isolate a leak during leak test procedure number 1
Báo cáo y học: " Determinants of the cuff-leak test: a physiological study" ppsx
... 10 .8 15 .0 0.58 11 .6 28.0 13 .8 18 .5 0.62 8.5 51. 2 13 .4 15 .1 10 0.60 13 .5 32.2 13 .3 17 .3 11 0.66 9.8 56 .1 8.5 12 .8 12 0.58 10 .4 17 .7 9.6 22.8 13 0. 51 13.0 37.6 9.0 14 .0 14 0.56 16 .0 43.9 6.7 13 .3 15 ... 50 C = 10 0 C = 20 C = 50 C = 10 0 C = 20 C = 50 C = 10 0 Leakpause (ml) 96 ± 99 ± 96 ± 10 5 ± 10 10 3 ± 11 11 0 ± 12 3 ± 12 c 11 5 ± 11 8 ± 12 c Leakconv (ml) 275 ± 1 1a 257 ± 245 ± 278 ± 6ab 2 61 ± 10 253 ... study, evaluated the data and drafted the manuscript All authors read and approved the final manuscript References 10 11 12 13 14 15 16 R 31 Darmon JY, Rauss A, Dreyfuss D, Bleichner G, Elkharrat D,...
- 8
- 321
- 0
Báo cáo y học: "The cuff-leak test: what are we measuring" pps
... operative 11 0 ml 0/96 (0) De Backer [5] 76 Mixed 15 .5% 75/72 10 (80) Jaber [11 ] 11 2 Mixed 11 0 ml (or 12 %) 85/95 13 (n .a. ) Maury [12 ] 11 5 Medical n .a 10 0/98 (10 0) n .a. , not applicable after deflation ... Stridor/reintubation, N (% of positive tests) n .a 10 0/85 n .a Fisher [8] 62 Upper airway obstruction Sandhu [9] 11 0 Trauma 11 .7% n .a. /98 14 (n .a. ) Miller [10 ] 11 0 At risk 11 0 ml 83/99 (n .a. ) Engoren ... expiratory and total leak was constant (around one-third to one-quarter of the total leak) whatever the value of the leak, this suggests that factors affecting expiratory leak would similarly affect...
- 3
- 297
- 0
EVALUATING a FINAL ENGLISH READING TEST FOR THE STUDENTS AT HANOI, TECHNICAL AND PROFESSIONAL SKILLS TRAINING SCHOOL – HANOI CON
... structuralist approach 1. 1 .1. 3 The integrative approach 1. 1 .1. 4 The communicative approach 1. 1.2 Classifications of Language Tests 1. 2 Testing reading 10 1. 3 Criteria in evaluating a test 13 1. 3 .1 ... The organization of the study PART TWO: DEVELOPMENT CHAPTER 1: LITERATURE REVIEW 1. 1 Language testing 1. 1 .1 Approaches to language testing 6 1. 1 .1. 1 The essay translation approach 1. 1 .1. 2 The ... testing reading as well as some literature to the test evaluation will be reviewed 1. 1 Language testing 1. 1 .1 Approaches to language testing 1. 1 .1. 1 The essay translation approach According to Heaton...
- 60
- 718
- 1
Tài liệu Báo cáo khoa học: Differential expression of duplicated LDH-A genes during temperature acclimation of weatherfish Misgurnus fossilis Functional consequences for the enzyme ppt
... GACTACTTTGGAGTTTGCGGTCAC AGTTGGGCATTCATCCATCC CAGAAAAAGACAAGGAGGAC ACAACACCACTGCTGCGGAGTTA ACATCAAGGAGCGTTAGAATCTAA GATTTAAGTGGAGCGGAATGCTA TGTGAAACGCAGTCTCTTCC CAAGGAGCGTTAGAATCTAAAG TCTCCAAACCAGATCTCTACAG ... forward forward forward reverse reverse forward reverse forward reverse Name PCR product length (bp) GTGGACGTGATGGAGGATAAG GAAGGCACGCTGAGGAAGAC GGATGAATGCCCAACTTCTCCC ACGAAACCTGGCAGAGTCCAAG GACTACTTTGGAGTTTGCGGTCAC ... TCTCCAAACCAGATCTCTACAG GATTTAAGTGGAGCGGAATGCTA A1 F A1 R B13R B6R B1R F13R F19R J1F J2R J3R H1F H1R H2F H2R 728 (with A1 F and A1 R) in the functional properties of tetrameric LDH -A via long-range structural effects...
