... 16S-9F and 16S-1525R The result of PCR perform size band of strains and Bacillus subtilis control had 1500bp Sequencing perform that strains (Bs4 and BN5) were Bacillus subtilis (99% and 98% ... environment and organic matter should be decided on the subject of Bacillus subtilis isolated from waste water of beer and beer wallows in the brewing process Objective: Isolation, selection and identification ... 45ml EtBr 0,8µl RESULTS AND DISCUSSION 3.1 Bacteria Isolation and characteristic: 3.1.1.Bacteria Isolation: 21 isolates bacteria strains isolates from “mud-dreg” took 42,85% and 12 from waste water...
Ngày tải lên: 06/10/2015, 12:58
Ngày tải lên: 08/04/2014, 12:50
Báo cáo khoa học: "Isolation and identification of Escherichia coli O157:H7 using different detection methods and molecular determination by multiplex PCR and RAPD" docx
... P010726-22, P010726-23, P010726-25, and O157-C-1-2), and 14 USA isolates; strains of ATCC (A1, A2, A3, and A4), strains of Cornell University (C1, C2, C3, C4, C5, and C6), and strains of Pennsylvania ... Nishibuchi M Isolation and characterization of Escherichia coli O157 from retail beef and bovine feces in Thailand FEMS Microbiol Lett 2000, 182, 343-347 48 Wallace JS, Cheasty T, Jones K Isolation ... were collected from pigs and cattle at slaughterhouses, and from chicken at meat processing plants The sponge sampling method was used to collect 286 pork and beef samples and homogenization was...
Ngày tải lên: 07/08/2014, 18:21
Báo cáo khoa học: " Isolation and identification of a canine coronavirus strain from giant pandas (Ailuropoda melanoleuca)" ppt
... giant pandas’ spleens, infected and non-infected FCWF cells (as positive and negative controls) using the TRizol Reagents kit (Invitrogen, USA) per the manufacturer’s recommendations o and the ... Bacteriology failed to grow organisms in cultures inoculated with liver and spleen after 48 h culture Fig Isolation and culture of giant panda virus (GPV) in Felis catus whole fetus (FCWF) cell line (A) ... bodies of GPV in the cytoplasm of cells Scale bars = 200 nm Isolation and identification of a canine coronavirus strain from giant pandas 263 isolated The electron microscopy results provided...
Ngày tải lên: 07/08/2014, 23:22
Báo cáo y học: "Isolation and identification of bioactive compounds in Andrographis paniculata (Chuanxinlian)" potx
... fractionated the dichloromethane extract and yielded three diterpene compounds, namely andrographolide, 14-deoxyandrographolide and 14-deoxy-11,12-didehydroandrographolide Andrographolide showed the greatest ... powder mixture of andrographolide plus 14-deoxyandrographolide and 14-deoxy-11,12-didehydroandrographolide together The mixture stimulated phagocytosis, and elevated antibody titer and plaque-forming ... of the nhexane and methanol extracts of A paniculata Seven compounds, namely andrographolide, bis-andrographolide 14-deoxy-11,12-didehydroandrographolide, andrograpanin, 14-deoxyandrographolide,...
Ngày tải lên: 13/08/2014, 15:21
Isolation and identification of components from ixeris sonchifolia hance as potential anti stroke agents
... Discussion and conclusions Chapter Isolation and characterization of components from ethyl acetate fraction of Ixeris sonchifolia Hance 48 55 3.1 Introduction 56 3.2 Materials and methods 56 3.2.1 Isolation ... Molecular and Cell Biology, who helped me process the tissue immunohistological staining I would like to thank Dr Chan Lai Wah and Dr Go Mei Lin for their valuable guidelines on my Ph.D candidature and ... continuous encouragement, wise advice and kind support Her support, understanding, advice and mentoring have helped guide me through my doctoral program and my dissertation Without her, none...
Ngày tải lên: 11/09/2015, 10:06
Instrumentation Symbols and Identification
... of the standard The symbols and designations in this standard can depict both hardware and function Sketches and technical papers will usually contain highly simplified symbolism and identification ... preface, footnotes, and appendices is included for information only and is not a part of the standard The instrumentation symbolism and identification techniques described in the standard accommodate ... instructions, and knowledge about measurement and control systems in the process industries This document is a consensus standard rather than a mandatory one As such, it has many of the strengths and the...
Ngày tải lên: 04/04/2013, 12:40
Tài liệu BIOMASS NOW – CULTIVATION AND UTILIZATION ppt
... environment They store carbon, produce food and timber, filter water and support wildlife and the urban and rural landscapes They also preserve records of ecological and cultural past However, there are ... clay and organic mater contents, land use had an overriding effect on soil quality: agricultural systems could be clearly differentiated from managed and natural forests, and grass land and arable ... the cultivation of peanut cv IAC-Tatu and velvet bean, and in the 0.2-0.4 m layer, with mung bean, sunflower IAC-Uruguai, and peanut cv IAC-Tatu The increase of 10 Biomass Now – Cultivation and...
Ngày tải lên: 21/02/2014, 22:20
Báo cáo " Analysis and identification of multi-variate random pressure fields using covariance and spectral proper transformations " pdf
... Physics 24 (2008) 209-222 identification, dynamic response and so on Several literatures presented the POD’s application to decompose the spatially-correlated and multi-variate random pressure fields ... troublesome and difficulties in interpreting theses results In this paper, the POD based spectral and covariance matrices of the random field will be presented Both covariance-based and spectral-based ... orthogonal basic vectors which can expand a multi-variate random process into a sum of products of these basic orthogonal vectors and single-variant uncorrelated random processes Let consider the...
Ngày tải lên: 05/03/2014, 14:20
Báo cáo khoa học: Isolation, characterization and expression analysis of a hypoxia-responsive glucose transporter gene from the grass carp, Ctenopharyngodon idellus potx
... GLUT1 and GLUT3 (exons 3–8), and four in human GLUT2 (exons 7–10) and GLUT4 (exons 6–9) (Table 1) The codons for arginine (96) and valine (231) in gcGLUT (Fig 2) are split between exons and 5, and ... (between exon and exon 5) and valine (between exons and exon 7) are shown Exonic regions are shown in uppercase and intronic regions are in lowercase The split codons are boxed and highlighted ... 5¢-CCTGATCGACGCACGAGT-3¢ and GT1-R, 5¢-TTTTGCAAGTCATAGTAATCAGTTT-3¢ for GTcDNA1 (2150 bp); and GT2-F, 5¢-CACCAGCAACTAC CTGATCGA-3¢ and GT2-R, 5¢-CACAAAATATGCTT CCAAGTGC-3¢ for GT-cDNA2 (3043 bp) RNA isolation and...
Ngày tải lên: 17/03/2014, 03:20
Báo cáo " Isomeranzin against Herpes simplex virus in vitro from Clausena heptaphylla (Roxb.) W. & ARN.: Isolation, structure and biological assay " potx
... Dr Tran Ngoc Ninh, Vietnamese Academy of Science and Technology Extraction and isolation Leaves of Clausena heptaphylla were dried at 40 ÷ 500C and powdered The powder (500 g) was extracted with ... ml of saline (for virus control and cell control) and given ml 2x MEM The cells were incubated for 72 hours and observed for cytopathic effects from the virus and cytotoxic effects from the samples ... MeOH 900 at 800C The extract was filtered and concentrated in vacuo to yield 84 g extract The concentrated extract was fractionated into Hexan, EtOAc, BuOH, and H2O-soluble fractions, sequentially...
Ngày tải lên: 03/04/2014, 15:20
fattorusso - modern alkaloids - structure, isolation, synthesis and biology (wiley, 2008)
... Glycosidase-Inhibiting Alkaloids: Isolation, Structure, and Application 111 Naoki Asano Introduction 111 Isolation and Structural Characterization 111 Deoxynojirimycin and Related Compounds 112 Isolation from Morus ... microbes and against desiccation; formation of a thick bark in roots and stems against water loss, microbes, and herbivores; development of spines, thorns, hooks, trichomes, and glandular and ... spp (Moraceae) 112 Isolation from Thai Medicinal Plants ‘‘Thopthaep’’ and ‘‘Cha Em Thai’’ 113 a-Homonojirimycin and Related Compounds 115 Isolation from Garden Plants 115 Isolation from the Thai...
Ngày tải lên: 04/06/2014, 15:25
Báo cáo sinh học: " Virus detection and identification using random multiplex (RT)-PCR with 3''''-locked random primers" docx
... detection and identification based on random multiplex (RT)-PCR using 3'-locked random primers to avoid primer-dimer amplification Once detected, virus amplification products can be shot-gun cloned and ... ctcagtctggttggtgaggttgaag 26523 Figure PCR Screening and Sequencing of Randomly Amplified Adenovirus Type 17 DNA PCR Screening and Sequencing of Randomly Amplified Adenovirus Type 17 DNA Randomly amplified DNA from Adenovirus ... 2.1 Sequence of Randomly Amplified DNA Multi-Cloning Site C Figure PCR Screening and Sequencing of Randomly Amplified Coxsackie Virus A7 cDNA PCR Screening and Sequencing of Randomly Amplified...
Ngày tải lên: 18/06/2014, 18:20
Báo cáo sinh học: "Pox proteomics: mass spectrometry analysis and identification of Vaccinia virion proteins" pot
... SDS and Triton X100 can greatly interfere with HPLC and mass spectrometric analysis [8] We tested the efficiency of OG in separating the virion components and found that the supernatant and pellet ... proteins (E6R and L3L) has not been described previously The peptides detected for each of these proteins are listed in Tables and The E6R ORF is situated between the E5R and E7R genes and produces ... E11L, G1L, G7L, H1L and J1R – all of which were identified in our analysis We also found membrane proteins (F9L, F10L, and E8R) and cytosolic proteins (A16L, E10R, F8L, G4L, and I3L) The remaining...
Ngày tải lên: 19/06/2014, 08:20
Báo cáo hóa học: " Virus detection and identification using random multiplex (RT)-PCR with 3''''-locked random primers" ppt
... detection and identification based on random multiplex (RT)-PCR using 3'-locked random primers to avoid primer-dimer amplification Once detected, virus amplification products can be shot-gun cloned and ... ctcagtctggttggtgaggttgaag 26523 Figure PCR Screening and Sequencing of Randomly Amplified Adenovirus Type 17 DNA PCR Screening and Sequencing of Randomly Amplified Adenovirus Type 17 DNA Randomly amplified DNA from Adenovirus ... 2.1 Sequence of Randomly Amplified DNA Multi-Cloning Site C Figure PCR Screening and Sequencing of Randomly Amplified Coxsackie Virus A7 cDNA PCR Screening and Sequencing of Randomly Amplified...
Ngày tải lên: 20/06/2014, 01:20
báo cáo hóa học:"Pox proteomics: mass spectrometry analysis and identification of Vaccinia virion proteins" docx
... SDS and Triton X100 can greatly interfere with HPLC and mass spectrometric analysis [8] We tested the efficiency of OG in separating the virion components and found that the supernatant and pellet ... proteins (E6R and L3L) has not been described previously The peptides detected for each of these proteins are listed in Tables and The E6R ORF is situated between the E5R and E7R genes and produces ... E11L, G1L, G7L, H1L and J1R – all of which were identified in our analysis We also found membrane proteins (F9L, F10L, and E8R) and cytosolic proteins (A16L, E10R, F8L, G4L, and I3L) The remaining...
Ngày tải lên: 20/06/2014, 04:20
báo cáo hóa học:" Characterization of the tumor marker muc16 (ca125) expressed by murine ovarian tumor cell lines and identification of a panel of cross-reactive monoclonal antibodies" docx
... conducted the RT-PCR and western blot ananlysis and was assisted in these experiments by JAB and JAAG MM and CR helped in designing appropriate Muc16 primers JC assisted in obtaining and maintaining ... Identification of soluble Muc16 and MUC16 by Western blotIdentification of soluble Muc16 and MUC16 by Western blotting Purified MUC16 (25 μg total protein/lane) from MOVCAR-2 (lane 1) and OVCAR-3 cells (lane ... human and murine forms of the mucin MUC16 is both expressed on the cell surface and shed from the cell in soluble forms Muc16, on the other hand, is detected primarily in the spent media and in...
Ngày tải lên: 20/06/2014, 07:20
Báo cáo hóa học: " Implications of GMO cultivation and monitoring-series" doc
... physiological and agronomic studies However, considerable gaps exist in the assessment of biodiversity effects, and how non-target organisms would be impacted by GM crop cultivation Landscape and regional ... Education and Research Received: 24 January 2011 Accepted: February 2011 Published: February 2011 doi:10.1186/2190-4715-23-2 Cite this article as: Schmidt and Schröder: Implications of GMO cultivation ... and Schröder: Implications of GMO cultivation and monitoring-series Environmental Sciences Europe 2011 23:2 Submit your manuscript to a journal and benefit from: Convenient online submission Rigorous...
Ngày tải lên: 21/06/2014, 06:20
Báo cáo nghiên cứu nông nghiệp " Isolation, inbreeding and relationships in forest trees " pdf
... Gympie, Queensland outcrossed selfed Forestry and Forest Products Inbreeding problems Petford Vietnam landrace Petford Rwanda landrace E camaldulensis: natural seed source vs local land race Australian ... Isolation, inbreeding and relationships in forest trees Phenotype Selection (seed orchards, seed prod areas) Forestry and Forest Products Why is selection ... source vs local land race Australian seedlot (collected from natural stand, one year younger) Vietnam land race Forestry and Forest Products Open-pollinated eucalypt family insects are the main...
Ngày tải lên: 22/06/2014, 13:20
Bạn có muốn tìm thêm với từ khóa: