... RDI was ≥ 85% in 59% and 68%, and < 50% in only 5% and 8% of arm A and B patients, respectively Gemcitabine RDI was ≥ 85% in 33% and 74%, and < 50% in 23% and 0% of arm A and B patients, respectively ... Tonato M: Gemcitabine and cisplatin versus mitomycin, ifosfamide, and cisplatin in advanced non-small-cell lung cancer: a randomized phase III study of the Italian Lung Cancer Project J Clin ... plus gemcitabine in advanced non-smallcell lung cancer: a phase III trial of the European Organization for Research and Treatment of Cancer Lung Cancer Group – EORTC 08975 J Clin Oncol 2003, 21:3909-3917...
Ngày tải lên: 18/06/2014, 15:20
... weekly paclitaxel (Arm B of this randomized phase II study) may be helpful to this area of drug development to determine the activity of the combination, and to understand peripheral blood mononuclear ... Rubin E, DiPaola RS: A phase I trial of weekly paclitaxel, 13- cis-retinoic acid, and interferon alpha in patients with prostate cancer and other advanced malignancies Cancer Chemother Pharmacol ... Doyle-Lindrud S, Engle E, Jin L, Todd M, DiPaola RS: A phase II trial of docetaxel and vinorelbine in patients with hormone-refractory prostate cancer Cancer Chemother Pharmacol 2005, 56:199-204 Hussain...
Ngày tải lên: 18/06/2014, 16:20
Báo cáo y học: " Green tea (Camellia sinensis) and cancer prevention: a systematic review of randomized trials and epidemiological studies" ppt
... review of randomized clinical trials and epidemiological studies to summarize the current evidence of its beneficial and harmful effects on cancer prevention in humans Methods Databases and search ... breast cancer among patients at stage I and II with high consumption of green tea (more than three cups per day) [47,49] Lung cancer (4 studies) A randomized trial compared green tea and black ... on cancer prevention as most evidence coming from cohort (grade III) and case-control studies (grade IV) is not consistent As tea drinking is common in many populations, it is difficult to randomize...
Ngày tải lên: 13/08/2014, 15:21
Báo cáo Y học: Two GPX-like proteins from Lycopersicon esculentum and Helianthus annuus are antioxidant enzymes with phospholipid hydroperoxide glutathione peroxidase and thioredoxin peroxidase activities pptx
... Dual activities for plant antioxidant enzymes (Eur J Biochem 269) 2415 MATERIALS AND METHODS Plant materials and chemicals Tomato (Lycopersicon esculentum Mill cv VFN8) and sunflower plants (Helianthus ... GPXle1 and GPXha2 The glutathione peroxidase activities of GPXle1 and GPXha2 towards several physiological and nonphysiological hydroperoxides were monitored in the presence of glutathione and glutathione ... terms of efficiency and substrate affinity (Tables and 3) Furthermore, both enzymes were able to reduce hydrogen peroxide, as well as linoleic acid, phosphatidylcholine dilinoleoyl and t-butyl hydroperoxides,...
Ngày tải lên: 08/03/2014, 22:20
FACILITY SURVEY (Under Reproductive and Child Health Project) Phase – II, 2003 ppt
... available in the District Hospitals Chapter III, IV, V, VI and VII are similar presentations respectively for FRU, CHC, PHC, SC, and ISM & H Hospital and Dispensary A summary of the findings relating ... 107 108 113 ISM and H Hospital and Dispensary Percentage of ISM and H Hospital and Dispensary functioning in government Building Percentage of ISM and H Hospital and Dispensary ... Needle………………………………………………………… 113 ii Syringe………………………………………………………… 113 iii Immunization cards and eligible couple register…………… …114 6.10 Performance of SCs …… …………………………………………………… 114 (a) ANC, Delivery and PNC services……………………………………...
Ngày tải lên: 14/03/2014, 09:20
Phase II: Estimating Health and Economic Damages (ILLNESS COSTS OF AIR POLLUTION) pdf
... the exposed population and environmental factors Key information requirements are: i) current and future air quality conditions, ii) current and future size, distribution and composition of the ... development and synthesis of better information and knowledge and to facilitate the best use of this information and knowledge in making important public policy decisions Learning and improvement ... benefit from learning and improvement, and in so doing, advance learning and improvement themselves As a result, the data and analytical methodologies set out in this section and accompanying appendices...
Ngày tải lên: 15/03/2014, 16:20
The National Study Report- Phase II of The National Study of Business Strategy and Workforce Development docx
... responsibilities A total of 578 organizations provided information during Phase I and Phase II Although this was not a random sample, all analyses (unless noted otherwise) used proportional weights ... of Business Strategy and Workforce Development The National Study Report The National Study of Business Strategy and Workforce Development was implemented in two phases Phase I was “The Benchmark ... training), talents and abilities, and family situations Age can affect many of these The National Study asked employers to think about the distinctions and the overlaps between age and career stage...
