... lagoons and ponds, and wetlands The lagoons and ponds depend on microbial life, and lower plants and animals, while wetlands support the growth of rooted plants Both pond systems and wetlands are ... Wetlands can be of two types: natural wetlands and constructed wetlands Both natural and constructed wetlands have been used for wastewater treatment, although the use of natural wetlands is generally ... of reliable cost data for wetland treatment systems is limited The cost of wetland treatment systems varies depending on wastewater characteristics, the type of wetland system, and the type of...
Ngày tải lên: 10/08/2014, 20:20
... Professor John Cairns Professor of Health Economics, Department of Public Health and Policy, London School of Hygiene and Tropical Medicine Professor Mike Campbell Statistician, University of ... Trust Professor Philip Home Professor of Diabetes Medicine, University of Newcastle upon Tyne Dr Peter Jackson Clinical Pharmacologist, University of Sheffield Professor Peter Jones Professor of Statistics ... of Sheffield Professor David Chadwick Professor of Neurology, Walton Centre for Neurology and Neurosurgery Dr Mark Chakravarty Head of Government Affairs and NHS Policy, Procter and Gamble Pharmaceuticals...
Ngày tải lên: 14/02/2014, 22:20
Báo cáo y học: "Intra-articular hyaluronan (hyaluronic acid) and hylans for the treatment of osteoarthritis: mechanisms of action" pps
... levels of prostaglandin F2α, 6-keto-prostaglandin F1α, and leukotriene C4 [72] In synovial fluid from the knees of patients with OA and RA, intra-articular HA reduced the levels of PGE2 [73,74] and ... fragments in vitro and in vivo Fragments of fibronectin bind and penetrate cartilage and subsequently increase levels of MMPs and suppress PG synthesis [64] In explant cultures of human cartilage, ... IL-1β and TNF-α stimulate their own production and the production of other cytokines (e.g IL-8, IL-6, and leukotriene inhibitory factor), proteases, and prostaglandin E2 (PGE2) [30] Synthesis of...
Ngày tải lên: 09/08/2014, 01:21
Biotechnology for waste and wastewater treatment n cheremisinoff
... are extracted from soil and water bodies and more recently technically developed for specific applications, and uses organic and toxic materials as sources of energy and carbon While in the future, ... science of recombinant DNA The following are examples of recent research and applications of wastes and toxics, using biotechnology control: Some 20 different bacteria are said to be capable of breaking ... quantities and ratios depend on the nature of the wastewater Characteristics of wastewaters are measured in terms of Chemical Oxygen Demand (COD), Biochemical Oxygen Demand (BOD), and Volatile...
Ngày tải lên: 16/03/2014, 18:11
Biotechnology for waste and wastewater treatment
... are extracted from soil and water bodies and more recently technically developed for specific applications, and uses organic and toxic materials as sources of energy and carbon While in the future, ... science of recombinant DNA The following are examples of recent research and applications of wastes and toxics, using biotechnology control: Some 20 different bacteria are said to be capable of breaking ... quantities and ratios depend on the nature of the wastewater Characteristics of wastewaters are measured in terms of Chemical Oxygen Demand (COD), Biochemical Oxygen Demand (BOD), and Volatile...
Ngày tải lên: 16/03/2014, 18:11
Market analysis and developing a competitive marketing strategy for selling medical solid waste wastewater treatment equipment to customers in vietnam
... firms, city/province departments of health (DoH), of Natural Resource and Environment (DoNRE), and department of Science and Technology (DoST) in the southern half of Vietnam, including four main ... Contents of the interview are often transcribed and translated into English at the end of the interviewing day or weekend Microsoft Excel software is utilized to build charts relevant to the amount of ... years, so suppliers must be patient and make a lot of attempts to pursue targeted objectives Inelastic demand – The total demand for plenty of business goods and services is not much affected...
Ngày tải lên: 23/07/2014, 03:36
ENCYCLOPEDIA OF ENVIRONMENTAL SCIENCE AND ENGINEERING - SMALL FLOW WASTEWATER TREATMENT TECHNOLOGY FOR DOMESTIC AND SPECIAL APPLICATIONS docx
... establishments and sub-divisions Among these are land treatment, and natural and constructed wetland Information on natural system may be found in Refs 1, 4, 15–17, 23 and 24 POLAR REGIONS Waste handling ... lightweight, and relatively easy to install However, their performance in terms of BOD and suspended solids reduction, and degree of disinfection achieved may be questionable Holding Tanks and Recirculating ... condensate, hygiene uses, and in the future, from urine Also the removal of trace contaminants from the air, the maintenance of the air composition and pressure, and the storage of solid wastes pending...
Ngày tải lên: 10/08/2014, 20:20
MATHEMATICS MANUAL FOR WATER AND WASTEWATER TREATMENT PLANT OPERATORS - PART pps
... (Overflow Rate) The primary goals of wastewater treatment ponds focus on simplicity and flexibility of operation, protection of the water environment, and protection of public health Moreover, ponds ... 400 lb/day Chlorine Demand The chlorine demand is the amount of chlorine used to react with various components of the water such as harmful organisms and other organic and inorganic substances ... measured as: % Strength = wt of solute wt of solute ¥ 100 = ¥ 100 wt of solution wt of solute + solvent (28.6) Example 28.10 Problem If 30 lb of chemical are added to 400 lb of water, what is the percent...
Ngày tải lên: 11/08/2014, 13:22
MATHEMATICS MANUAL FOR WATER AND WASTEWATER TREATMENT PLANT OPERATORS - PART 4 pdf
... For example, a mole of water is 18 grams of water, and a mole of glucose is 180 grams of glucose A mole of any compound always contains the same number of molecules The number of molecules in a ... The molarity of a solution is calculated by taking the moles of solute and dividing by the liters of solution The molarity of a solution is calculated by taking the moles of solute and dividing ... approximation of the amount of organic matter present in the solid fraction of wastewater, activated biosolids and industrial wastes With the exception of the required drying time, the suspended solids and...
Ngày tải lên: 11/08/2014, 13:22
MATHEMATICS MANUAL FOR WATER AND WASTEWATER TREATMENT PLANT OPERATORS - PART 5 docx
... by 40 ft long and contains water to a depth of 12 ft? A tank has a diameter of 60 ft and a depth of 12 ft Calculate the volume of water in the tank (in gallons) What is the volume of water in a ... of 70 ft and a depth of 19 ft What is the volume of water in the tank (in gallons)? 24 If a tank is 25 ft in diameter and 30 ft deep, how many gallons of water will it hold? FLOW, VELOCITY, AND ... flow of 4.2 MGD with a chlorine residual of 3.1 mg/L? 63 What should the chlorinator setting be (in lb/day) to treat a flow of 4.8 MGD if the chlorine demand is 8.8 mg/L and a chlorine residual of...
Ngày tải lên: 11/08/2014, 13:22
MATHEMATICS MANUAL FOR WATER AND WASTEWATER TREATMENT PLANT OPERATORS - PART 1 potx
... number is half the size of 2, and is half the size of Alternately, is twice the size of 1, and is twice the size of WORKING WITH RATIO AND PROPORTION When working with ratio and/ or proportion, the ... presence of a decimal For example, 23.676 is read “twenty-three and six hundred seventy-six thousandths,” and 73.2658 is read “seventy-three and two thousand six hundred fifty-eight ten-thousandths.” ... Rectangular Basin Volume of Round Pipe and Round Surface Areas Volume of a Cone and Sphere Volume of a Circular or Cylindrical Tank Chapter 12 Force, Pressure, and Head Calculations Force and Pressure Head...
Ngày tải lên: 11/08/2014, 13:22
A new hybrid treatment system of bioreactors and electrocoagulation for superior removal of organic and nutrient pollutants from municipal wastewater
... 1c A bundle of the media consisted of thousands of fibers having a total specific surface area of 560–725 m2 mÀ3, and a specific weight of 0.530 ± 0.027 kg mÀ3 Two flat-sheet modules of submerged ... Influence of operating conditions The results showed that the average removal efficiencies of total COD and ammonium were higher than 76% and 70–99% for HRT of 3.5 h and 4.5 h, respectively One of the ... Republic of Korea School of Civil and Environmental Engineering, University of Technology, Broadway, Sydney, NSW 2007, Australia h i g h l i g h t s A new hybrid system consisting of RHMBR, MBR and...
Ngày tải lên: 13/09/2015, 17:48
Báo cáo y học: "Inhalation with Fucose and Galactose for Treatment of Pseudomonas Aeruginosa in Cystic Fibrosis Patients"
... sputum cultures for at least three years) and acute exacerbation at time of recruitment They were randomized to be treated with inhalation of a 10 ml of 0.1 M fucose / 0.1 M galactose solution ... the clinical effect of fucose/galacatose when given to CF patients In the present study both inhalation of fucose/galactose solution alone and combined therapy of inhalation and antibiotics decreased ... fucose and galactose can prevent binding of PA lectins I and II (8, 15) In those studies inhibition of ciliary beats due to PA lectins was quantified as well as restoration by adding fucose and/ or...
Ngày tải lên: 03/11/2012, 11:48
Behavior of Nitrite Oxidizers in the Nitrification/Denitrification Process for the Treatment of Simulated Coke-Oven Wastewater
... activities of nitrite oxidizing bacteria - 31 - Journal of Water and Environment Technology, Vol.5, No.1, 2007 Figure Behavior of nitrate and nitrite at the end of the aerobic tank Behavior of Nitrobacter ... The effective reactor consisted of 45L of anoxic tank and 135L of aerobic tank, and a sedimentation tank Influent was 60L/day pH was 8.0-8.5 in the anoxic tank, and 7.0-7.5 in the aerobic tank ... the species of NOB, the primer set FGPS872f, CTAAAACTCAAAGGAATTGA and FGPS1269r , TTTTTTGAGATTTGCTAG (Degrange and Bardin, 1995) was employed for the detection of Nitrobacter species, and the primer...
Ngày tải lên: 05/09/2013, 09:38
Contact-Adsorption-Regeneration-Stabilization Process for the Treatment of Municipal Wastewater
... (2008ZX07103-001 and 2008ZX07316-002), and the Anhui R&D Key Project (07010301022 and 08010302109) for the partial support of this study REFERENCES Standard Methods for the Examination of Water and Wastewater ... the HRT of the adsorption tank were kept at 30 In Series II, R was increased from 20% to 60%, and the SRT, HRT of regeneration tank, and HRT of the adsorption tank were kept at d, h and 30 min, ... indicator of adsorptive capacity and appetency, respectively; and KF and n are constant characteristics of the system for the Freundlich model, which can be respectively considered as an indicator of...
Ngày tải lên: 05/09/2013, 09:38
Multi-criteria Evaluation of Wastewater Treatment Scenarios for Small Towns in Developing Countries - Case Study of Toan Thang Town in Vietnam
... technical, functional, and societal aspects for quantification and comparison of trade-offs between the effects of newly introduced technical solutions and their related impacts MATERIALS AND METHODS Criteria ... value, and lack of an alternative source of water Thus, it is necessary to have a clear understanding of the cultural aspects and sanitation practices; also the potential for utilization of treated ... the regulations and of embedding the technology in policymaking) Technical and functional Complexity of construction, O&M Flexibility of the system Reliability of the system Units of measure for...
Ngày tải lên: 05/09/2013, 10:15
Occurrence of Tetracycline-Resistant and Tetracycline- Degrading Bacteria in Wastewater Treatment Plant Effluent and Environmental Water Systems
... rates and bacterial growth in each sample for the analysis of the growth of tetracycline-resistant or tetracycline-degrading bacteria and the mechanism of tetracycline degradation MATERIALS AND ... Tahara M., Shimizu K and Nisimura T (2008) Monitoring of PPCPs in Aquatic Environments in Japan and Evaluation of Removal Efficiency on Assumption of Water Purification Process, J of Japan Society ... Characteristics of Pharmaceuticals in Wastewater Treatment, - 326 - Journal of Water and Environment Technology, Vol 8, No.4, 2010 J of Water and Waste, 50(7), 587-593 Wen X., Jia Y., and Li J., (2009)...
Ngày tải lên: 05/09/2013, 10:15
Integration of energy and environmental systems in wastewater treatment plants
... courses following upset of wastewater treatment process by industrial discharges Adequate pretreatment of industrial wastewater; efficient monitoring and enforcement Pollution of receiving water courses ... of the process flow and shares the benefits of each individual process design model The main objective of this model is to integrate and optimize each process by conducting a detailed study of ... filter, sand filter, primary and secondary clarifier, and oxidation Figure illustrates the various processes used at the plant, the flow of influent through various filters, and the capacity of each...
Ngày tải lên: 05/09/2013, 15:28
Bạn có muốn tìm thêm với từ khóa: