local expression of the south

... great-grandmother Grandma, b. 1901 grandmother/homemaker Gram, b. 1903 grandmother/homemaker Grandad, b. 1903 grandfather/bookkeeper Grandpa, b. 1911 grandfather/doctor Fritz Markley, b. 1929 father-in-law/locksmith ... original family Al, b. 1959 brother/lawyer Dad, b. 1934 father/IT professional Doug, b. 1962 brother/lawyer Drew, b. 1970 dog Mom, b. 1936 mother/writer Sam, b. 1960 brother/artist Chicago circle ... Marco Torez security officer Matt Benjamin IT professional Matthew Martinez supervisor Melanie Bricker office administrator Michelle Jennings office administrator Nikos IT professional Odin...

Ngày tải lên: 07/11/2012, 09:09

... to the catalytic site of the R1E subunit. As reported in the Results, upon completion of substrate conversion, the radical is then rapidly passed back from the R1E subunit to the tyrosyl of the ... RNR and that of other class 1 RNRs or, instead, is a result of the interaction of the R2F with the inactivated (oxidized) form of the R1E. We consider the first option unlikely. Under these cir- cumstances, ... recipient. In the present study, we report data on homologous expression of the nrdF gene of C. ammoniagenes strain ATCC 6872. This is the first report of the successful purification of high amounts of the...

Ngày tải lên: 15/02/2014, 01:20

... from that of the oviduct ecto-ATPDase. Immunochemical staining demonstrates the distribution of the ecto-ATPDase in the bile canaliculi of the chicken liver. HeLa cells transfected with the chicken ... Besides oviduct and liver, the chicken ecto- ATPDase is also present in the apical membranes of the oxyntic-peptic cells [37]. The distribution of the ecto- ATPDase on these epithelial cells is distinctly ... different from theotherATPDaseintheE-ATPasefamily,theCD39s [13,17,19]. Molecular cloning of chicken liver ecto-ATPDase The results described above indicate that: (a) the enzymatic properties of the chicken...

Ngày tải lên: 22/02/2014, 04:20

... [Pg 1] The South of France. I. known, the gifts of all property that were made to the Church, the abandonment of worldly pursuits, the terrors of many, the anxiety of the calmest, the emotional ... telling of the Cathedrals of the South which was at once accurate and complete. For the Cathedrals of that country are monuments not only of architecture and its history, but of the history of peoples, ... ancients. To Virgil the adventures of the “pious Æneas” were truly heroic. The western shores of the Mediterranean were then the “end of the earth,” and even during the first centuries of our own era,...

Ngày tải lên: 06/03/2014, 03:21

... Some of the methodologies employed and the basic results for these other countries are discussed by Mani (2007). However, it is not the intention of this report to analyse the results of these ... 3.2% of the turnover of these enterprises. In both the industrial and services sector, the bulk of innovation expenditure was devoted to the acquisition of new machinery, equipment and software, ... on benchmarking the results of the South African Innovation Survey with the results of CIS4 undertaken in the various EU countries (as well as Norway and Iceland). The results of innovation surveys...

Ngày tải lên: 07/03/2014, 09:20

... processing of the D. melanogaster a -F1-ATPase transcript The expression of the a-F1-ATPase gene during develop- ment is coordinated with the expression of the nuclear- encoded b-F1-ATPase gene and the ... under the control of the actin 5C promoter. The GAGA factor stimulated at least threefold the activity of the promoter in constructs )397/+86 and )146/+86, but had no effect on the activity of the construct ... similar activity in Schneider cells to the promoter of the b-F1-ATPase gene [34] and 10-fold stronger than the promoter of the gene encoding the catalytic subunit of the mitochondrial DNA polymerase...

Ngày tải lên: 07/03/2014, 16:20

... clearly grouped the trout IL-11 with IL-11 molecules from other species and separate from other members of the IL-6 family. In vivo expression of IL-11 RT–PCR was used to examine the expression of trout IL-11 ... differ- ences were a 26 bp insertion in the 5¢-UTR of the cDNA and an insertion of 12 repeats with a consensus of CCAATGATGATCCAAGAAATCCACACTACAG (31 bp) in the 3¢-UTR of the cDNA sequence (Fig. 1). A ... in the 5¢-UTR, and four potential poly(A) signals were found in the 3¢-UTR (Fig. 1), two of them just 14 or 23 bp upstream of the poly(A) tail. The remaining two poly(A) signals were upstream of the...

Ngày tải lên: 07/03/2014, 16:20

... gene for one of the proteolipid subunits of V-ATPase. Expression of the cDNAs in the strain revealed that four cDNAs from the six complemented the proton transport activity into the vacuole, ... progress. Isoforms of V-ATPase subunits have so far been reported in higher plants as reviewed by Sze et al. [1], three isoforms of the subunit a of mouse enzyme [22,23], four isoforms of the proteolipid ... isoforms as observed in higher plants V-ATPase. We have also isolated two different cDNAs coding for the subunits A and B of V-ATPase. The intracellular localization of these isoforms and the...

Ngày tải lên: 08/03/2014, 23:20

... questionnaires. Many of the smaller firms did not see the relevance of the Innovation Survey to their businesses. Because of the relatively low response rate to the survey, some of the smaller sub-strata ... Some of the methodologies employed and the basic results for these other countries are discussed by Mani (2007). However, it is not the intention of this report to analyse the results of these ... turnover of all enterprises and 2.1% of the turnover of innovative enterprises. Intramural and outsourced R&D accounted for 0.69% of the turnover of all enterprises and 1% of the turnover of...

Ngày tải lên: 15/03/2014, 02:20

... them out, take the blacking and brush, and go at them." CHAPTER IV THE BOAT-RACE. At eight o'clock, on the evening of the third day of the passage, the lights of another steamer ... Just at the edge of the city, and sheltered by large poplar-trees was the old homestead in which she resided. There was a splendid orchard in the rear of the house, and the old weather-beaten ... citizen of the first standing among the whites, but even the slaves regarded him as one of the kindest of masters. Having inherited his slaves with the rest of his property, he became possessed of...

Ngày tải lên: 15/03/2014, 03:20

... suggesting that the level of GFP–PrP C transgene expression was dependent on the colour of the background of the animal. The fusion protein was found only in the NIL and not in the AL of black- and ... investigate the intracellular fate of PrP C by examining for the first time its biosynthesis in the secretory pathway of neuro- endocrine cells in vivo and the effect of the transgene expression of PrP C on ... approach with the intermediate pituitary melanotrope cells of the South- African claw- toed frog Xenopus laevis. Depending on the colour of the background of the animal (black or white), these cells...

Ngày tải lên: 16/03/2014, 14:20

... present in the other members of the APP superfamily, such as the absence of the exon encoding the KPI domain and the lack of a second heparin-binding domain [3,4,13,26]. Comparative analysis of the Xenopus and ... andmammalianAPLP2. Overall, the high degree of conservation of APLP2 may help the identification of functionally important domains within this APP superfamily member. Expression pattern of Xenopus APLP2 mRNA The expression ... Xenopus .The availability of the Xenopus APLP2 protein sequence allowed a phylogenetic analysis of APP superfamily mem- bers that suggested the occurrence of APP and preAPLP lineages with their...

Ngày tải lên: 16/03/2014, 16:20

... may have acted on the level of pyrG expression has been removed. The strength of the feedback regulation of CTP on pyrG expression, i.e. the elasticity of pyrG expression for the CTP concentration ... pyrG expression of up to 250% of the wild-type level (Fig. 4A). The results show that the feedback inhibition of the CTP synthase enzyme is incomplete in vivo. In conclusion, the homeostasis of the ... downstream of synthetic promoters. Expression from pyrG in the wild type is regulated by the concentration of CTP in the cell by an attenuation mechanism in the 5¢-end of the pyrG mRNA [6]. The primer...

Ngày tải lên: 16/03/2014, 16:20

... particles from grass pollens [10,11]. The small size of these sub- cellular particles allows them to reach the deeper air- ways and may explain the frequent occurrence of heavy asthma attacks after rainfalls ... Spectrometer (ThermoQuest Inc.). The spectra were deconvoluted using Thermo Finnigan’s xcali- bur software and the spectra were also verified by hand cal- culations of charge states. The proteolytic ... preincubation of patients’ sera with small recombinant protein fragments suggesting the importance of conformational IgE epitopes [25]. Therefore, we further tested the importance of struc- tural...

Ngày tải lên: 16/03/2014, 18:20

Ngày tải lên: 16/03/2014, 23:20

Ngày tải lên: 17/03/2014, 10:20

Ngày tải lên: 17/03/2014, 11:20

Ngày tải lên: 23/03/2014, 13:20

Ngày tải lên: 24/03/2014, 04:21