000 rpm using a SV RT6000 refrigerated centrifuge for 10 minutes. The supernatant was discarded and the cell pellet was gently resuspended in 25ml of 10 mM MgSO4 and diluted to an OD600 of 0.5 with 10 mM MgSO4. 46 Chapter 2.3.2.3 Titration of λ phage library Stock phage containing the 129/Sv mouse genomic library was serially diluted in SM buffer (0.1M NaCl, 15 mM MgSO4, 0.05M TrisHCl (pH 7.5), 0.01% gelatin), and 100 µl of diluted phage was mixed with 200 µl of OD600 = 0.5 host cells and incubated at room temperature for 20 minutes followed by 15 minutes at 37°C. Four ml of top agar kept at 48°C was added and the mixture plated onto 100 mm NZY plates. The top agar were allowed to hardened at room temperature and the plates incubated at 37°C overnight. The number of plaque forming units (pfu)/ml concentration was determined by counting the number of plaques on the plates. 2.3.2.4 Primary screening of genomic DNA library To cover the entire mouse genome, 14 µl of the tittered phage, corresponding to about 1x106 plaques was incubated with 20 ml of OD600 = 0.5 host cells for 20 minutes at 37°C. One hundred and twenty ml of 48°C top agar was mixed with the pre-infected host cells and the mixture was plated onto four 230mm x 230mm NZY plates, which were then incubated overnight at 37°C. The plates were chilled for hours at 4°C. Hybond-N nylon filters (Amersham) were carefully placed in the plates (avoiding air bubbles) and the orientation of the filters was marked. Filters were lifted after incubation at room temperature for two minutes. Each plate was subjected to up to five lifts. Filters were dried at room temperature for 30 minutes on Whatmann paper, and placed sequentially on top of Whatmann papers saturated with 0.5M NaOH /1.5M NaCl for minutes, 0.5M Tris/HCl (pH 8.0) /1.5M NaCl for five minutes and x SSC for thirty seconds. The filters were then blotted dry 47 Chapter on Whatmann 3MM papers and the DNA crosslinked to the filters using a UV cross linker (Stratagene). Blots were prewashed by soaking in 0.1 x SSC, 0.1% SDS at 65°C for one hour and then blot dried on Whatmann paper. The prewashed filters were prehybridized at 37°C in prehybridization buffer (6 x SSC, x Denhardt’s solution, 0.05% sodium pyrophosphate, 100 µg/ml salmon sperm DNA and 0.1% SDS). Subsequently, the blots were hybridized at 42°C with 106 cpm/ml of labeled probes in hybridization buffer (6 x SSC, x Denhardt’s solution, 0.05% sodium pyrophosphate, 100 µg/ml salmon sperm DNA, 50% formamide) over night. The filters were washed in 6x SSC/0.05% sodium pyrophosphate at room temperature for x minutes. The temperature was then gradually increased to up to 60°C to achieve different stringencies in subsequent washings. The washed membranes were exposed to X-ray films over night at -80°C. The radioactive probes on the filter could be stipped off by shaking in 0.1% SDS at 70°C for hr for reprobing purposes. 2.3.2.5 Secondary and tertiary screening of genomic DNA library The films were developed and aligned with the original plates, and the agar under each individual spot was cut out and placed in 1ml of SM buffer. One hundred µl of chloroform were added, and the tubes were rolled at room temperature for several hours to lyse the phages. The suspensions were centrifuged and the appropriately diluted phage containing supernatants were used for secondary and tertiary screenings, until a single positive plaque can be identified and isolated. 48 Chapter 2.3.3 Phage DNA preparation The single positive phage plaque was picked up and dissolved in 0.3 ml of SM buffer. After incubation at room temperature for hours, it was used to infect 0.3 ml host cells and was then plated onto NZYM plate to grow over night. Two ml of SM buffer was added onto the plate to wash off phages for hours at room temperature. The phage suspension was collected, mixed with 30 µl of chloroform and kept at °C. 50 µl of the phage suspension were used to infect ml of host cells, which was subsequently incubated in 250 ml of x NZYM at 37°C for hours, before the addition of 1ml of chloroform and shaked for another 15 minutes to complete the phage lysis. The phage supernatant was collected and the phage DNA extracted using QIAGEN columns according to the manufacturer’s instructions. 