ions in a solution near an electrode

... Albert Narath, Lockheed Martin Corporation (retired), Venkatesh Narayanamurti, Harvard University, V Adrian Parsegian, National Institutes of Health, Julia Phillips, Sandia National Laboratories, ... Materials New Tools for Observation in the Quantum Regime Manipulating Atoms and Electrons New Materials Artificial Nanoscale Structures Quantum Information and the Engineering of Entangled States ... mechanical state with a high probability of spatial overlap and entanglement Quantum overlap can sometimes extend over distances very large compared to a single atom, as in gaseous Bose-Einstein...

Ngày tải lên: 12/02/2014, 16:20

... in attracting investors •  hile appreciating its political and economic stability, few regard Canada as W offering a strong entrepreneurial culture Non-Canadian respondents ranked Canada a respectable ... investment destinations cited by both non-Canadian and Canadian respondents in our survey Table 4: Top five investment destinations FDI inflow in 2010: UNCTAD report Non-Canadians in Economist Intelligence ... survey 2011 Canadians in Economist Intelligence Unit survey 2011 US China Canada China India US Hong Kong SAR US China Belgium Canada India Brazil Vietnam Brazil Source: UNCTAD; Economist Intelligence...

Ngày tải lên: 08/03/2014, 06:20

... conclude that an ambulating patient with an above knee amputation and a subcapital fracture should be operated on after appropriate planning and preparation with satisfactory results A patient can return ... lever arm, and the patient was treated nonoperatively Two studies[4,6] have shown that this an appropriate strategy for most fractures after an amputation, except displaced intertrochanteric and ... Journal of Orthopaedic Surgery and Research 2009, 4:30 http://www.josr-online.com/content/4/1/30 Figure An anteroposterior (a) and lateral (b) xrays of the fracture An anteroposterior (a) and lateral...

Ngày tải lên: 20/06/2014, 04:20

... implementation of such an approach has limitations in that it requires a substantial (and continuing) investment in quality control, training and access to a central facility The validity and reliability of ... health care system, social environment, hospital settings and culture to be similar enough that it is acceptable to pool data in Scandinavia Admission data from the nine participating Scandinavian ... Claesson and Svensson [36] used the rank-invariant statistical method and suggested a scale reduced to four categories, as did also Heinemann and coworkers using Rasch analysis RSM [37] Thus, a...

Ngày tải lên: 20/06/2014, 15:20

... human insulin (56 U/ml; normal value,

Ngày tải lên: 11/08/2014, 21:22

... 2001) Apart from facilitating crystal growth via the incorporation of phosphoserine and aspartic acid, these nucleations were also initiated by concentrating the inorganic cations to local supersaturation ... California, USA) Upon saturating the atmosphere with argon gas (Soxal, Singapore), plasma was generated at 30 W and maintained for a desired period A thin layer of 1.5 mg / mL neutral bovine collagen ... Extracted basement membrane revealed an architecture consisting of 70 nm wide nanopores as well as a felt-like landscape with peaks and valleys approximately 100 nm in height and depth Various aspects...

Ngày tải lên: 11/09/2015, 16:04

... musculoskeletal, cardiovascular, gastrointestinal, neurological and urological disorders Polypharmacy is associated with increases in drug-drug interactions, adverse drug reactions, disease-drug interactions ... by DM and AB Authors’ information Ashis Banerjee has been a consultant in emergency medicine in London for the preceding 16 years, and is lead clinician at Chase Farm Hospital and honorary senior ... channel blockers Although warfarin is used in a significant number of elderly patients, we were unable to find any drug combinations leading to potential adverse interaction with warfarin usage...

Ngày tải lên: 21/06/2014, 03:20

... Relief-Web (a media and NGO repository maintained by the Office for the Coordination of Humanitarian Affairs), the Uppsala Conflict Database Program (a database that contains information on armed conflicts ... recommendations of the Standardized Monitoring and Assessment of Relief and Transition (SMART) initiative and seek studies of high quality [3] You will ask a support team in the capital, Kinshasa – ... census data that can provide region-specific demographic and mortality data However, in many settings affected by conflict, populations are displaced, census data is out-of-date and Health Information...

Ngày tải lên: 25/10/2012, 10:31

... institutional and departmental resources Abbreviations ACC: American College of Cardiology; AHA: American Heart Association; CABG: coronary artery binding graft; CK: creatine kinase; MACE: major adverse ... SES and PES cohorts A P value < 0.05 was considered statistically significant RESULTS Baseline clinical, angiographic, and lesion characteristics are shown in Tables and The baseline clinical ... similar according to the modified ACC/AHA (American College of Cardiology/American Heart Association) classification.22 Overall, most lesions were located in the left anterior descending artery and...

Ngày tải lên: 26/10/2012, 08:57

... formalin and embedded in paraffin wax The sections were stained routinely with haematoxylin and eosin (H&E) Selected sections were stained with high iron diamine (HID)/Alcian blue and periodic acid ... Figure 4-20% gradient SDS-PAGE of purified mucin stained for protein (Lanes 1-3) or carbohydrate (Lanes and 4) Lane 1: Molecular Weight marker Lane and Lane Purified mucin Lanes and 5, mucin reduced ... time an amino acid analysis has been done of purified mucin in an ovarian teratoma The observation that this ovarian teratoma produced a highly viscous mucus secretion in which the mucin was largely...

Ngày tải lên: 26/10/2012, 10:03

... Enhancing Performance of Solar air heater Proceedings of XVII National and VI ISHME/ASME Heat and Mass Transfer Conference, IGCAR, Kalpakkam India 2004; Jan 05-07 [2] Han J C “Heat transfer and ... Tariq, A. , Keshav Kant and Panigrahi, P K., “Heat transfer enhancement using an internally threaded tube”, Proceeding of the 4th ISHMT-ASME and 15th National Conference on Heat and Mass transfer ... reasonable accuracy In a recent study, Cho et al [12] investigated the effect of a gap in the inclined rib on heat transfer in a square duct and reported that a gap in the inclined rib accelerates...

Ngày tải lên: 05/09/2013, 16:10

... containing the image from the database Create a SQL statement to retrieve the required image from the database and retrieve the image using a DataReader A DataTable or DataSet filled using a DataAdapter ... shown in Example 7-15 Example 7-15 File: ADOCookbookCS0707b.aspx.cs // Namespaces, variables, and constants using System; using System.Configuration; using System.Data; using System.Data.SqlClient; ... the image as a binary stream The BinaryWrite( ) method of the HttpResponse object writes a stream of binary characters to the HTTP output stream rather than a textual stream Response.BinaryWrite((byte[])dr["Photo"]);...

Ngày tải lên: 28/10/2013, 18:15

... CurrencyManager notifies all data-bound controls if the current item changes so that they can refresh their data The PropertyManager class inherits from the BindingManagerBase class and maintains ... BindingManagerBase object and either a CurrencyManager or PropertyManager object is returned depending on the type of data source: • • The CurrencyManager class inherits from the BindingManagerBase ... that are bound to the same data source so that they display information from the object within the data source, such as a row in a DataTable The BindingContext class is used to instantiate a BindingManagerBase...

Ngày tải lên: 28/10/2013, 18:15

... find another tap and having to use a long hose which may, anyway, not fit the shape of some taps Simpler than playing around with washing machine hoses Procedure: 1)Squeeze the single mixer tap ... A Further method was sent in by a user, Dave Maynard: When needing to pass mains cold water pressure across to air locked hot water supply using kitchen mixer taps: Easier than trying to find ... non-mains pressured COLD supply i.e also fed from a header tank and which also has an airlock: Same as just described but this time you need to use the mains pressured water to purge the non-mains...

Ngày tải lên: 17/12/2013, 10:45

... dynamic data upon request Access to data that is stored anywhere and on Access to data that is stored anywhere and on any platform any platform " Ability to easily create business logic " Ability ... module review and a tool to help students prepare for the final module and lab, where they analyze a new trading partner integration scenario and create a B2B design plan Lab: Integrating XML Web ... For example, an XML Web service can provide you with a tax rate based on a price that you supply and can also gather the latest currency exchange rates ! Access to data anywhere, on any platform...

Ngày tải lên: 17/01/2014, 08:20

... N-terminus was obtained by PCR from the plasmid pET21 SIC1 [32] with a forward primer (5Â-TAC CTGGCCAATGAATATGCATCATCATCATCATCATA CTCCGTCGACCCCACC-3Â) designed to introduce a hexahistidine tag and ... hexahistidine tag was obtained by PCR using the pET2 1a PNT-H6 plasmid [30] as the template The forward primer (5Â-TACCGTTAACATCGATATGCATCATCATC ATCATCATGC-3Â) was designed to insert a ClaI restriction ... because isolated NTAIL is less extended than isolated PNT The structural disorder and exibility typical of isolated NTAIL is maintained and appears to increase in the fusion, resulting in a Stokes...

Ngày tải lên: 18/02/2014, 04:20

... by silver staining (lane 6) or immunoblotting using an antibody against subunit c1 (lanes and 8) or subunit c2 ⁄ (lane 9) The antibody against c2 ⁄ also reacts with c1 2000 FEBS Journal 275 (2008) ... 1-palmitoyl-2-oleyl-sn-glycero-3-phosphocholine (Avanti Polar Lipids Inc., Alabaster, AL, USA) at lipid-toprotein ratios of 0.5, 1.0 and 1.5 w ⁄ w The mixture was dialyzed in 50 lL buttons (Hampton Research, Aliso Viejo, CA, USA) against ... to be invariable as all the enzymes analyzed so far have a a3b3 (F1F0) or A3 B3 (A1 A0, V1V0) stoichiometry [28] The uncertainty lay in the number of ion-translocating subunits in the membrane-embedded...

Ngày tải lên: 18/02/2014, 17:20

... 5¢-d(TCAGAAATTAAAGCGG ATGCATTATTTGCATG)-3¢ The upstream primer containing the NdeI restriction site (underlined) was: 5¢-d(GCTAGCATATGAAGCTTAAA AAAATTG)-3¢ and the downstream primer containing the ... Gly261 to Ala, upper primer 5¢-d(CAAATAGATTGGGCTGGCCATG CAAATAAT)-3¢, lower primer 5¢-d(TATTTGCATGGCC AGCCCAATCTATTTGAG)-3¢; Gly262 to Ala, upper primer 5¢-d(ATAGATTGGGGTGCCCATGCAAATAA TGCA)-3¢, ... Kinetic studies of wild-type and mutant alkaline phosphatases (A) Temperature dependence of kcat of TAB5 (d), mutants G26 1A (r), G26 1A/ Y26 9A (j) and E coli (·) alkaline phosphatases at temperature...

Ngày tải lên: 22/02/2014, 04:20

Ngày tải lên: 07/03/2014, 02:20

... Susan Brennan, Marilyn Friedman, and Carl Schwall, and Pilar Mart~nez Advances in MaPollard A Centering Approach to Pronouns In chine Translation Research in IBM In ProceedProceedings of 25th Annual ... References [i] Chinatsu Aone, Hatte Blejer, Sharon Flank, Douglas McKee, and Sandy Shinn The Murasaki Project: Multilingual Natural Language Understanding In Proceedings of the ARPA Human Language Technology ... A Formal Approach to Discourse Anaphora Technical report, Bolt, Beranek, and Newman, 1978 [7] Ido Dagan and Alon Itai Automatic Acquisition of Constraints for the Resolution of Anaphora References...

Ngày tải lên: 08/03/2014, 07:20