maximum of adsorption at the i e p

... Since these P- type ATPases are also the first Pb(II)-translocating pumps to be identified, it is possible that differential expression in Pb(II)exposed individuals may produce variations in Pb(II) ... suggest that the A1 site exhibits independent unisite catalysis in the absence of As(III) or Sb(III); participation of the A2 site requires metalloid binding, which produces multisite catalysis ... opposite directions illustrates the point that the directionality of transport cannot easily be deduced from inspection of the primary sequence of the proteins Together the two pumps provide...

Ngày tải lên: 11/08/2014, 15:20

... the specified limits, and high specific speed pumps, which may have a narrower preferred operating region than specified, should be offered where appropriate, and their preferred operating region ... develop when operating with the furnished impeller at the rated speed, and maximum specified relative density (specific gravity) 1.4.16maximumallowablespeed (inrevolutions per minute): The highest ... upon the pump's energy density,its specific speed In general, the change in vibration inspeed, and its suction specific creases with increasing energy density, higher specific speed, and higher...

Ngày tải lên: 02/04/2014, 15:32

... h p phụ gi i h p vật liệu ion kim lo i U(VI), Cu(II), Pb(II), Zn(II) Cd(II) m i trường nước  Gi i hạn: Nghiên cứu đặc tính h p phụ gi i h p ion kim lo i U(VI), Cu(II), Pb(II), Zn(II) Cd(II) ... chức epichlorhydrin (hay chloromethyloxirane) polyphosphate [103] , β-cyclodextrin polyaldehyde ethyleneglycol diglycidyl ether glycerolpolyglycidylether hexamethylenediisocyanate, genipin [11, ... tác giả chứng minh trình h p phụ Cd(II) chitosan có mặt ethylenediaminetetraacetic acid (EDTA) giảm nhiều, i u gi i thích EDTA tạo phức bền v i ion kim lo i nặng Một thuận l i việc sử dụng chitosan...

Ngày tải lên: 18/04/2014, 17:43

... systems The adsorption isotherms are one of the most useful data to understand the mechanism of the adsorption and the characteristics of isotherms are needed before the interpretation of the kinetics ... Pb(II) (Fig 9c) respectively presented new appearing peaks, corresponding to Ni and Pb elements The EDS spectra provided an evidence for efficient metal uptake by chitosan/ magnetite composite ... important to establish the appropriate relationship for the batch equilibrium data using empirical or theoretical equations as it may help in modeling, analyzing and designing adsorption systems...

Ngày tải lên: 02/07/2014, 14:14

... L.H Khiem (2011), “Design of experiment for (α ,p) reaction induced by 22Mg radioactive ion beam”, Proceedings of the topical conference on Nuclear Physics, High energy Physics and Astrophysics, ... Tokyo, pp - 27 [5] N N Duy, L H Khiem, S Kubono, D Kahl et al (2012), “Active target measurement of the 22 Mg+alpha system in inverse kinematics”, RIKEN Accelerator Process Report 45, p. 20 [6] ... “Investigation of gas gain of GEM-foil used in low energy radioactive beam experiment”, Communications in Physics, Vol 22, No.3, pp 283 - 287 [12] N.N.Duy, L.H Khiem and V H Tan (2011), “Gas gain...

Ngày tải lên: 25/07/2014, 09:04

... tests using the trained network that incorporates the inspection for training data fitting errors and prediction test of errors The selected network was then applied for computer-generated application ... Cd(II) data i. e. , other absorbance intensities were introduced to the networks to check for its prediction capability and precision Table 1: The general setting of the BP specific parameters during ... spectral reading were obtained Three of these spectra were used for testing the trained network whilst the remaining spectra were used for the training of the network Journal of Physical Science,...

Ngày tải lên: 07/08/2014, 14:20

... and kinetic studies”, The 2012 international conference on green technology and sustainable development Ho Thi Yeu Ly, Vo Quang Mai, Nguyen Mong Sinh, Adsorption zinc (II) onto modifiled chitosan: ... hiệu h p phụ ion kim lo i U(VI), Cu(II), Pb(II), Zn(II) Cd(II) pH mà trình h p phụ CTSK đạt hiệu suất cao ion U(VI) 5, Cu(II), Pb(II) Zn(II), Cd(II) Th i gian đạt trạng th i cân h p phụ U(VI) ... Đ i v i vật liệu CTSK-CT có khác biệt, v i ion UI(VI), Pb(II) Zn(II), trình h p phụ tuân theo bốn mô hình Langmuir, Freundlich, Temkin Redlich-Peterson V i ion Cu(II), trình h p phụ tuân theo...

