glycotope structures and intramolecular affinity factors of plant lectins for tn t antigens
The 11th form non-english majors’ level of satisfaction with their reading comprehension lessons at phan boi chau specialized upper secondary school, nghe an
Ngày tải lên :
07/11/2012, 14:54
... involves the three basic components of experiments as presented by Selinger and Shohamy, that is, the population (1st students at NACEC), the treatment (CS) and the measurement of the treatment (t- test) ... choose, with negative attitudes and beliefs often causing poor strategy use or lack of orchestration of strategies Type of task: The nature of the task helped determine the strategies naturally ... post-test which was the same as the pre-test However, to minimize the possible effect of the test familiarity on the students' gains between the two test administrations, some items of the first...
- 46
- 840
- 3
THE 11TH FORM NON ENGLISH MAJORS’ LEVEL OF SATISFACTION WITH THEIR READING COMPREHENSION LESSONS AT PHAN BOI CHAU SPECIALIZED UP
Ngày tải lên :
07/09/2013, 13:48
... affecting the students’ satisfaction that are worth considering such as students’ interest, needs teachers’ activities, the topic of the text, the text type…This thesis only aims at investigating the ... students understand the text by focussing attention on key words and ideas They are also intented intended to indicate the basic structure of the text, and help students’ anticipation Actually, ... student satisfaction If it is true that we cannot teach the language to the students , but just create conditions for the learning to happen, it is crucial to make our students satisfied with...
- 30
- 367
- 0
Tài liệu Báo cáo Y học: Interaction of decorin with CNBr peptides from collagens I and II Evidence for multiple binding sites and essential lysyl residues in collagen pot
Ngày tải lên :
21/02/2014, 15:20
... related to the percentage of Lys/Hyl side chains that did not react with the derivatizing agent (the percentage ranged from to 12%) Taken together, these data demonstrate the essential role of the ... 3B) and the thermal stability, with the relevant exception of N-acetylation with acetic anhydride for the reasons mentioned above The greatest decrease of Tm on derivatization in mild conditions ... aggregation states, multiple contacts are probably essential for the strength and the specificity of the interaction ACKNOWLEDGEMENTS We thank Antonella Forlino for helpful suggestion and criticism,...
- 10
- 575
- 0
Báo cáo khoa học: Comprehensive interaction of dicalcin with annexins in frog olfactory and respiratory cilia pdf
Ngày tải lên :
07/03/2014, 05:20
... A1; 5¢-CATATGGCTACTATT CATGAAAT-3¢ (forward) and 5¢-GGTTCCTCAGTCA TCTCCAGCACATAG-3¢ (reverse) for annexin A2; and 5¢-GGAATTCCATATGGCAACGACAAAAAG-3¢ (forward) and 5¢-CGGGATCCTTACTCATCATCCCCA-3¢ ... region of each annexin was amplified by PCR with a pair of primers The sequences of the primers were: 5¢-GGAATTCCATATGTCATTCATTTCCGAG-3¢ (forward) and 5¢-CGGGATCCTTAAGCTCCTCCAATAAGT G-3¢ (reverse) for ... We thank Dr H Matsumoto at the University of Oklahoma and Dr H Kurono at Kurume University for MS analysis of the binding proteins at the initial stage of this study This research was supported...
- 14
- 477
- 0
Báo cáo khoa học: Interaction of DAPI with individual strands of trinucleotide repeats Effects on replication in vitro of the AATÆATT triplet docx
Ngày tải lên :
16/03/2014, 23:20
... selectivity of DAPI for the minor-groove of the ATT-triplet with respect to all the other individual strands of trinucleotide repeats Both A T and T T base-pairs appear to be necessary conditions ... possibility that the inhibitory property of DAPI could only be attributed to a direct interaction of the drug with the Klenow fragment A DNA-mediated step correlating with the different structural and ... structures on the ATT- but not on the AAT- and GC-rich random-templates In addition, it has been reported previously that long tracts of CTGÆCAG repeats, which have the propensity to fold into...
- 7
- 350
- 0
Báo cáo khoa học: Interaction of 42Sp50 with the vegetal RNA localization machinery in Xenopus laevis oocytes ppt
Ngày tải lên :
23/03/2014, 03:20
... nucleus and mediate anchoring to cortical actin upon arrival of the RNP at the vegetal pole of the oocyte In the context of these localizing RNPs, but also as integral part of the 42S storage particle, ... experiments; however, no direct interaction of 42Sp50 with the different LEs could be demonstrated (data not shown) These negative results indicate that 42Sp50 is either not in direct contact with the ... diethylpyrocarbonate-treated water Thirty microlitres of S16 were used for the isolation of total RNA employing the same protocol In total, 1.5 lL of precipitated RNA or 0.3 lL (2%) of total...
- 10
- 327
- 0
Báo cáo khoa học: NMR studies on the interaction of sugars with the C-terminal domain of an R-type lectin from the earthworm Lumbricus terrestris pot
Ngày tải lên :
23/03/2014, 04:21
... bound to asialofetuin–agarose as strongly as the whole protein and retained its hemagglutinating activity, although at a level 10-fold lower than that of the whole protein [1] The crystal structures ... NMR study, the Kd of the c sugar-binding site for b-Me-Gal was the same as that for lactose; and (d) the STD–NMR data in this study showed that the epitope of lactose for EW29Ch is the galactose ... STD effect for sugar arose from the contribution of both the a and c sugar-binding sites because of the mixture of lactose and EW29Ch at a ratio of 100 : At first, 2D STD–TOCSY and 2D STD–[1H,13C]...
- 11
- 458
- 0
Báo cáo Y học: Exploration of the diaphorase activity of neutrophil NADPH oxidase Critical assessment of the interaction of iodonitrotetrazolium with the oxidase redox components doc
Ngày tải lên :
31/03/2014, 21:21
... attention to the possibility of the nonenzymatic univalent reduction of tetrazolium salts, particularly INT by O2– with concomitant production of the tetrazolium radical In addition, the INT ... rates of oxygen uptake were deduced from the slopes of the tangents to the oxygraphic traces, and the contact points of the tangents with the curves were used to determine the O2 concentrations ... concentrations of INT, the plots corresponded also to straight lines that intersected the 1/v axis at a common intercept, which was the same as that of the control curve, and the apparent Km for...
- 10
- 429
- 0
Báo cáo y học: "Direct interaction of immunoglobulins with synovial fibroblasts: a missing link in the pathogenesis of rheumatoid arthritis" potx
Ngày tải lên :
09/08/2014, 06:22
... online http://arthritis-research.com/content/7/1/44 cellular activation (also known as transformation), that leads to alteration in their apoptotic response, the attachment of these cells to articular ... matters of debate The present data indicate very clearly that stable alterations in the fibroblasts themselves are indispensable for (auto)antibodies to exert their effects on IL-16 (and RANTES) ... with the degree of joint destruction over a 2-year period [16] These data extend the aforementioned observations and link IL-16 to the disease process of RA In this context it is of interest, that...
- 3
- 222
- 0
báo cáo khoa học: " Gene expression profiling in susceptible interaction of grapevine with its fungal pathogen Eutypa lata: Extending MapMan ontology for grapevine" pdf
Ngày tải lên :
12/08/2014, 03:21
... weeks after the experimental infection 46 plantlets out of 60 infected plantlets were showing eutypiosis symptoms The control plantlets [40] did not show any symptoms After inspection of symptoms, ... infected plants die within a few years There is no known resistant cultivar, no efficient treatment and neither diagnostic tool available for this disease Therefore a better insight into the grapevine ... transcriptional level, and that translational and post-translational events may also be involved Methods Plant material Cabernet Sauvignon in vitro plantlets were experimentally infected with the...
- 14
- 396
- 0
Interaction of EcoRI with noncognate DNA sequences computational investigation of dynamics of protein water and DNA conformation
Ngày tải lên :
09/09/2015, 18:49
... which the first step is the fitting of atoms‟ trajectories to a reference frame so as to filter the translational and rotational motions and to extract only the concerted motions The second step ... recognition Thus, it was understood that several factors, in addition to the direct interactions between the protein and the DNA, contribute to the specificity in proteinDNA interaction In addition, ... their study revealed that the total binding energy is not just the sum of energetic contributions from each of the protein-DNA contacts, but that there were additional factors Further, the crystal...
- 204
- 375
- 0
Interaction of scribble with zonula occludens and intermediate filament proteins
Ngày tải lên :
14/09/2015, 08:24
... septate junction (SJ) This junction is located just basal to the adjacent AJ and is the functional equivalent of vertebrate TJ In vertebrate epithelia, the lateral locations of the AJ and TJ ... simultaneous retraction of the rear This is regulated by another Rho GTPase, RhoA via its stimulation of actin stress fiber assembly and contractile force at the side and rear of the cell This retraction ... suppressors Tests for genetic interaction among the three proteins have indicated codependence for protein localization and dose-sensitivity in mutant phenotype, supporting the notion that these proteins...
- 189
- 298
- 0
Báo cáo khoa học: DNA mediated disassembly of hRad51 and hRad52 proteins and recruitment of hRad51 to ssDNA by hRad52 pot
Ngày tải lên :
16/03/2014, 14:20
... ssDNA substrate PUC+, used in this study was: 5¢—TTTCCCAGTCACGA CGTTGTAAAACGACGGCCAGTGCCAAGCTTGCAT GCCTGCAGGTCGACTCTAGAGGATCCCCGGGTAC CGAGCTCGAATTCGTAATCATGGTCATAGCTGTTT CCT—3¢ DNA concentrations ... smaller forms of the protein are generated prior to active assembly, is an open question Our results suggest that transient contacts of DNA strands with either protein create an effect of ‘protein ... disaggregation’ It is important to note that all the effects uncovered in the present study are from in vitro analyses and it is not clear how these effects may relate to the situations in vivo, the...
- 9
- 378
- 0
Intein mediated generation of n terminal cysteine proteins and their applications in live cell bioimaging and protein microarray
Ngày tải lên :
08/11/2015, 16:30
... follows: pTWIN1-EGFP 5’-GGT GGT TGC TCT TCC AAC TGC AGA GCC atg gtg agc aag ggc- 3’ 5’-GGT GGT CTG CAG tta ctt gta cag ctc gtc-3’ pTWIN2-GST 5’-GGT GGT TGC TCT TCC AAC TGC AGA GCC atg tcc cct ata cta- ... AGC TGG GTC CTG CAG tta ctt gta cag-3’ pTWIN1-ECFP-NLS and pT-Rex-DEST30-intein/ECFP-NLS 5’-GGT GGT CTG CAG tta tct aga tcc ggt gga-3’ 5’-GGGG AC CAC TTT GTA CAA GAA AGC TGG GTC CTG CAG tta tct ... Pst I MCS Intein2 CBD T7 promoter Sap I Target gene CAC AAC TGC AGA GCC - tac aag taa CTG CA GTG TTG ACG TCT CGG - atg ttc ATT G Pst I G GAA AC GTC CTT Figure Cloning of a target gene into the...
- 77
- 200
- 0
Báo cáo y học: " Antagonistic interaction of HIV-1 Vpr with Hsf-mediated cellular heat shock response and Hsp16 in fission yeast (Schizosaccharomyces pombe)" potx
Ngày tải lên :
13/08/2014, 09:20
... elevated Hsp16 to suppress activity of Vpr' Therefore, wild type Vpr specifically counteracts activation of Hsp16 in response to vpr gene expression or heat treatment It is of interest to note that ... Competing interests The author(s) declare that they have no competing interests Authors' contributions ZB did the initial analysis of Hsp16 and carried out the experiments to test the effect of Vpr on ... death are two functionally independent activities is still of debate Earlier reports suggested that these two activities are separable both in fission yeast and Page of 14 (page number not for...
- 14
- 228
- 0
Tài liệu Báo cáo khoa học: Insights into the interaction of human arginase II with substrate and manganese ions by site-directed mutagenesis and kinetic studies Alteration of substrate specificity by replacement of Asn149 with Asp docx
Ngày tải lên :
20/02/2014, 02:21
... activity of the Asn149Asp variant, it is clear that the interactions of arginase II with l-arginine and agmatine are greatly altered by replacement of this residue with aspartate To the best of ... oligonucleotide primers were: 5¢-gattgccaggctgttgtctcctcccag-3¢, 5¢-GTTGATGTCAGCATTGGCATCAACCCA-3¢ and 5¢-GGGGTGTGTCGATGTCA-3¢ for His120Asn, His145Asn and Asn149Asp, respectively The corresponding ... metal ion as being involved in the stabilization of the transition state [27], but not in the stabilization of the substrate in the Michaelis–Menten complex [24] Also in agreement with this, the...
- 9
- 651
- 0
Tài liệu Báo cáo khoa học: Interaction of the small heat shock protein with molecular mass 25 kDa (hsp25) with actin doc
Ngày tải lên :
20/02/2014, 23:20
... electrophoresis The quantity of actin in the pellet was plotted against the total quantity of actin in the sample Results Heat denaturation of actin Before starting the investigation of the HSP25–actin interaction ... mutants decreased the quantity of polymerized actin in the pellet It is worthwhile to mention that the mutants of HSP25 affect the rate but not the maximal extent of intact actin polymerization ... in the pellet was plotted against the total quantity of actin in the probe (Fig 6C) The wild type HSP25 has little effect on the extent of polymerization of intact actin, whereas both 2D and...
- 10
- 431
- 0
Báo cáo khoa học: Interaction of the general transcription factor TnrA with the PII-like protein GlnK and glutamine synthetase in Bacillus subtilis potx
Ngày tải lên :
06/03/2014, 00:21
... these data demonstrate, that TnrA binds constitutively to GlnK in AmtB-deficient mutants, and to GS in GlnK-deficient mutants This constitutive binding in the mutant strains probably protects TnrA ... (5¢-TCC AGC GGA TCC TTC CGC ACT TAC GGA TC-3¢) and TnrA35 (5¢-TTC TTT GGA TCC CAT ATC CTT TTA AAT CTC TGC-3¢) oligonucleotides were used, respectively, instead of TnrA6 The sequences of all cloned ... Discussion Fig The interaction of truncated TnrA proteins with GlnK and GS (A) BIAcore analysis of GlnK and GS binding to wild-type TnrA (TnrAwt), TnrA6, TnrA20, and TnrA35 The analyte (40 nM GlnK...
- 11
- 596
- 0
Báo cáo khoa học: Cloning, expression and interaction of human T-cell receptors with the bacterial superantigen SSA ppt
Ngày tải lên :
07/03/2014, 16:20
... TAAAGATCTCAAATTACCC-3¢, for the second PCR the primers were: 5¢ primer, 5¢-GGGTAATTTGAGATC TTTATATGATAACC-3¢ and 3¢ primer, 5¢-CGCGCGG GATCCTTAGTGATGGTGATGGTGATGGGTGACC GGTTTTTTGGTAGGTGAAC-3¢ The third ... encoding the mature protein (5¢ primer, 5¢-CATGCCATGGCCAGTAGTCAGCCTGACCCTACT CCAG-3¢; 3¢ primer, 5¢-CGCGCGGGATCCTTAGTG ATGGTGATGGTGATGGGTGACCGGTTTTTTGG Ó FEBS 2004 Interaction of human TCR with superantigen ... interest in these molecules in the treatment of several pathologies and because of the potential use of the toxins as biological weapons Alteration of their MHC and TCR binding capacity by site...
- 9
- 485
- 0