Báo cáo khoa học: Intrabodies against the EVH1 domain of Wiskott–Aldrich syndrome protein inhibit T cell receptor signaling in transgenic mice T cells potx

Intrabodies against the EVH1 domain of Wiskott–Aldrich syndrome protein inhibit T cell receptor signaling in transgenic mice T cells Mitsuru Sato1, Ryo Iwaya1,2, Kazumasa Ogihara1,3, Ryoko Sawahata1,3, Hiroshi Kitani1, Joe Chiba2, Yoshikazu Kurosawa4 and Kenji Sekikawa1,5 Department of Molecular Biology and Immunology, National Institute of Agrobiological Sciences, Ibaraki, Japan Department of Biological Science and Technology, Tokyo University of Science, Chiba, Japan Institute for Antibodies Co., Ltd, National Institute of Agrobiological Sciences, Ibaraki, Japan Institute for Comprehensive Medical Science, Fujita Health University, Toyoake, Aichi, Japan Kitasato University School of Veterinary Medicine and Animal Sciences, Aomori, Japan Keywords cytosolic protein; functional knockdown; intrabody; T-cell receptor signaling; Wiskott– Aldrich syndrome protein (WASP) Correspondence K Sekikawa, Department of Molecular Biology and Immunology, National Institute of Agrobiological Sciences, 3-1-5, Kannondai, Tsukuba, Ibaraki 305-0856, Japan Tel ⁄ Fax: +81 29 8386039 E-mail: sekiken@nias.affrc.go.jp (Received August 2005, revised October 2005, accepted 10 October 2005) doi:10.1111/j.1742-4658.2005.05011.x Intracellularly expressed antibodies (intrabodies) have been used to inhibit the function of various kinds of protein inside cells However, problems with stability and functional expression of intrabodies in the cytosol remain unsolved In this study, we show that single-chain variable fragment (scFv) intrabodies constructed with a heavy chain variable (VH) leader signal sequence at the N-terminus were translocated from the endoplasmic reticulum into the cytosol of T lymphocytes and inhibited the function of the target molecule, Wiskott–Aldrich syndrome protein (WASP) WASP resides in the cytosol as a multifunctional adaptor molecule and mediates actin polymerization and interleukin (IL)-2 synthesis in the T-cell receptor (TCR) signaling pathway It has been suggested that an EVH1 domain in the N-terminal region of WASP may participate in IL-2 synthesis In transgenic mice expressing anti-EVH1 scFvs derived from hybridoma cells producing WASP-EVH1 mAbs, a large number of scFvs in the cytosol and binding between anti-EVH1 scFvs and native WASP in T cells were detected by immunoprecipitation analysis Furthermore, impairment of the proliferative response and IL-2 production induced by TCR stimulation which did not affect TCR capping was demonstrated in the scFv transgenic T cells We previously described the same T-cell defects in WASP transgenic mice overexpressing the EVH1 domain These results indicate that the EVH1 intrabodies inhibit only the EVH1 domain function that regulates IL-2 synthesis signaling without affecting the overall domain structure of WASP The novel procedure presented here is a valuable tool for in vivo functional analysis of cytosolic proteins Intracellular antibodies (intrabodies) may be useful tools for not only clinical applications such as viral neutralization and cancer therapy but also functional analysis of proteins inside cells A variety of intrabody formats have been used Single-chain variable fragments (scFvs) consist of one heavy chain variable region (VH) linked through a flexible peptide spacer, usually a repeated motif of · GGGGS, to one light Abbreviations BrdU, 5-bromo-2¢-deoxyuridine ER, endoplasmic reticulum; intrabody, intracellular expressed antibody; EVH1, enabled ⁄ vasodilator-stimulated phosphoprotein (Ena ⁄ VASP) homology 1; FITC, fluorescein isothiocyanate; GST, glutathione S-transferase; IL, interleukin; scFv, single-chain variable fragment; TCR, T cell receptor; VH, heavy chain variable; VL, light chain variable; WASP, Wiskott–Aldrich syndrome protein; WIP, WASP-interacting protein FEBS Journal 272 (2005) 6131–6144 ª 2005 The Authors Journal Compilation ª 2005 FEBS 6131 Impaired TCR signaling in anti-WASP scFv Tg mice M Sato et al chain variable (VL) They are able to fold and retain the antigen-binding specificity and affinity of the parental antibody [1,2] scFvs are expressed more easily than whole antibodies assembled with heavy and light chains by disulfide bonds In general, the antibody fragments for assembling the