modeling and identification of a direct drive robotic manipulator

Effect of injection timing on combustion and performance of a direct injection diesel engine running on Jatropha methyl ester

Effect of injection timing on combustion and performance of a direct injection diesel engine running on Jatropha methyl ester

... degrees, the peak rate of heat release is at 357 degree crank angle and on retarding by and degrees, the peak heat release rate is found at 362 and 363 degrees against 361 degree with standard timing ... development of biofuel, Planning commission, Government of India, 2003 S Jindal, B.P Nandwana, N.S Rathore Comparative evaluation of combustion, performance and emissions of Jatropha methyl ester and Karanj ... hydrocarbon (HC) and oxides of nitrogen (NOx) with exhaust gas opacity The software enables evaluation of performance from the acquired data using standard relationships The BTHE is evaluated...

Ngày tải lên: 05/09/2013, 16:11

10 829 1
Case Study in Financial Modeling and Simulation of a Forestry Investment potx

Case Study in Financial Modeling and Simulation of a Forestry Investment potx

... fire, pests and diseases, unsuitable species, collateral damage at harvest Forestry Risks  Timber return: inappropriate pruning and thinning, poor growth, timber usage and fashion changes  Sovereign ... can span a lifetime of over 50 years Cash Flow Structure General for Projects initial cash outlay inflows from sale of product Particular to Forestry long term maintenance timed on-going outlays:thinnings, ... pruning and thinning, fire and pest protection  Inflows:wood; commercial thinning, final harvest non-wood; flora gathering, recreation, land renewal  Required rate of return  Forest Yield Factors...

Ngày tải lên: 23/03/2014, 04:20

18 786 4
báo cáo hóa học:" Characterization of the tumor marker muc16 (ca125) expressed by murine ovarian tumor cell lines and identification of a panel of cross-reactive monoclonal antibodies" docx

báo cáo hóa học:" Characterization of the tumor marker muc16 (ca125) expressed by murine ovarian tumor cell lines and identification of a panel of cross-reactive monoclonal antibodies" docx

... primer pairs from Integrated DNA Technologies: Muc16 5'-TGCCACCTACCAGTTGAAAG-3' and 5'-GTACCGCCAAGCAGATGAG-3'; GAPDH 5'-TGCTGAGTATGTCGTGGAGTCTA-3' and 5'AGTGGGAGTTGCTGTTGAAGTCG-3' The amplified ... murine monoclonal antibodies that were initially generated against human MUC16 List of abbreviations EOC: epithelial ovarian cancer; ConA: Concanavalin A; αMe-Man: α-methylmannopyranoside Competing ... western blot ananlysis and was assisted in these experiments by JAB and JAAG MM and CR helped in designing appropriate Muc16 primers JC assisted in obtaining and maintaining murine ovarian tumor...

Ngày tải lên: 20/06/2014, 07:20

7 430 0
Báo cáo khoa học: " Isolation and identification of a canine coronavirus strain from giant pandas (Ailuropoda melanoleuca)" ppt

Báo cáo khoa học: " Isolation and identification of a canine coronavirus strain from giant pandas (Ailuropoda melanoleuca)" ppt

... isolation and identification of a potential viral pathogen was pursued Canine coronavirus was first isolated from a case of canine enteritis during an epizootic in Germany in 1971 Later, Woods and ... Hayek LA, Dubovi E, Zhang Z, Yan Q, Guo W, Wildt DE Serosurvey of ex situ giant pandas (Ailuropoda melanoleuca) and red pandas (Ailurus fulgens) in China with implications for species conservation ... total RNA was reverse transcribed to cDNA using avian myeloblastosis virus reverse transcriptase (TaKaRa, Japan) and oligo (dT) primers per the manufacturer’s recommendation The PCR detection was...

Ngày tải lên: 07/08/2014, 23:22

3 308 0
báo cáo khoa học: " Screening and Identification of a Renal Carcinoma Specific Peptide from a Phage Display Peptide Library" pot

báo cáo khoa học: " Screening and Identification of a Renal Carcinoma Specific Peptide from a Phage Display Peptide Library" pot

... potential for use in early diagnosis and targeted therapy of RCC Materials Renal carcinoma line A4 98 and a normal renal cell line HK-2 were obtained from Medical Academy of China (Beijing, PR China) ... Screening and Identification of a Renal Carcinoma Specific Peptide from a Phage Display Peptide Library Xiangan Tu1*§, Jintao Zhuang1*, Wenwei Wang1, Liang Zhao1, Liangyun Zhao1, Jiquan Zhao1, Chunhua ... cG250 and low dose subcutaneous IL-2 in patients with advanced renal cell carcinoma Cancer Immun, 2007, 7: 13 14 Xu C, Lo A, Yammanuru A, Tallarico AS, Brady K, Murakami A, Barteneva N, Zhu Q, Marasco...

Ngày tải lên: 10/08/2014, 10:21

28 266 0
Group 2 allergens from dust mite  epitope mapping and functional characterization of der p 2, and identification of a paralogue of der f 2

Group 2 allergens from dust mite epitope mapping and functional characterization of der p 2, and identification of a paralogue of der f 2

... Special thanks goes out to Sai Mun and Souvik for always giving me timely assistance and advice in so many areas of research Also to Shruthi, who has been of great assistance for databasing, and analysis ... Tan CL, Reginald K, Chew FT (2006) Genomic organization and characterization of group allergen paralogs from Dermatophagoides farinae In: The 63th American Academy of Allergy and Immunology Annual ... PCR with μg of genomic D farinae DNA using primers Df2F_3 (5’-ATGATTTCCAAAATCTTGTGC-3’) and Df2R_3 (5’-TTAATCACGCATTTTAGCGTG-3’) for Der f and DF975_MET (5’ATGAACCGATTCCTCATTGTT-3’) and EcoR1Df975R...

Ngày tải lên: 15/09/2015, 17:09

235 904 0
Modeling and control of hard disk drive in mobile applications

Modeling and control of hard disk drive in mobile applications

... consists of a pivot with a ball bearing, a metal arm, and a rigid suspension that holds the R/W head and slider To come up with devices that are smaller, cheaper and able to store more data and retrieve ... presents a fairly comprehensive modeling and compensation of pivot friction hysteresis nonlinearity of a typical VCM actuator used in commercial HDDs and a practical account of the application of an ... like to thanks to all my colleagues and friends in the Mechatronics and Automation Lab and the Edutainment Robotics Lab for their concerns and help Special thanks to all the staff and students...

Ngày tải lên: 16/10/2015, 15:38

130 563 0
Modeling and control of a heat gun

Modeling and control of a heat gun

... Heat Gun 18 (a) Air temperature of case (b) Air velocity of case (c) Air temperature of case (d) Air velocity of case (e) Air temperature of case (f) Air velocity of case (g) Air temperature of ... software which is used for simulation, visualization, and analysis of fluid flow, heat and mass transfer, and chemical reactions GAMBIT is a preprocessor for the CFD analysis GAMBIT allows fast ... pipe, additional heater coil and the heat recycle In Chapter 4, the models for different parts of the heat gun are analyzed, and some parameters of the heater materials are also provided Characteristics...

Ngày tải lên: 26/11/2015, 12:31

131 370 0
Modeling and simulation of a hybrid electric vehicle using MATLAB/Simulink and ADAMS

Modeling and simulation of a hybrid electric vehicle using MATLAB/Simulink and ADAMS

... Activating Mechanical Brakes The brake constant for this model is arbitrarily set as 200Nm, and can be modified if additional test data are available Modeling the mechanical brake interface with ... simulate the hybrid vehicle Comparison of simulation results obtained from the MATLAB/ADAMS simulation platform and ADVISOR will be presented Chapter will contain comparative analysis of hybrid and ... communication link for data transfer between the two softwares This Chapter will describe the software modeling in detail, and provide validation results of the MATLAB/ADAMS model against the ADVISOR...

Ngày tải lên: 27/01/2016, 13:02

100 805 3
Control of a macro mini robotic manipulator

Control of a macro mini robotic manipulator

... Macro-Mini manipulator system (b) Human arm and hand bone structure 16 2.2 Software model and parameters of Macro-Mini manipulator In order to conduct software simulations of Macro-Mini manipulator ... operation of the robot In a new design of manipulators, an additional rigid small robot (called the Mini manipulator) is attached at the end of the long reach manipulator (called the Macro manipulator) , ... possibilities of position/trajectory tracking control of Macro-Mini manipulator system, using the kinematics and dynamics of separate Macro and Mini manipulators, instead of that of the overall system...

Ngày tải lên: 03/10/2015, 21:56

110 260 0
Control of a macro mini robotic manipulator

Control of a macro mini robotic manipulator

... Macro-Mini manipulator system (b) Human arm and hand bone structure 16 2.2 Software model and parameters of Macro-Mini manipulator In order to conduct software simulations of Macro-Mini manipulator ... operation of the robot In a new design of manipulators, an additional rigid small robot (called the Mini manipulator) is attached at the end of the long reach manipulator (called the Macro manipulator) , ... possibilities of position/trajectory tracking control of Macro-Mini manipulator system, using the kinematics and dynamics of separate Macro and Mini manipulators, instead of that of the overall system...

Ngày tải lên: 04/10/2015, 07:58

110 259 0
Exergoeconomic optimization and improvement of a cogeneration system modeled in a process simulator using direct search and evolutionary methods

Exergoeconomic optimization and improvement of a cogeneration system modeled in a process simulator using direct search and evolutionary methods

... exergoeconomic analysis of the system at each iteration and on several qualitative and quantitative objective criteria, a hierarchical classification of the system components, and the associated subsets of ... Nelder and Mead A global analysis of Tables and reveals an important outcome: the method of Powell systematically leads to the smallest values of the objective function and of the number of simulator ... Holland J.H Adaptation in Natural and Artificial Systems The University of Michigan Press: Ann Arbor, 1975 Okamoto M., Nonaka T., Ochiai S., Tominaga D Nonlinear numerical optimization with use of...

Ngày tải lên: 05/09/2013, 16:30

14 594 0
báo cáo hóa học:" Identification of a public CDR3 motif and a biased utilization of T-cell receptor V beta and J beta chains in HLA-A2/Melan-A-specific T-cell clonotypes of melanoma patients" potx

báo cáo hóa học:" Identification of a public CDR3 motif and a biased utilization of T-cell receptor V beta and J beta chains in HLA-A2/Melan-A-specific T-cell clonotypes of melanoma patients" potx

... CTTGGC GCCAGCAG ATACCA GGGAC TAGGA 39 GCCTGGAGTGT C C CAGGG CTAGG NA XXXXXXAGT CAT CAGGG ATTGGG 16 GCCAGCA CCCT GACAGGG CTTGGA 6E4 GCCAGCAGTTT TCT 40 GCCAGCAGTTTA B/22 GCCAGCAGT C A .ACAGGG ... .CAGCCCCAGXX X .CAGCCCCAGCA T TTCACCCCT CCAC TCAGCCCCAGXX X TCAGCCCCAGXX X TCAGCCCCAGCA T .CAGCCCCAGCA T .CAGCCCCAGCA T .CAGCCCCAGCA T TCAGCCCCAGCA T CTATGGCTACXXX TCAGCCCCAGCA T not available tions 105, ... GCCAGCAG CCA .ACAGGGG CTCGG B/9 GCCAGCAGTTT TCA GGGAC TCGG aNucleotides 5' J region C GGG TTGGG CAGCCCCAGCA T .TATGGCTACACC .CAGCCCCAGCA T .CAGCCCCAGCA T .CAGCCCCAGXX X .CAGCCCCAGXX X .CAGCCCCAGCA...

Ngày tải lên: 18/06/2014, 15:20

14 532 1
Báo cáo hóa học: " Identification of a contemporary human parechovirus type 1 by VIDISCA and characterisation of its full genome" pdf

Báo cáo hóa học: " Identification of a contemporary human parechovirus type 1 by VIDISCA and characterisation of its full genome" pdf

... Microarray-based detection and genotyping of viral pathogens Proc Natl Acad Sci U S A 2002, 99:15687-15692 Allander T, Andreasson K, Gupta S, Bjerkner A, Bogdanovic G, Persson MA, Dalianis T, Ramqvist ... Isolation and identification of a novel human parechovirus J Gen Virol 2004, 85:391-398 Abed Y, Boivin G: Molecular characterization of a Canadian human parechovirus (HPeV)-3 isolate and its relationship ... linkers for the HinP1I-site (GACGATGAGTCCTGAT and Phosphate-CGATCAGGACTCAT, 1:1) and the CviII-site (CTCGTAGACTGCGTACG and Phosphate-ATCGTACGCAGTC, 1:1) were ligated to the complete phenol-purified...

Ngày tải lên: 20/06/2014, 01:20

10 432 0
báo cáo hóa học:" Identification and characterization of a spontaneous ovarian carcinoma in Lewis rats" docx

báo cáo hóa học:" Identification and characterization of a spontaneous ovarian carcinoma in Lewis rats" docx

... http://www.ovarianresearch.com/content/3/1/9 Page of Figure Gross and histologic examination of proband Intraperitoneal tumor arising spontaneously in a Lewis rat has pathologic appearance of an ovarian adenocarcinoma (A) Proband shows ... Identification and characterization of a spontaneous ovarian carcinoma in Lewis rats Journal of Ovarian Research 2010 3:9 Page of Submit your next manuscript to BioMed Central and take full advantage ... metastasis and clinicopathological characteristics in human ovarian carcinoma Acta Histochemica 2008, 110:59-65 37 Balachandran R, Welsh MJ, Day BW: Altered levels and regulation of stathmin in paclitaxel-resistant...

Ngày tải lên: 20/06/2014, 07:20

8 441 0
Báo cáo hóa học: "An Artificial Intelligence Approach for Modeling and Prediction of Water Diffusion Inside a Carbon Nanotube'''' potx

Báo cáo hóa học: "An Artificial Intelligence Approach for Modeling and Prediction of Water Diffusion Inside a Carbon Nanotube'''' potx

... using an appropriate transformation method It has been reported that the ANFIS systems trained on transformed data sets achieve better performance and faster convergence in general There are many ... order of several days with the aid of a supercomputer However, a designed ANFIS can be run on a normal personal computer An ANFIS ignores a relatively large amount of noise or variations in solving ... which has the following equation [23]: ztrn ¼ a log10 ðtrn þ bÞ zchk ¼ a log10 ðchk þ bÞ where ztrn and zchk are the transformed values of the training and checking data sets, a is an arbitrary...

Ngày tải lên: 21/06/2014, 20:20

5 424 0
Báo cáo hóa học: " Research Article A Framework for System-Level Modeling and Simulation of Embedded Systems Architectures" ppt

Báo cáo hóa học: " Research Article A Framework for System-Level Modeling and Simulation of Embedded Systems Architectures" ppt

... layer, architecture model layer, and the mapping layer which is an interface between application and architecture models THE SESAME APPROACH The Sesame modeling and simulation environment facilitates ... well as that of SCPEx) differs from the popular SystemC language in a number of important aspects Pearl, implementing the messagepassing mechanism, abstracts away the concept of ports and Cagkan ... communication, issues such as synchronization and contention on the shared resources are also captured in the architectural modeling To realize trace-driven cosimulation of application and architecture...

Ngày tải lên: 22/06/2014, 19:20

11 400 0
Báo cáo y học: "The identification and characterization of a novel protein, c19orf10, in the synovium" docx

Báo cáo y học: "The identification and characterization of a novel protein, c19orf10, in the synovium" docx

... the maintenance of synovial inflammation, aggravating the destruction of cartilage and bone and stimulating the development of the pannus Because FLSs can exhibit significant phenotypic changes ... tissue.(b) Intense staining of the synovial lining layer and perivascular regions of OA (paraffin section) tissue (c) An area demonstrating a thin lining layer and perivascular region populated with c19orf10-positive ... Diego, CA, USA), resulting in a glutathione S transferase (GST)-His-c19orf10 fusion gene Primers Orf10NdeI (gaattccatatGGTGTCCGAGCCCACGA) and Orf10R2 (catggctcgagcAGCTCAGTGCGCGAT) were used to amplify...

Ngày tải lên: 09/08/2014, 10:20

9 490 0
Báo cáo y học: " Identification of a novel linear B-cell epitope in the UL26 and UL26.5 proteins of Duck Enteritis Virus" doc

Báo cáo y học: " Identification of a novel linear B-cell epitope in the UL26 and UL26.5 proteins of Duck Enteritis Virus" doc

... TGCAGGGATCCATGCAGTTAGATGGTGACAAT CTTTGGTCGACTTATTCCCCCGGATAATAGAT 1540-1575 36 F7 TGCAGGGATCCATGTTAGATGGTGACAATATC CTTTGGTCGACTTATTCCCCCGGATAATAGAT 1543-1575 33 F8 TGCAGGGATCCATGGATGGTGACAATATCTAT ... CTTTGGTCGACTTATTCCCCCGGATAATAGAT 1552-1575 24 F11 TGCAGGGATCCATGAATATCTATTATCCGGGG CTTTGGTCGACTTATTCCCCCGGATAATAGAT 1555-1575 21 F12 F13 TGCAGGGATCCATGATCTATTATCCGGGGGAA CTTTGGTCGACTTATTCCCCCGGATAATAGAT GATCCATGATCTATTATCCGGGGTAAG ... GTCGACTTACAGCTGCCCTCCCTGGAC 1042-1347 306 F2 GGATCCATGTATGGACAGCCTGTTTAT GTCGACTTAAGCTAATGGTCCAGTAGA 1294-1731 438 F3 GGATCCATGCCTACTGGACAAGGTAAC GTCGACTCAACATCTATTACACATCA 1681-2124 444 F2-1 GGATCCATGTATGGACAGCCTGTTTAT...

Ngày tải lên: 12/08/2014, 01:21

9 450 0
w