Ngày tải lên: 22/12/2014, 08:43

Ngày tải lên: 04/04/2015, 15:19

... th y sau gi i h p ph ion kim lo i M2+ kh i axit humic r i ti n hành t i h p ph ion kim lo i M2+ kh h p ph c a axit humic gi m không thay ñ i nhi u T i tr ng h p ph ion M2+ c a axit humic sau l ... lo i axit humic b n m i trư ng pH cao pH th p Như v y: Có th ch n pH = cho trình gi i h p ph 3.5.2 T i h p ph i u ki n ti n hành: Ti n hành t i h p ph ion kim lo i lên axit humic (A.H/II – ... p ph axit humic ban ñ u nên ñ rõ nét c a ñám ph riêng bi t b gi m Ti n hành gi i h p ph kho ng pH khác ñ i v i m i ion kim lo i ch n pH = cho trình t i h p ph Th c hi n chu trình h p ph - gi...

Ngày tải lên: 23/12/2013, 16:33

... introduced on the end of the proposed synthetic trypsin inhibitor gene The sequences of the forward and reversed primers are shown on fig and of the synthetic gene is on fig Forward primer: GAATTCCATATGAGCGGCAGCGATGGCGGCGTGTGCCCGA ... overlapping synthetic oligo nucleotides were designed While desingning the oligo nucleotide primers Nde I restricsion site was introduced on the end, stop codon and Xho I restriction site was introduced ... template The conditions for this experiment were established as: 150ng of each primer; 200àM of dNTPs ;400ng of the purified total MCo DNA Cloning of the synthetic MCoTI-II The PCR amplified...

Ngày tải lên: 12/02/2014, 10:20

... features emerging from the sequence comparison concern, as expected, the replacement of the otherwise conserved aspartate at the ferroxidase center with a histidine (His78), and the absence of ... This aspartate fi histidine replacement is the basis for the unforeseen binding of Zn(II) at the ferroxidase center, and most likely for the high efficiency of O2 as Fe(II) oxidant These properties ... funnel shape of the pores and in an increase in their cross-section (Fig 2B) Furthermore, the nature and spatial arrangement of the residues lining the pore change with respect to the other Dps...

Ngày tải lên: 15/03/2014, 09:20

... further restricting antigenic diversity increasing relative expression of wild-type proteins thus further exposing these epitopes to immune surveillance and facilitating specific high-affinity immune ... responsible, the kinetic paradox implies their potency falls significantly between points A and B 2.3 The Hepatitis C "early replication" paradox Hepatitis C replication kinetics and their relationship ... given RNA virus quasispecies biology, it would be surprising if some didn't), then the RNA quasispecies will generate a quasispecies of variant polypeptides potentially reactive to these receptors...

Ngày tải lên: 19/06/2014, 08:20

... further restricting antigenic diversity increasing relative expression of wild-type proteins thus further exposing these epitopes to immune surveillance and facilitating specific high-affinity immune ... responsible, the kinetic paradox implies their potency falls significantly between points A and B 2.3 The Hepatitis C "early replication" paradox Hepatitis C replication kinetics and their relationship ... given RNA virus quasispecies biology, it would be surprising if some didn't), then the RNA quasispecies will generate a quasispecies of variant polypeptides potentially reactive to these receptors...

Ngày tải lên: 20/06/2014, 04:20

... radiation therapy planning were not available for patients treated at outside facilities No significant differences in the use of IOERT versus perioperative brachytherapy were observed between the NCR ... groups; no SA patients received IOERT or perioperative brachytherapy There were no significant differences in use of IOERT or brachytherapy with regard to patient age or sex No significant difference ... Differences in limb preservation rates between NCR and NR were not detected, making it unclear if the addition of chemotherapy to pre-operative therapy improves limb preservation outcomes Logistic...

Ngày tải lên: 09/08/2014, 09:20

... phức chất Zn(II), Cd(II), Pd(II) v i ph i tử dẫn xuất Quinolin phương ph p phiếm hàm mật độ phương ph p phổ’’ Mục tiêu nghiên cứu - Nghiên cứu cấu trúc số phức chất Zn(II), Cd(II), Pd(II) v i ... phân tử phức chất Zn(II), Cd(II), Pd(II) v i ph i tử QAm số phƣơng ph p vật lý hóa học nhƣ: phƣơng ph p EDX; phƣơng ph p phân tích nhiệt; phƣơng ph p phổ h p thụ hồng ngo i (phổ IR); phƣơng ph p ... phản ứng trùng h p vinyl Năm 2011, Hussein S Seleem báo cáo tổng h p nghiên cứu hoạt tính sinh học phức chất số kim lo i chuyển ti p nhƣ ion Fe(III), Co(II), Ni(II), Cu(II), VO(II) Pd(II) với...

Ngày tải lên: 18/12/2014, 20:38

... phức chất Zn(II), Cd(II), Pd(II) v i ph i tử dẫn xuất Quinolin phương ph p phiếm hàm mật độ phương ph p phổ’’ Mục tiêu nghiên cứu - Nghiên cứu cấu trúc số phức chất Zn(II), Cd(II), Pd(II) v i ... phân tử phức chất Zn(II), Cd(II), Pd(II) v i ph i tử QAm số phƣơng ph p vật lý hóa học nhƣ: phƣơng ph p EDX; phƣơng ph p phân tích nhiệt; phƣơng ph p phổ h p thụ hồng ngo i (phổ IR); phƣơng ph p ... phản ứng trùng h p vinyl Năm 2011, Hussein S Seleem báo cáo tổng h p nghiên cứu hoạt tính sinh học phức chất số kim lo i chuyển ti p nhƣ ion Fe(III), Co(II), Ni(II), Cu(II), VO(II) Pd(II) với...

Ngày tải lên: 19/12/2014, 08:53

... this paper is outlined in section VII Reference-point interactive approaches 2.1 Concepts In this section we summarize the reference point interactive method, which is the most popular one in the ... With the present of DM, POFs were contracted towards the areas of preference That is the e ect of reference points , which was used to create the reference rays in DMEA-II If the loop is continued, ... those reference points we propose three approaches to be used in the proposal interactive method The first approach, the rays are generated from the reference points and paralleled with the central...

Ngày tải lên: 13/08/2015, 10:00

... squares PC PCR (Phương ph p bình phương t i thiểu nghịch đảo) Principal component (Cấu tử chính) Principal component regression PLS (Phương ph p h i qui cấu tử chính) Partial least squares PP ppm ... natridiethyl dithiocacbamat, Alizarin đỏ S, dithizon, axit rubeanic, natridiethyldithiocacbomat, 2,2’-biquinoline, cupferon V i thuốc thử Natridiethyl dithiocacbamat (NaDDC), phản ứng tạo phức ... Tween 80 (5%) Khoảng tuyến tính: Co(II) 0,5 – (ppb), Ni(II) 0,5– (ppb), Cu(II) 0,5 – 23 (ppb) Gi i hạn phát hiện: Co(II) 6,7 (ppb), Ni(II) 3,2 (ppb), Cu(II) 3,9 (ppb) Cực đ i h p thụ: Co(II)...

Ngày tải lên: 10/04/2013, 10:22

... (sweep rate): 0,06V/s - Th i gian sục khí (initial purge time): 300s - Th i gian sục khí cho lần thêm dung dịch chuẩn: 10s - Th i gian i n phân (deposition time): 90s - Th i gian cân (equilibration ... p c -0,45 V v i gi i hạn phát 2,4.10-10 M Bằng phương ph p Vôn-Ampe hoà tan đệm axetat (pH = 4,6) Cu cho p c -0,0038V v i gi i hạn phát 1.10-10 M [16] [18] 1.1.4.2.3 Phương ph p Neocuproine Ion ... cần phân tích Pb (II) cation kim lo i có khả tạo phức v i nhiều thuốc thử hữu khác Vì p dụng phương ph p trắc quang để xác định Pb Việc xác định Pb phương ph p trắc quang v i dithizon phương pháp...

Ngày tải lên: 20/12/2013, 18:07

... tạo phức v i nhiều kim lo i 1.2 Khả tạo phức Thiosemicacbazit Jensen ng i tổng h p nghiên cứu phức kim lo i chuyển ti p v i thiosemicacbazit Ông tổng h p nghiên cứu phức chất Cu (II), Ni (II), ... salmonellatyphi, s.aureus, shigella, pseuđomonas Còn phức Ni(II) hầu hết lo i vi khuẩn bị ức chế nh Tuy nhiên tác động shigella pseuđomonas phức Ni(II) cha đợc phát Trong số phức Zn (II) Cd (II) ... V i hoạt tính nh: kháng khuẩn, chống sốt rét, kháng vi rút kháng u Phức kẽm thiosemicacbazon theo Fluorescence studies of the intra-cellular distribution of zinc bis (thiosemicacbazon ) complexes...

Ngày tải lên: 22/12/2013, 13:09