scFvs are isolated from either antibody phage display libraries [3] or well-characterized hybridoma producing mAbs Although screening of phage libraries allows the selection of antibody fragments directed against a variety of antigens, the screened antibody fragments often show low or intermediate affinity for the antigen Therefore, large-scale libraries and extensive screening are required for the selection of the antigen-specific antibody fragments On the other hand, the antibody fragments isolated from hybridomas have high affinity and specificity for the target molecules However, the cloning of heavy and light chain variable regions by RT-PCR can be difficult because of the presence of nonspecific variable region transcripts produced by myeloma cells that are fused to the antibody-producing cells In functional proteomics, comprehensive protein analyses have been demonstrated [4] However, the development of a new procedure for domain analysis of protein is necessary Gene knock-out technologies that rely on developing a phenotype from null mutation of the gene in embryonic stem cells are powerful tools for understanding gene function Recently, RNA interference (RNAi) which can eliminate specific mRNA and lead to gene silencing has been developed [5] However, these gene knock-out and silencing techniques cannot be used to analyze domain structures and functions and post-translationally modified protein functions Dominant negative gene knock-out procedures succeed in inhibiting the targeted domain functions of proteins, but not in all cases Antibodies have been used for various purposes for a long time For example, they have been used as reagents for Western blotting, immunostaining, immunoprecipitation and blocking of protein function Therefore, if intrabodies retain their specificity and high-affinity binding properties, they may be useful tools for inhibition of protein function inside the cell In fact, much attention has been paid to intrabodies for clinical applications The functional knockdown of target proteins, such as HIV gp120, chemokine receptor, growth factor receptors, MHC class I, Ras oncogene, p53 tumor suppressor, and protein kinases has been demonstrated [6–12] If the target proteins are synthesized and processed in the endoplasmic reticulum (ER), scFvs are expressed with the signal peptide at the N-terminus of VH and VL with the ER retention signal KDEL (Lys-Asp-Glu-Leu) at the C-terminus Folded scFvs can bind to the target 6132 proteins on the lumen side and inhibit transport of target proteins in the process of functional maturation [6,8] If the targets are cytosolic proteins, scFvs without the signal peptide are used for expression in the cytosol However, expression levels of scFvs are low in the cytosol, and binding of scFv intrabodies to target molecules is difficult to detect [13] A small quantity of intrabodies in the cytosol may explain the low translational efficiency and low stability of intrabodies in the cytosol Wiskott–Aldrich syndrome protein (WASP), the causal gene product of the X-linked immunodeficiency (WAS) [14,15], participates in TCR signaling as a cytosolic adaptor molecule [16–18] It is well known that TCR stimulation activates various signaling cascades accompanied by recruitment of adaptor molecules, protein kinases and regulatory molecules into the membrane-receptor complexes, resulting in the correct initiation and amplification of the signaling reaction WASP is an adaptor molecule containing multiple domains: for example, a GTPase-binding domain, which is thought to interact with Cdc42, and a proline-rich region, which interacts with the Src homology domain of the adaptor Nck, Grb2 and several kinases [19–22] Furthermore, WASP is also associated with the actin-related protein (Arp2 ⁄ 3) complex through its C-terminal region The association of WASP and the Arp2 ⁄ complex activates the actin nucleation activity of the Arp2 ⁄ complex [23] To investigate further the function of the WASPEVH1 domain in the TCR signaling pathway, we developed transgenic (Tg) mice that express intrabodies that specifically bind to the WASP-EVH1 domain The cDNA fragments that encode variable regions of heavy and light chains were isolated from two established hybridomas producing WASP-EVH1specific mAbs We constructed several scFvs consisting of VH and VL regions with ⁄ without the VH leader sequence at the N-terminal and with ⁄ without the CL(j) region behind the VL region None of the constructs contained the KDEL sequence at the C-terminus We compared the quantity of scFv intrabodies and assessed their binding activity to the WASP-EVH1 domain in the scFv gene-transfected T cells Finally, we succeeded in expressing the functional scFv intrabodies in the cytosol and precisely knocking down the targeted protein domain in scFv transgenic mice Results Construction of anti-WASP-EVH1 scFvs To assess the binding activity to native WASP in T cells, mAb clones (17, 18 and 21) were confirmed FEBS Journal 272 (2005) 6131–6144 ª 2005 The Authors Journal Compilation ª 2005 FEBS M Sato et al Impaired TCR signaling in anti-WASP scFv Tg mice Fig Selection of WASP EVH1 mAbs for assembling scFvs and aligned amino-acid sequences of the VH and VL regions (A) Immunoprecipitation of T cell lysates with WASP EVH1 mAbs produced by established hybridomas T cell lysates were immunoprecipitated with lgỈmL)1 control mouse IgG (lane 1), clone 17 (lane 2), clone 18 (lane 3), clone 21 (lane 4) or commercially available WASP mAb (lane 5) and analyzed by Western blotting with WASP polyclonal antibody Control T cell lysates were loaded in lane The 30-kDa bands (arrowhead) indicated secondary antibody cross-reactive nonspecific proteins (B) Comparison of deduced amino-acid sequences of the VH and VL fragments derived from WASP EVH1 mAbs 18 and 21 Shared amino acids are indicated by bars Leader signal sequences and three complementarity-determining regions are shown in gray boxes Four framework regions (FR) are marked above the sequence by immunoprecipitaion Clones 18 and 21 were able to bind to the native form of WASP expressed in T cells, but clone 17 was not able to immunoprecipitate native WASP (Fig 1A) On the basis of this result, clones 18 and 21 were selected for construction of scFv intrabodies For the design of primers for PCR amplification of cDNA that encodes subtype-specific VH and VL regions, mAbs were checked by an isotyping test Clones 18 and 21 were classified as IgG3 ⁄ j and IgG2b ⁄ j, respectively The appropriate cDNA fragments of the VH and VL regions were then generated by RT-PCR A comparison of the VH and VL amino-acid sequences of clones 18 and 21 is shown in Fig 1B All of the VH regions and the complementarity-determining region of the VL regions differed strongly between the two clones Generation of scFv from hybridomas was achieved by well-established molecular engineering methods The four-step PCR using appropriate primers allowed amplification and assembly of the VH and VL regions (Fig 2A) To investigate the stability of scFvs, we designed several scFv constructs with and without the N-terminal leader signal sequence of the VH region and with and without the CL(j) region following the VL region, which are described as HL, SHL, HL-CL and SHL-CL in Fig 2B Expression of scFv intrabodies and binding to WASP In all scFv gene-transfected T cells, expression of scFv intrabodies was detected by Western blot analysis However, scFvs containing the VH signal peptide sequence and CL region (SHL or SHL-CL) were highly expressed in T cells (Fig 3A) These results strongly suggest that the addition of the VH signal peptide sequence and CL(j) region to scFvs increases the stability of the scFv intrabodies in T cells An in vitro binding assay was performed using glutathione S-transferase (GST) pull-down to detect the binding activity of anti-WASP scFvs Constructs containing the VH signal peptide sequence, 18SHL ⁄ SHL-CL and 21SHL ⁄ SHL-CL, were able to bind to GST-WASP15 (see Experimental procedures for definition of WASP15), whereas no binding activity of scFvs that did not contain the signal peptide sequence of the VH region was detected (Fig 3B) Although the expression levels of 18SHL ⁄ SHL-CL and 21SHL ⁄ SHL-CL were almost the same in the scFv gene-transfected T cells, 21SHL ⁄ SHL-CL bound more strongly to GST-WASP15 than 18SHL ⁄ SHL-CL (Fig 3A,B) Furthermore, to examine the interaction in vivo between scFv intrabodies and the target molecule, WASP, scFv gene-transfected T cells were lysed FEBS Journal 272 (2005) 6131–6144 ª 2005 The Authors Journal Compilation ª 2005 FEBS 6133 1, 3, (G4S)3 2, VL 7, 21 SH L VH ve cto r signal 18 HL A A 21 HL -C L 21 SH L-C L M Sato et al 18 SH L 18 HL -C L 18 SH L-C L 21 HL