- 11
- 662
- 0
Evaluation of a reproductive health awareness program for adolescence in urban Tanzania-A quasi-experimental pre-test post-test research pptx
... 15 3 girls and 15 2 boys Girls’ ages ranging from 11 to 12 was 49.7%; 13 years old was 39.2%; and age 14 to 16 was 11 .1% The mean age for girls was 12 .5 (SD = 0.9) Boys’ ages ranging from age 11 ... health matters based on literature review The questionnaire was translated to Kiswahili as a language familiar to most Tanzanians Data was gathered by an anonymous questionnaire The knowledge test ... material and small group discussion This program is a feasible program for other areas in Tanzania Program evaluation Gallant and Maticka-Tydale compared reproductive health education programs applying...
- 9
- 580
- 0
Báo cáo hóa học: " Research Article Evaluation of Cross-Layer Rate-Aware Routing in a Wireless Mesh Network Test Bed" pdf
... parameters using the raw transmission rate as a metric will always give better performances than using the simple hop-count metric [11 ] [12 ] [13 ] [14 ] [15 ] [16 ] [17 ] [18 ] [19 ] [20] [ 21] ACKNOWLEDGMENT ... IPv4 packets, thus we developed a small software translating DNS queries from IPv4 to IPv6 L Iannone et al S08 S10 S02 S09 S12 C01S S 11 S08 S10 S12 S03 S02 S09 S04 S05 S06 C01S S 11 S03 S04 S 01 S06 ... Network Address Translator (Traditional NAT),” RFC 3022, January 20 01 C Perkins, E Belding-Royer, and S Das, “Ad hoc on demand distance vector (aodv) routing,” RFC 35 61, July 2003 T Clausen and P Jacquet,...
- 10
- 344
- 0
Báo cáo hóa học: " A New Method for Estimating the Number of Harmonic Components in Noise with Application in High Resolution Radar" pdf
... Resolution Algorithms 11 79 Autocorrelation matrix eigenvalues Autocorrelation matrix eigenvalues 3.5 2.5 1. 5 0.5 6 10 11 k 10 11 k (a) (b) Figure 1: Variation of the autocorrelation matrix eigenvalues ... thesis, Stanford University, Stanford, Calif, USA, 19 81 [3] A Paulraj, R Roy, and T Kailath, A subspace rotation approach to signal parameter estimation,” Proc IEEE, vol 74, no 7, pp 10 44 10 45, 19 86 ... are, the larger is the dynamic range ∆ 1 The eigenvalue variation is not necessarily linear, but the results obtained in this case can be generalized This type of variation has also the advantage...
- 12
- 409
- 0
A FORTY-FIVE MINUTE TEST TEACHER’S EVALUATION ppt
... Korean ones However, many folk villages and museums across the country regularly perform ceremonies to (17 ) …… the traditions alive 13 A soon 14 A control 15 A Although 16 A traditional 17 A catch ... look D raise 22 Mr Jackson’s behavior and comments on occasions were inappropriate and fell below the standards A accept B acceptable C acceptance D accepting 23 – “What an attractive hair style ... at someone A point B smile C look D raise 12 Mr Jackson’s behavior and comments on occasions were inappropriate and fell below the standards A accept B acceptable C acceptance D accepting 13 ...
- 12
- 354
- 1
Báo cáo toán học: "A Note on Two Multicolor Ramsey Number" doc
... 1 0 0 the electronic journal of combinatorics 12 (2005), #N14 21 11 11 21 16 22 10 15 17 25 26 12 13 20 13 23 19 19 14 24 26 18 10 14 18 16 23 17 20 12 24 15 25 22 Figure 2: The graphs with adjacency ... Ramsey number survey [3] we also know that 18 ≤ R4 (C4 ) ≤ 21 It was shown by Clapham, Flockhart and Sheehan [1] that a C4 -free graph with 19 vertices has at most 42 edges Since · 42 = 16 8 and ... M1 = X X X X X ¯ M2 = Y Y Y Y Y ¯ X X X X X ¯ Y Y Y Y ¯ ¯T ¯T ¯T ¯T ¯T ¯T ¯T ¯T ¯T ¯T 0 0 0 0 21 16 16 17 12 11 22 11 21 10 15 20 25 13 18 23 24 26 13 18 23 19 14 ...
- 3
- 290
- 0
Báo cáo khoa học: "Evaluation of a Bacillus stearothermophilus tube test as a screening tool for anticoccidial residues in poultry" doc
... 1G 1G 1G 1G 1G 1G 1G 1G 1G 1G 1G 1G 1G 1G 1G 1G 66-GB remirP 1F 1F 1F 1F 1F 1F 1F 1F 1F 1F 1F 1F 1F 1F 1F 1F 1F 4F 4F 4F 1F 5F 4F 4F 4F 1F 4F 1F 1F 3F 1F 2F 1F 1F 1F 1F 1F 1F 1F 1F 1F 1F 1F 1F ... 01 1E 1D 1C 1B 1A mutups namuH 49/3 91 1E 1D 1C 1B 1A mutups namuH 49/7 91 1E 1D 1C 1B 1A mutups namuH 49/9 91 1E 1D 1C 1B 4A mutups namuH 49 /19 1 1E 1D 1C 2B 3A mutups namuH 89/083 1E 1D 1C 1B 2A ... .selpmas eniws dna enivob morf hcae niarts dna )TD-TM dna vR73H( sniarts ecnerefer ,aidnI ,yllieraB ,latipsoH 1G 1G 1G 1G 1G 1G 1G 1G 1G 1G 1G 1G 1G 1G 1G 1G 1G 2G 4G 1G 1G 3G 1G 1G 1G 2G 2G 1G 1G...
- 7
- 323
- 0
Báo cáo toán học: "A Note on Divisibility of the Number of Matchings of a Family of Graphs" ppt
... arrangements on a quadratic lattice, Physica, 27, (19 61) , 12 09 -12 25 [3] H N V Temperley and M E Fisher, Dimer problem in statistical mechanics – an exact result, Phil Mag., 6, (19 61) , 10 61- 1063 [4] ... claim that each of the equivalence classes under R has n +1 n +1 cardinality Thus, the total number of perfect matchings is a multiple of n +1 It remains only to prove the claim that each equivalence ... Kuperberg, M Larsen, and J Propp, Alternating sign matrices and domino tilings, J Algebraic Combin., 1, (19 92), 11 1 -13 2 and 219 -234 [5] G Kuperberg, Symmetries of plane partitions and the permanent-determinant...
- 4
- 344
- 0
Báo cáo khoa học: "Circadian variations in salivary chromogranin a concentrations during a 24-hour period in dogs" pps
... Organs 2005, 18 0, 237-244 Sato F, Kanno T, Nagasawa S, Yanaihara N, Ishida N, Hasegawa T, Iwanaga T Immunohistochemical localization of chromogranin A in the acinar cells of equine salivary glands ... Metab Res 2003, 35, 355-357 Nakane H, Asami O, Yamada Y, Harada T, Matsui N, Kanno T, Yanaihara N Salivary chromogranin A as an index of psychosomatic stress response Biomed Res 19 98, 19 , 4 01- 406 ... 422 Kazutaka Kanai et al were measured using a Human CgA enzyme-linked immunosorbent assay kit (Yanaihara Institute, Japan) All samples were analyzed in duplicate Salivary CgA concentrations...
- 3
- 317
- 0
Báo cáo lâm nghiệp: "Genetic variation of wood density components in a radiata pine progeny test located in the south of Chile" pps
... [10 ] For example, Vargas-Hernandez [34] observed that area weighted ED and LD increased with cambial age in 60 families of coastal Douglas-fir that were analyzed at age 15 A similar pattern was ... increase outwards Figure Changes in family mean values for within ring area components with cambial age (A) EA; (B) LA All family mean values for EA increased after ring and reached a plateau between ... differences among traits and allowed reliable comparisons of family covariances among different traits Covariance components, for each cambial age and transformed (standardized) traits, were also estimated...
- 10
- 341
- 0
Báo cáo toán học: "A new bound on the domination number of graphs with minimum degree two" docx
... Discrete Math 254 (2002), 17 5– 18 9 [8] K Kawarabayashi, M D Plummer, and A Saito, Domination in a graph with a 2-factor J Graph Theory 52 (2006), 1 6 [9] A V Kostochka and B Y Stodolsky, On domination ... Let G1 be a component of G′ and let X1 = X ∩ V (G1 ) Claim N If γ(G1 ; X1 ) > ψ(G1 ; X1 ), then G′ = G1 Proof Suppose that γ(G1 ; X1 ) > ψ(G1 ; X1 ) and G′ = G1 Then, G′ contains at least two ... J Graph Theory 13 (19 89), 749–762 [13 ] M Molloy and B Reed, The dominating number of a random cubic graph Random Structures Algorithms (19 95), 209–2 21 [14 ] B A Reed, Paths, stars and the number...