Ngày tải lên: 23/03/2014, 02:20
Natural Resource Accounting in Goa Phase II: Integrated Research and Action for Development, New Delhi doc
... has to be taken to landfill sites The trucks and trolleys are used for transportation of waste and it is dumped in landfill sites Land fills (Value of Land): The value of land that is used for ... generally disposed at waste-land and some part of it is goes for organic composting and recycling • Landfill - major part of the solid waste is dumped into wasteland or farmland; generally it is dumped ... the value of Land We take the value of municipal land where the solid waste is disposed and the land is filled upto a depth of meter (assumed) One hectare of land taken for the land filling upto...
Ngày tải lên: 29/03/2014, 14:20
báo cáo hóa học:" Phase II trial of Modified Vaccinia Ankara (MVA) virus expressing 5T4 and high dose Interleukin-2 (IL-2) in patients with metastatic renal cell carcinoma" pot
... References Authors' contributions H L K and M.W.C did the conception and design of the clinical study; H L K., B T and W S treated and evaluated patients; G D and J M provided study materials; S ... M processed samples and analyzed immune responses; H.L.K, S K-S, J N H, R H., and S N did data analysis and interpretation H.L.K, J N H and S K-S did statistical analysis and wrote the manuscript ... cell dependent and antibody mediated Cancer Immunol Immunother 2006, 55:1081-1090 Schlom J, Gulley JL, Arlen PM: Paradigm Shifts in Cancer Vaccine Therapy Experimental Biology and Medicine 2008,...
Ngày tải lên: 18/06/2014, 15:20
Báo cáo khoa học " Optimisation of extraction procedure for black fungus polysaccharides and effect of the polysaccharides on blood lipid and myocardium antioxidant enzymes activities " pdf
... al., 2009) MDA and GSH levels of BFP-treated and untreated high fat mice are presented in Figs and Compared with normal control, MDA level and increased GSH level in myocardium and blood were ... cholesterol diet (HCD) and the other group fed the same diet supplemented with black fungus polysaccharides (0.6% and 1.2%) Another mice fed with basic diet and served as control Diets and tap water were ... glucopyranose (Glcp) and xylopyranose (Xylp), respectively Medicinal mushroom extracts have been considered as important remedies for the prevention and treatment of many diseases for thousands of years...
Ngày tải lên: 28/06/2014, 11:20
Báo cáo khoa học: " Neoadjuvant capecitabine, radiotherapy, and bevacizumab (CRAB) in locally advanced rectal cancer: results of an open-label phase II study" docx
... capecitabine vs intravenous 5-fluorouracil and leucovorin: integrated efficacy data and novel analyses from two large, randomized, phase III trials Br J Cancer 2004, 90:1190-1197 15 Glynne-Jones ... and postoperative chemotherapy with 5-fluorouracil and oxaliplatin versus 5-fluorouracil alone in locally advanced rectal cancer: first results of the German CAO/ARO/AIO-04 randomized phase III ... rectal cancer: a multicentric phase II study Ann Oncol 2006, 17:246-251 41 Desai SP, El-Rayes BF, Ben-Josef E, Greenson JK, Knol JA, et al: A phase II study of preoperative capecitabine and radiation...
Ngày tải lên: 09/08/2014, 09:21
Báo cáo y học: "Reduction in antioxidant enzyme expression and sustained inflammation enhance tissue damage in the subacute phase of spinal cord contusive injury" ppt
... demonstrate that oxidoreduction-related enzymes (Prx1, Prx6, MnSOD and CAT) and Hsp60 were reduced at day 14 post SCI, while b-actin and actin-capping proteins (CAPG and CAPBZ) were increased Similar ... tissues with DAB, and counted per section Preparation of primary astrocytes and microglia Media and antibiotics were purchased from Invitrogen (Carlsbad, CA, USA) Cell cultureware and Petri-dishes ... peptide calibration standard I (Bruker Daltonics) for each batch of samples and neighboring calibration with angiotensin II (1046.5418 m/z), [Glu]-fibrinopeptide B (1570.6774 m/z), and ACTH fragment...
Ngày tải lên: 10/08/2014, 05:21
báo cáo khoa học: " The redox-sensitive transcription factor Rap2.4a controls nuclear expression of 2-Cys peroxiredoxin A and other chloroplast antioxidant enzymes" pps
... PCR1 and primer2 (CTCCGGTCACGTTATTCAAC) and 2CPANcoI (AGACGCCATGGCTGCTACACAC) for PCR2 The 1425 bp product was amplified from the gel purified products of PCR1 and PCR2 with 2CPA-HindIII and 2CPA-Nco ... corresponding wild-type promoter (amplified with 2CPA-HindIII and 2CPA-Nco I using 2CPA:LUC [11] as template) it was cloned into the Hind III and Nco I sites of pEYFP (Clontech, CA, USA) (2CPAwt:YFP; ... chloroplast antioxidant enzymes Plant Physiol 2007, 143:1774-1788 [https://iii.genevestigator.ethz.ch/at/] Baier M, Dietz KJ: Primary structure and expression of plant homologues of animal and fungal...
Ngày tải lên: 12/08/2014, 05:20
Tài liệu WWEI phase II pdf
... lng c bn - other salary Cụng tỏc xõy lp thuc nhúm II: 1.062 group II of construction of work Cụng tỏc xõy lp thuc nhúm III: 1.171 group III of construction of work Legal holiday, public holiday ... Inner road and OM road Attention: those characteristics are diffirent to those described in final report - main report volume Proposed for phase II Basis for demand resilent modulus of phase I: ... engineering design consists of (1) review of definitive plan: Phase II : IR, F/S Phase I : detailed design (detail drawing, main report and final report), ICB document (2) detailed engineering...
Ngày tải lên: 18/01/2014, 13:20
Tài liệu Design, Lifestyles and Sustainability. Aesthetic Consumption in a World of Abundance pptx
... Design, Lifestyles and Sustainability 325 tion and consumption are becoming progressively more fashion sensitive, dependent on aesthetics and well designed products and services In such lands of ... distinguishable and clear Designers such as Peter Behrens in Germany and Raymond Loewy in the United States were hailed in the press and contracted by companies and brands such as AEG, Greyhound and Lucky ... offerings, of images and brands To infuse meaning into products and services; to transform commodities into concepts and lifestyles has become a prime task for managers Lash and Urry (1994) argue...
Ngày tải lên: 19/02/2014, 17:20
MARTA 2012 Management Audit PHASE II DRAFT pdf
... 0.0% MARTA’s Wages and Salaries as a percentage of Total Personnel Costs are lower than private sector and state and local averages MARTA’s Medical, Pension and Other Retirement, and WC, FICA, SS ... assessment of owned and not utilized functionality, and available functionality not owned KPMG interviewed MARTA’s IT staff, business owners, and management We also analyzed MARTA’s IT usage and IT impact ... Enhancement Background and Objectives MARTA engaged KPMG to provide a combination of operational audits and strategic advisory services to assess and improve MARTA’s overall operational and financial...
Ngày tải lên: 06/03/2014, 23:20
Child Health Action Plan Phase II Impacting on Child Health Outcomes 2012 - 2017 pptx
... development: • Phase I - building a multi-disciplinary team approach within CCDHB; • Phase II - a strategy to support a wider CCDHB Hospital and Health Services (HHS) engagement; and • Phase III - a ... Disability and Unintentional Injury Prevention This paper has been developed for the purposes of identifying the key issues, and prioritised areas for action for Phase II The Phase II document ... implementation and development of Phase I and Phase II Action Plans A key role of the Child Health ICC will be to: • Identify sustainable approaches to address service priorities; • Develop and implement...
Ngày tải lên: 07/03/2014, 04:20
International consensus recommendations on the aesthetic usage of botulinum toxin type A (Speywood Unit) – part II: wrinkles on the middle and lower face, neck and chest pdf
... the largest and strongest muscle functioning in mastication Its superficial portion originates from the zygomatic arch and inserts into the ramus of the mandible and the side of the mandibular angle ... palpebral and orbital portions The lacrimal portion is at the medial side of the orbit, and is the smallest and the innermost part of the orbicularis oculi The palpebral portion raises the eyelid and ... affect the depressor labii inferioris and the orbicularis oris, causing drooling, speech impairment, mouth asymmetry and lower lip ptosis Using the recom- 1293 mended dose and injection points should...
Ngày tải lên: 07/03/2014, 17:20
Báo cáo khoa học: Residues affecting the chloride regulation and substrate selectivity of the angiotensin-converting enzymes (ACE and ACE2) identified by site-directed mutagenesis pot
... the chloride sensitivity of tACE and ACE2, the fold differences between the activity at and 500 mm NaCl with angiotensin I and and 100 mm NaCl with angiotensin II were recorded (Fig 4) These concentrations ... site-directed mutagenesis, and the effects on chloride sensitivity, substrate selectivity and inhibitor potency were observed Results PCR mutagenesis of CL1 and CL2 site residues of tACE and ACE2 The residues ... CL1 and CL2 sites of tACE and ACE2 are shown in Fig In tACE, the residues that coordinate the chloride ion at the CL1 site are Arg186, Trp485 and Arg489, which are conserved as Arg169, Trp477 and...
Ngày tải lên: 16/03/2014, 04:20
Báo cáo khoa học: The propeptide of cruzipain ) a potent selective inhibitor of the trypanosomal enzymes cruzipain and brucipain, and of the human enzyme cathepsin F ppt
... a PBL residue, displayed as a ball -and- stick model and highlighted in the sequence alignment and cathepsin F than in the cathepsin V, L, K and S proregions, and thus they may represent another ... template and Pfx polymerase (Invitrogen, Grand Island, NY, USA) The Proteolytic enzymes amplification conditions were as follows: 30 cycles of denaturation (94 °C, min), annealing (55 °C, min), and ... differentiation to macrophages Hela cells and androgen-independent DU145 prostate cancer cells derived from brain metastasis of human prostate cancer were obtained from the ATCC, and human primary cultures...
Ngày tải lên: 16/03/2014, 11:20