2.3.4 Mapping of Cidea and Cideb locus and construction of the targeting vector After the screening, one Cidea genomic clone and seven Cideb genomic clones were confirmed to contain the respective coding sequence by dot blotting and Southern blotting using different end-labelled specific oligonucleotide probes. One Cidea clone and one Cideb clone with the longest 5’ end of the respective genomic sequence were chosen for further restriction enzyme mapping analysis. The insert DNA were released by NotI digestion and cloned into pBluescript-KS vector. Intensive mapping of the genomic DNA insert was performed by restriction enzyme digestion combined with Southern blot analysis using various oligonucleotide probes and DNA sequencing of subcloned fragments. Based on the mapping result, a targeting vector for Cidea was constructed to replace half of the second exon with a neor gene cassette. The targeting vector for Cideb was constructed as such to replace the three exons located at 3’ end, 49 Chapter which correspond to the CIDE-C domain of Cideb, with a neor gene cassette. A detail description of the targeting vectors and their construction is presented in Chapter 3. 2.3.5 Transfection of targeting vectors into embryonic stem (ES) cells 2.3.5.1 ES cells culture RW4 ES cells were grown on top of feeder cells - mitomycin C inactivated mouse embryonic fibroblasts (MEF). ES cells are further passaged when they begin to form three-dimensional, phase-refractive colonies at 70-80% confluency. Colony growth is assessed, as this is a measure of when construct transfection by electroporation would be performed. A “healthy” culture will be growing rapidly (doubling time of approximately 10 h) with ES cell colonies beginning to become three-dimensional, having discrete colony boundaries, lacking distinct cell borders, and cover 70-80% of the surface area. 2.3.5.2 ES cells transfection A few hours before electroporation the ES cells were fed with fresh ES medium. About 107 ES cells were resuspended in electroporation buffer (20 mM HEPES (pH 7.05), 137 mM NaCl, mM KCl, mM D-glucose, 0.7 mM Na2HPO4) containing 30 µg of the linearized targeting construct. The cell-DNA mixtures were electroporated at 240 volts and 500 µF capacitance using cuvettes with mm electrode distance and cm width (BIO-RAD). After the electroporation, the ES cells were incubated at room temperature for minutes and subsequently plated onto three dishes of mitomycin C (Sigma # M 0305) treated MEF cells dishes. 50 Chapter 2.3.6 ES cells cloning After about one week of selection in 300 µg/ml G418 (Geneticin, GIBCO # 10131-027), and µM gancyclovir (GANC sodium salt, Cymeven Syntex. # 115661), visible ES cells colonies were picked using a pipetteman. Each colony was dispensed in 50 µl 0.05% trypsin for minutes in round bottom 96 well plates. After adding 50 µl of ES medium, the trypsinized ES cells were transferred into corresponding wells on two 48-well plates, one as the master plate for freezing and the other for DNA extraction analysis. Once the clones on the master plate had grown sufficiently, they were trypsinized with 100 µl of trypsin and were frozen down directly in the 48-well plate by adding 400 µl of ES freezing medium (12.5% DMSO in FCS). 2.3.7 Screening of homologus recombinant clones by PCR and Southern analysis Clones on the duplicate plate were lysed using the lysis buffer for preparation of genomic DNA as described in section 2.2.13. The homologous recombinants were screened by PCR and positive clones were further confirmed by Southern blot analysis. 2.3.8 Generation of Cidea and Cideb null mice The targeted ES cells clones with Cidea or Cideb gene disruption were recovered from the frozen master plates and injected into C57BL/6J blastocysts to generate chimeric mice for germline transmission of the mutant allele. Homozygous mice were obtained by crossing heterozygous mice. The successful targeted disruption of Cidea or Cideb was confirmed by Southern and Northern analysis as detailed in Chapter 3. 51 Chapter 2.4 Histological analysis of mice tissue 2.4.1 Paraffin section & cryosection Mice were sacrificed by cervical dislocation. Tissues to be fixed and processed were cut to less than mm thick, and fixed in 10% formalin at 4°C over night. Fixed tissues were processed and embedded in paraffin using a Histokinette 2000 tissue processor (Reichert Jung, Germany). The paraffin embedded tissue blocks were sectioned at µm thickness on a microtome, transferred onto glass slides, and dried at room temperature over night. 