... tunneled segment pulls axially at that segment during systole, due to strong morphologic changes in the bridge region during the heart contraction (e .g. , deeper dipping of the tunneled segment into ... in Fig 3) Since the vessel is more or less tethered to the surrounding tissues, the local wall elongations induced by this force generate in turn retaining forces in these tissues The resulting ... Kearney P, G rge G, Haude M, Meyer J: Comparison of intravascular ultrasound and angiography in the assessment of myocardial bridging Circulation 1994, 89(4):1725-1732 Ge J, Erbel R, Gorge G, Haude...
... blot with GAPDH Ig mediated through various protein kinase and monomeric GTP-binding proteinsignaling pathways including MAP kinases and Rho GTPases [18,20,31] To determine the signal transduction ... cytoskeleton components in relaying signals between signaling molecules Another potential explanation suggests a model whereby, in the absence of Rho-induced actin polymerization, G- actin inhibits transcription ... extracellular-regulated kinase 1/2 (ERK1/2), c-Jun N-terminal kinase (JNK), p38 mitogenactivated protein (MAP) kinase and nonreceptor tyrosine kinases [19,20] These signaling pathways are linked to...
... be performed: 1) searching for specific TF Page of 10 binding sites and outputting all genes containing these sites and 2) searching for genes expressed in specific organs, tissues, cell types ... accomplish the same task GeneDB, GeneSynonymDB, SpeciesDB, BindingSiteDB, and TF_connect_TFBS_DB form the main grouping of tables used for holding gene and binding site information The TF_connect_TFBS_DB ... of the genes in the database contain known binding sites for p53 and therefore it is listed here only as a gene Clicking on the gene link in the search menu will display binding site information...
... CIRCUITS OXYGEN-SIGNALLING IN HYPEROXIA nγ-GCS GSSG BSO BCNU ↑ GSH γ-GCS 2GSH ? NF-κB Activation ROOH ROOH NAC PDTC ROS ↑ GSSG ROS NF-κB DNA Binding INDUCTION OF OXIDATIVE STRESS-RESPONSIVE GENES Schematic ... exacerbating in lung injury Regarding the mechanisms reported in hyperoxia-mediated lung injury, it was suggested that hyperoxia-associated production of ROS might lead to neutrophil infiltration into ... CCAAT/enhancer binding protein beta, Sp-1, AP-1 and CREB are present in the promoter regions of numerous cytokine genes, including those whose expression is increased after blood loss To investigate early...
... element binding protein; CBP, CREB-binding protein; DAG, diacyl glycerol; ECF, extracellular fluid; ICF, intracellular fluid; IP3, inositol triphosphate; MAPK, mitogen-activated protein kinase; ... NADP, nicotinamide dinucleotide oxidized; NADPH, nicotinamide dinucleotide reduced; PKC, protein kinase C; ROS, reactive oxygen species; SAPK, stress-activated protein kinase DNA binding In hypoxia, ... significant lung injury 48 Pugin and colleagues, for instance, have developed an in vitro model in which isolated lung cells can be submitted to a prolonged cyclic pressure-stretching strain...
... Woodstock, Virginia, at Pugh’s Run (USGS streamflow-gaging station number 1633650) and the second was near the town of Mount Jackson, Virginia, near Red Banks (USGS streamflow-gaging station number ... Virginia, near Red Rocks site was located at USGS streamflow-gaging station 1633000 Sampling Processing and Chemical Analysis Each POCIS and SPMD was extracted individually before designating ... Stuer-Lauridsen, F., Getting, D.T., Goddard, J.P., Gravell, A., 2007, Tool for monitoring hydrophilic contaminants in water: polar organic chemical integrative sampler (POCIS) in Greenwood, R., Mills, G. , Vrana,...
... factors, including insulin growth factor-1, platelet-derived growth factor and epidermal growth factor [14,15] Various protein phosphatases have been implicated in the regulation of MAPK signaling, including ... shown) JSP1-wt-GFP JSP1 -G2 A-GFP In contrast to most phosphatases, which negatively regulate MAPK signaling, JSP1 was shown to be a positive regulator of the JNK signaling pathway [20,21] Since myristoylation ... ⁄ PAGE The gel was fixed in 40% methanol ⁄ 10% acetic acid, and stained with SYPRO Ruby Protein Gel Stain (Invitrogen) according to the manufacturer’s protocol Bands containing JSP1-wt or G2 A...