- 35
- 259
- 0
Báo cáo khao học: "Genetic trends in wood density and radial growth with cambial age in a radiata pine progeny test" ppt
... Heritability ARD TRW RA Number 0.35 Fc P-value Fc P-value Fc P-value 0.30 10 11 12 13 14 0.25 0.20 0 .15 0 .10 0.05 0.00 10 11 12 13 2.75 1. 76 1. 52 0.98 1. 06 1. 12 1. 01 1.54 1. 47 1. 38 2. 21 1.09 1. 54 0.0 01 ... 24 21 18 15 12 3 10 11 12 13 14 Ring number from pith 3 .1 Means Figures 1a, 1b and 1c show changes in average value through cambial age for TRW, RA, and ARD, respectively (including all data and ... 0 .13 5 0 .11 7 0.083 0.0 01 0.0 01 1.82 1. 65 1. 50 1. 31 1.52 1. 31 1. 21 1.40 1. 22 1. 33 1. 32 1. 88 2 .17 0. 013 0.033 0.070 0 .15 8 0.063 0 .15 9 0.240 0 .10 7 0.228 0 .14 7 0 .15 5 0. 010 0.002 14 Ring number from...
- 10
- 329
- 0
Báo cáo khoa học: "A colliding maxillary sinus cancer of adenosquamous carcinoma and small cell neuroendocrine carcinoma - a case report with EGFR copy number analysis" pot
... the final manuscript Page of 10 11 12 13 14 15 16 Noske A, Pahl S: Combined adenosquamous and large-cell neuroendocrine carcinoma of the gallbladder Virchows Arch 2006, 449 :13 5 -13 6 Yazawa T, Ishii ... neuroendocrine carcinoma Ear Nose Throat J 2004, 83:530-532 Alos L, Castillo M, Nadal A, Caballero M, Mallofre C, Palacin A, Cardesa A: Adenosquamous Carcinoma of the head and neck: criteria for diagnosis ... JE, Campanella RS, Block LJ: Small cell carcinoma of the nose and paranasal sinuses Otolaryngol Head Neck Surg 19 82, 90: 516 - 517 Avitia S, Osborne RF: Blindness: a sequela of sinonasal small cell...
- 5
- 342
- 0
Báo cáo y học: " Does a positive anti-CCP test identify a distinct arthritis entity" docx
... presentation, although the average antibody levels decrease after diagnosis, probably due to medication [9 -11 ] The lower prevalence rates recorded in incident population-based materials of very early arthritis ... regarding the degree of synovitis and joint destruction One-half of the patient population was initially treated with analgesics followed by antimalarials or sulfasalazine if the initial treatment ... population At a diagnostic sensitivity equal to agglutinating RF, the secondgeneration anti-CCP2 assays detect ACPA of the IgG class with a superior diagnostic specificity for RA Studies on patients...
- 3
- 312
- 0
báo cáo khoa học: "Experimental comparison of methods for simultaneous selection of two correlated traits in Tribolium. 2. Index selection and independent culling levels : a replicated single generation test" potx
... the advantages of minimal record maintenance and animal handling increase its attraction On the other hand, the arbitrary culling levels sometimes applied can be very far from the optimum values ... population were obtained by analysis of variancecovariance of full-sib families The expected response to selection for each trait separately (AG AG and ,) I2 for tht AMPO ODRIGUEZ aggregate genotype ... for adult weight than for egg laying was consistent with the variation found in the base population for each trait The coefficients of variation of these mean values were about p 10 0 and 12 p 10 0...
- 9
- 249
- 0
Báo cáo y học: "A cross-sectional study of the number and frequency of terms used to refer to knowledge translation in a body of health literature in 2006: a Tower of Babel?" pps
... studies 10 Patient educational and clinician educational material Each article in the database was classified as being about KT or not about KT An example of a KT paper is one by Shojana and colleagues ... 2007) Sample size calculations based on data from Yao and colleagues [ 21] showed that a database with approximately 11 0 to 15 0 articles classified as being KT is needed to build and validate effective ... Journal 2004, 21( 3) :14 8 -16 3 17 Shojania KG, Fletcher KE, Saint S: Graduate medical education and patient safety: a busy–and occasionally hazardous–intersection Annals of Internal Medicine 2006, 14 5(8):592-598...
- 11
- 598
- 0
Báo cáo y học: "Sudden deterioration due to intra-tumoral hemorrhage of ependymoma of the fourth ventricle in a child during a flight: a case report" pps
... infants and young children Pediatrics 19 92, 90:385-3 91 10 Federal Aviation Administration: Allowable carbon dioxide concentration in transport category airplane cabins [http:// www.airweb.faa.gov/Regulatory_and_Guidance_Library/rgNPRM.nsf/ ... sinuses At a cabin pressure of 575 mmHg, gas expands to 13 2% of its baseline volume at sea level [10 ] Expansion of intestinal gas may have brought about a mild elevation of intra-abdominal pressure ... revealed an anaplastic ependymoma Our patient was seen by our pediatric oncologist for adjuvant chemotherapy Six months later, he underwent standard cranial Figure Brain magnetic resonance imaging...
- 4
- 352
- 0
Tìm thêm: xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến tốc độ rôto n fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25