2.4.2 Haematoxylin & Eosin (H&E) staining Slides were placed on top of a 55°C heating plate for 10 to melt the paraffin. The slides were subsequently deparaffinized in changes of xylene for minutes each, and rehydrated by stepwise incubation with 100% alcohol (2 changes for minutes each) and sequentially with 95% alcohol, 80% alcohol, 70% alcohol, distilled water for minutes each. After the rehydration the slides were immersed in Haematoxylin solution (Poly Scientific (Bayshore, NY) #s212A) for minutes. The slides were then washed in running water until excess haematoxylin was completely removed. Slides were then dipped in acid ethanol (1% acetic acid / 70% ethanol), and washed with running water for minutes. The slides were then stained in Eosin solution (Poly Scientific (Bayshore, NY) #s176) for minutes. The slides were subsequently dehydrated sequentially with 70% ethanol, 80% ethanol, 95% ethanol for minutes each and 100% ethanol (two changes) for 10 minutes each. Finally the slides were dehydrated by changes of xylene for minutes each and mounted in Entellan (ProSciTech, Australia). 52 Chapter 2.4.3 Electron microscopy (EM) Mouse brown adipose tissue lobes were fixed by immersion in 1% glutaraldehyde/PBS directly after disection and kept at oC overnight. Samples were post fixed in osmium tetraoxide and processed for conventional electron microscopy, by embedding in Spurr’s low viscosity resin. Semi-thin (0.5µm) sections, made using a Leica Ultracut Mictrome, were counterstained with 0.1% Toluidin-blue in distilled water containing 0.1% Borax. Sections were viewed on a Zeiss Axiovert light microscope equipped with a Sensicam digital camera (Image Pro Software) before examination using Philips transmission EM. For statistical analysis, 10 pictures were randomly taken from every tissue slide at 630X magnification. Ratio of lipid volume density was calculated as previously described (Griffiths et al., 2001; Lucocq, 1993) 2.5 Blood chemistry Blood was collected from the orbital plexus after animals were anaesthetized with soflurane (Vedco) or from tail bleeds. Serum was frozen in aliquots and stored at –20 oC. Enzymatic assay kits were used for the determination of serum nonesterified free fatty acids (NEFAC, Wako) and glycerol (Roche diagnostic). Serum insulin and leptin levels were measured using ELISA kits (Research diagnostic Inc.). Levels of blood glucose were measured by glucose strips from whole tail blood with a hand-held glucose test monitor (Accutrend-GCT, Roche Diagnostic, Switzerland) and disposable test strips. Serum triglyceride levels were determined by the medical chemistry laboratory of National University Hospital of Singapore. 53 Chapter 2.6 Hormone-Sensitive Lipase (HSL) assays Experiments were performed as previously described (Martinez-Botas et al., 2000). Briefly mice were fasted for h and injected intraperitoneally with saline or isoproterenol (10 mg per kg body weight). Blood was collected from the orbital plexus before (0 min) and 15 after injection and serum NEFAC and glycerol levels were determined as mentioned above. One unit of enzyme activity is defined as µmol of oleic acid released per minute at 37 °C and lipase activity was expressed as unit per mg of tissue. HSL activity was measured as described previously (Martinez-Botas et al., 2000). Briefly, BAT and WAT were dissected out from mice fasted for hours and homogenized in 3ml buffer/g tissue and centrifuged at 110,000g for 45 minutes. The fat-depleted infranatant was used for measuring HSL activity using a lipase assay kit (RDI, USA). 2.7 Mice physiology 2.7.1 Core body temperature Core body temperature of mice was measured at room temperature with a rectal temperature probe (model 402, Yellow Springs Instruments). The probe was inserted cm into the colon. Mice were then fasted for 12 hours (with free access to water) and then placed in a 4°C room. Body temperature was measured hourly after the initiation of cold exposure. 54 Chapter 2.7.2 Glucose tolerance test (GTT) and Insulin tolerance test (ITT) Glucose and insulin tolerance tests were conducted by intraperitoneal injection of glucose (1.5 g/kg) and recombinant human insulin (0.75 unit/kg, Eli Lilly, USA) to mice, respectively. Tail blood samples were taken before (0 min) and 15, 30, 60, 90,120 minutes after injection for glucose level measurements. Mice were fasted for 16 hours and hours for GTT and ITT, respectively. 2.7.3 Mice metabolism and food intake experiments and measurements Whole body oxygen consumption rate and respiration exchange rate was assessed individually in one-year-old male mice (12 each) fed a standard chow diet using a computer controlled open-circuit indirect calorimetry (Oxymax, Colombus Instruments) with an air flow of 0.6 l/min and sample flow 0.5 l/min at 23°C. After hours of adaption in the metabolic chamber, VO2 was measured at 15-min intervals for 10 hours during the night. Daily food intake was measured by weighing the food given and the food remained daily at 10:00 am for weeks old mice, for a period of one month. 2.7.4 Mice adiposity index Mice chows were obtained from Glenforest (Australia). Gonadal, mesenteric, retroparitoneal, subcutaneous and inguinal fat pads were dissected out from F2 129/C57BL wild type (+/+) and null (-/-) mice according to various anatomical landmarks. The fat pads were rinsed in saline and weighed on a Mettler AE 50 fine balance. Adiposity index was calculated as the total weight of white fat pads from these five different anatomical locations divided by the total body weight. DNA and 55 Chapter lipid contents were determined by extraction of total DNA and lipids from gonadal fat pad as previously described (Martinez-Botas et al., 2000). 2.7.5 Adipose tissue lipolysis assay In vitro lipolysis assay was performed as previously described (Haemmerle et al., 2002). Briefly, 5-6 weeks old mice were fasted for hours and then decapitated. BAT and WAT were excised from the interscapular region and the gonadal region respectively. Tissues were chopped into 400 µM blocks using a Mcllwain tissue chopper (Campden Instruments, USA) and distributed at 50 mg / 60 mm plate in ml of DMEM medium containing 2% fatty acid-free bovine serum albumin (Sigma, USA). Tissue slices were incubated in the medium in the presence or absence of 10 µM isoproterenol for one hour. The medium was then collected and stored at –80oC for further measurements of glycerol and NEFA concentration. 2.7.6 Preadipocyte isolation and differentiation Preadipocytes were isolated essentially as described previously (Klein et al., 1999). For in vitro differentiation, preadipocytes at 95% confluency were induced in DMEM medium supplemented with 1.7 µM insulin, nM T3, 0.5 mM isobutylmethylxanthine, 0.5 µM dexamethasone, 125 nM indomethacin and 1nM alltrans-retinoic acid for 4-5 days, or until the intracellular accumulation of multilocular lipid droplets were obvious. 56 Chapter 2.8 Statistics All data were presented as mean ± SEM. Differences between groups were assessed by a two tailed, non-paired or paired student’s t-test using the Graphpad Prism statistical software (Graphpad software Inc.). 2.9 Plasmid construction, expression of UCP1∆3 and Cidea in yeast and measurement of Mitochondria Potential Mouse UCP1 cDNA was PCR amplified from cDNAs of BAT, digested with BamHI and XhoI and subcloned into the pXJ40 N-terminal Flag-tagged vector. UCP1∆3 (Bouillaud et al., 1994) was made by site directed mutagenesis (Stratagene, USA) as described in section 2.2.16. Full-length human Cidea cDNA was subcloned into pCMV5 as described previously (Chen et al., 2000). UCP1∆3 and Cidea were subcloned into pRS315 and pRS316 respectively and transformed into a diploid S. cerevisiae (strain w303) either alone or in combination. Growth of yeast cells, induction of protein expression, and preparation of yeast mitochondrial enriched heavy membrane and measurement of mitochondrial membrane potential by a flow cytometer (BeckmanCoulter, USA) were performed as described previously (Bouillaud et al., 1994). 25 nM of DiOC6 (Molecular Probes, USA) was used for the flow cytometric staining. 10 µM of FCCP (Sigma, USA) was added 10 before the addition of DiOC6. 57 [...]... Full-length human Cidea cDNA was subcloned into pCMV5 as described previously (Chen et al., 2000) UCP1 3 and Cidea were subcloned into pRS315 and pRS316 respectively and transformed into a diploid S cerevisiae (strain w3 03) either alone or in combination Growth of yeast cells, induction of protein expression, and preparation of yeast mitochondrial enriched heavy membrane and measurement of mitochondrial... paired student’s t-test using the Graphpad Prism statistical software (Graphpad software Inc.) 2.9 Plasmid construction, expression of UCP1 3 and Cidea in yeast and measurement of Mitochondria Potential Mouse UCP1 cDNA was PCR amplified from cDNAs of BAT, digested with BamHI and XhoI and subcloned into the pXJ40 N-terminal Flag-tagged vector UCP1 3 (Bouillaud et al., 1994) was made by site directed mutagenesis... light/dark cycle and ad libitum access to chow and water 2 .3. 2 Mouse genomic DNA library screening 2 .3. 2.1 Preparation of Cidea and Cideb cDNA probe The mouse full-length cDNA for mouse Cidea and Cideb were released by restricted enzymatic digestion from their respective constructs and radioactively labeled by 32 pCTP using the High prime DNA labeling Kit (#1584584, ROCHE) 2 .3. 2.2 Preparation of bacterial... phage suspension was collected, mixed with 30 µl of chloroform and kept at 4 °C 50 µl of the phage suspension were used to infect 5 ml of host cells, which was subsequently incubated in 250 ml of 1 x NZYM at 37 °C for 6 hours, before the addition of 1ml of chloroform and shaked for another 15 minutes to complete the phage lysis The phage supernatant was collected and the phage DNA extracted using QIAGEN... instructions 2 .3. 4 Mapping of Cidea and Cideb locus and construction of the targeting vector After the screening, one Cidea genomic clone and seven Cideb genomic clones were confirmed to contain the respective coding sequence by dot blotting and Southern blotting using different end-labelled specific oligonucleotide probes One Cidea clone and one Cideb clone with the longest 5’ end of the respective... 400 µl of ES freezing medium (12.5% DMSO in FCS) 2 .3. 7 Screening of homologus recombinant clones by PCR and Southern analysis Clones on the duplicate plate were lysed using the lysis buffer for preparation of genomic DNA as described in section 2.2. 13 The homologous recombinants were screened by PCR and positive clones were further confirmed by Southern blot analysis 2 .3. 8 Generation of Cidea and Cideb... NEFAC and glycerol levels were determined as mentioned above One unit of enzyme activity is defined as 1 µmol of oleic acid released per minute at 37 °C and lipase activity was expressed as unit per mg of tissue HSL activity was measured as described previously (Martinez-Botas et al., 2000) Briefly, BAT and WAT were dissected out from mice fasted for 4 hours and homogenized in 3ml buffer/g tissue and. .. respectively 2.7 .3 Mice metabolism and food intake experiments and measurements Whole body oxygen consumption rate and respiration exchange rate was assessed individually in one-year-old male mice (12 each) fed a standard chow diet using a computer controlled open-circuit indirect calorimetry (Oxymax, Colombus Instruments) with an air flow of 0.6 l/min and sample flow 0.5 l/min at 23 C After 8 hours of adaption... acrylamide (29:1), 0 .37 5 M Tris-HCl pH 8.8 and 0.1% (w/v) sodium dodecyl sulfate (SDS), and were polymerized by the addition of freshly prepared 0.1% (w/v) ammonium persulfate and 0.01% (v/v) TEMED Stacking gels are composed of 4% acrylamide, 0.125 M Tris-HCl, pH 6.8, and 0.1% SDS, and were polymerized as described for the separating gels Protein samples were mixed with equal volume of 2X protein sample... the number of plaques on the plates 2 .3. 2.4 Primary screening of genomic DNA library To cover the entire mouse genome, 14 µl of the tittered phage, corresponding to about 1x106 plaques was incubated with 20 ml of OD600 = 0.5 host cells for 20 minutes at 37 °C One hundred and twenty ml of 48°C top agar was mixed with the pre-infected host cells and the mixture was plated onto four 230 mm x 230 mm NZY plates, . cycle and ad libitum access to chow and water. 2 .3. 2 Mouse genomic DNA library screening 2 .3. 2.1 Preparation of Cidea and Cideb cDNA probe The mouse full-length cDNA for mouse Cidea and Cideb. 250 µM each of deoxy-adenine, deoxy-cytosine, deoxy-guanine and deoxy-thymidine nucleotides (New England Biolabs), 50 pM of the sense and anti-sense primers, and 2.5 Units of the Expand TM DNA. mixed with 30 µl of chloroform and kept at 4 °C. 50 µl of the phage suspension were used to infect 5 ml of host cells, which was subsequently incubated in 250 ml of 1 x NZYM at 37 °C for 6 hours,