... 5¢-ATGAGCTCGGGAACCCTTAAAGCCCG-3¢ 5¢-ATGAGCTCTGCTTTCCTTCCGGGGA-3¢ 5¢-ATTGAGCTCACCAGGAGGGCAGGAGG-3¢ 5¢-GACACCTGTCGGTAACCCTTAAAGCC-3¢ 5¢-CGGAGTCGCCTAAGGAGAGATGGAGA-3¢ 5¢-AGGGTTCCCGATCGGTGTCTGAGAGA-3¢ ... mGATA* mE-box* mEts-F* 5¢-GTGGTACCAGTAGCAGCCGCCGCAAG-3¢ 5¢-ATGGTACCGGGCTTTAAGGGTTCCCG-3¢ 5¢-ATGGTACCGGAAGGAAAGCAGAGCCC-3¢ 5¢-ATGGTACCTGGTGATCCAGGGCTTGC-3¢ 5¢-CCGTTCCGAGCTCCGAGCAC-3¢ 5¢-ATGAGCTCGGGAACCCTTAAAGCCCG-3¢ ... al [34] The DNA fragments containing the putative Etsbinding sequence of the 5¢-flanking region of the mouse a3 integrin gene were synthesized; 5¢-TTTTCTCTTTCCCCG GAAGGAAAGCAGAG-3¢ (wild-type) and...
... 5F (5¢-TGAAGAGTTT GATCATGGCT-3¢) and 1540R (5¢-AAGGAGGTGAT CCAACCGCA-3¢) numbered according to the E coli 16S rRNA sequence were used The PCR product was purified and ligated into the p-GEM-T Easy ... quantities of protein utilizing the principle of protein- dye binding Anal Biochem 72, 248–254 41 Laemmli, U.K (1970) Cleavage of structural proteins during the assembly of the head of bacterialphage T4 ... N-D-AAase gene (Eur J Biochem 269) 4877 37 Thompson, J.D., Higgins, D .G & Gibson, T.J (1994) CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting,...
... (5¢-CAGTGACCCCAGAC GGGGTCGACTTC-3¢) and DH974 (5¢-GGCTGGTCGTC GCCTCGGCAACAGCGGGTTCCTCCTTC-3¢) for pig CPT1B, and DH977 (5¢-CGGTGACCCCAGAAGGGGT CGACTTC-3¢) and DH978 (5¢-GAAGTCGACCCCTTCTG GGGTCAC CG-3¢) ... QuickChange Site-Directed Mutagenesis Kit (Stratagene) The primers used were DH801 (5¢-TTCTTCCGCCA AACCCTTAAGCTGCTGCTTTCCTAC-3¢) and DH802 (5¢-GTAGGAAAGCAGCAGCTTAAGGGTTTGGCGGA AGAA-3¢) Using this ... (5¢-AGCTGAATTC ATGGCGGAAGCTCACCAG-3¢) and DH803 (5¢-TCCA CCCATGGTAGCAGAGAAGCAGCTTAAGGGTTTGG CGGA-3¢) The PCR reaction yielded a 422-bp product, in which an EcoRI site (in bold in the forward primer...
... subdivided into two main groups (i.e the quinoxalines and the quinolines), depending on the chromophore moiety bound to the N-termini of each oligopeptide chain Prominent members of the quinoxaline-group ... ring (Cy8 ⁄ 4) or to eight residue rings By contrast, GrsB T-TE is capable of trimerizing pentapeptidyl-SNAC substrates to form 15-residue rings It was suggested that the size of the resulting ... subsequently ligated into a BamHI and NcoI-digested pQE60 vector (Qiagen), appending an C-terminal hexahistidine tag to the expressed protein DNA sequencing of the derived plasmid was performed by GATC...
... To preserve all protein DNA contacts the chimera was designed keeping the nonsymmetric HIV-1 NF-kB binding site (50 -GGGGACT TTCC-30 ) and linking to this DNA core a T base in the 50 position ... generate self- or inter-strand hybridization, possibly forming highly stable complexes [23–27] In this respect, palindromic DNA sequences (for example the symmetric GGGGATTCCCCT NF-kB binding ... carrying binding sites for GATA-1 and NF-IL2A were used, as indicated (B,C) Effects of increasing amounts of DNA–DNA and PDP–PDP hybrids carrying the target sites of HIV-1 NF-kB, on the interaction...
... AAACGTTGCTGACGTGCACAC CGATATTCTCAAGCCCAAGCC TGATGGAGTCTGGGTTGGAAG AGCCAGATTGATTATGGCCGC ATTCGGACACCCTTGAAAGGG ATAGACAAGTCCGCAGTCCCC 4409 Role of NrpRII in M mazei K Weidenbach et al extracted using ... 5¢-GTTTGAAGCTTTTATAAAAGACCCATAC; Mm1028 His.for 5¢-GGTTGACATATGAGCGAATC ⁄ Mm1028 His rev 5¢-GAAGCTTCTTATAAAAGCCCC; and Mm 1772 His.for 5¢-GGTGATATCATATGGTAGAAGTCG ⁄ Mm 1772 His.rev 5¢-GAAGAAAGCTTTAGAGGATAATCTCG) ... each time using 300 lL of protein- binding buffer (see above) Potentially DNA-bound proteins were subsequently eluted step-by-step using 200 lL of binding buffer containing increasing amounts of...