Impaired TCR signaling in anti-WASP scFv Tg mice (kD) 49.9 8, 10 (kD) 21 SH L-C L 21 HL -C L 21 SH L 18 SH L-C L 21 HL 18 HL -C L 18 SH L ve cto r B 13, 14 18 HL 32.3 11, 12 G W G W G W G W G W G W G W G W G W 49.9 G: GST W: GST-WASP15 B 32.3 VL Myc VH (G4S)3 VL CL Myc VH (G4S)3 VL CL Myc (kD) 21 HL -C L 21 SH L-C L (G4S)3 C HL 21 SH L Myc 18 HL -C L 18 SH L-C L 21 HL VL 18 SH L (G4S)3 18 HL VH VH signal ve cto r SHL 49.9 SHL-CL signal 32.3 Fig Constructions of anti-WASP EVH1 scFvs (A) Cloning of variable region of immunoglobulin heavy and light chains from hybridoma cells producing WASP EVH1 mAb The arrows represent the following primers used to amplify the antibody fragments: primer 1, 5¢-CACCCAAGCTTGCCACCATGGGCAGACTTACTTCTTCATTC-3¢; primer 2, 5¢-CAGAACCACCACCCCCTGAGGAGACGGTGACTGAGG ATCC-3¢; primer 3, 5¢-CACCCAAGCTTGCCACCATGCAGGTTACTCT GAAAGAGTC-3¢; primer 4, 5¢-CACCCAAGCTTGCCACCATGAAATG CAGCTGGGTTATCTTC-3¢; primer 5, 5¢-CAGAACCACCACCCCCTG AGGAGACGGTGACTGAGGTTCC-3¢; primer 6, 5¢-CACCCAAGCTT GCCACCATGGAGGTTCAGCTGCAGCAGTCTG-3¢; primer 7, 5¢-GGT GGAGGAGGTTCTGATGTTTTGATGACCCAAACTCCAC-3¢; primer 8, 5¢-CGAATGCGGCCGCCCGTTTGATTTCCAGCTTGGTGC-3¢; primer 9, 5¢-GGTGGAGGAGGTTCTGATGTTGTTCTGACCCAAACTCCACTC-3¢; primer 10, 5¢-CGAATGCGGCCGCCCGTTTCAGCTCCAGCTTGGTCC-3¢; primer 11, 5¢-TCAAAACATCAGAACCTCCTCCACCGGATCCTCCAC CTCCAGAACCACCACCCCC-3¢; primer 12, 5¢-GAACAACATCAGAA CCTCCTCACCGGATCCTCCACCTCCAGAACCACCACCCCC-3¢; primer 13, 5¢-CGTCTCCTCAGGGGGTGGTGGTTCTGGAGGTGGAG GATCCGGTGGAGGAGGTTCT-3¢; primer 14, 5¢-CGTCTCCTCA GGGGGTGGTGGTTCTGGAGGTGGAGGATCCGGTGGAGGAGG TTCT-3¢ In all primers, underlined sequences indicate restriction site of HindIII and NotI, and bold letters indicate full or part of the (Gly4Ser)3 linker sequence (B) Schematic representation of the four scFv formats (SHL, HL, SHL-CL, and HL-CL) Shown are the leader signal sequence, VH region, polypeptide linker (G4S)3, VL region, light chain constant [CL(j)] region and Myc tag sequence and immunoprecipitated with WASP mAb A strong interaction between WASP and 21SHL ⁄ SHL-CL scFvs was detected by Western blot analysis with Myc tag antibody, whereas 18SHL ⁄ SHL-CL scFvs and other scFvs were not able to associate with native WASP (Fig 3C) The binding specificity for the WASP EVH1 domain was demonstrated by in vivo interaction between T7-tagged WASP15 and 21SHL ⁄ SHL-CL scFvs (Fig 3D) These results suggest that 21SHL and 21SHL-CL are stably expressed as intrabodies with 6134 87 WASP 49.9 D (kD) T7 -W AS P1 T7 -W A + SP 1H 15 L T7 -W A + SP1 1S HL T7 -W A + SP 1H 15 L-C L T7 -W AS +2 P 1S 15 HL -C L HL-CL 49.9 21SHL-CL-Myc 32.3 21SHL-Myc 28.8 T7-WASP15 22 Fig Expression of anti-WASP scFvs and detection of their binding activity to WASP in T cells (A) Western blot analysis of protein extracts of anti-WASP scFv DNA-transfected T cells The immunoblot was probed with Myc tag mAb (B) In vitro binding assay using GST pull-down All anti-WASP scFv DNA-transfected T cells were lysed and incubated with GST (G) or GST-WASP15 (W) fusion protein noncovalently bound to glutathione–Sepharose beads Bound proteins were analyzed by Western blotting with Myc tag mAb (C) In vivo association between scFvs and WASP All scFv DNA-transfected cell lysates were immunoprecipitated with WASP mAb and analyzed by Western blotting with Myc tag mAb (top panel) or WASP mAb (bottom panel) (D) EVH1 domain-specific binding of scFv T7-WASP15 and scFv DNA cotransfected cell lysates were immunoprecipitated with biotinylated T7 tag mAb Immunocomplexes were recovered by on streptavidin–agarose and analyzed by Western blotting with Myc tag mAb (top panel) or T7 tag mAb (bottom panel) Arrowheads indicate secondary antibody cross-reactive nonspecific proteins domain-specific binding capabilities, and are able to associate with native WASP in T cells To detect cleavage of the VH signal peptide sequence from the N-terminal scFv-VH region, the N-terminal amino-acid sequence of scFv 21SHL-CL expressed in T cells was determined Unfortunately, we could not detect the N-terminal sequence by the well-established Edman method because the N-terminal amino-acid residue was blocked Moreover, we could not detect a FEBS Journal 272 (2005) 6131–6144 ª 2005 The Authors Journal Compilation ª 2005 FEBS M Sato et al Impaired TCR signaling in anti-WASP scFv Tg mice VH signal peptide sequence by MS analysis of 21SHLCL digested with lysyl endopeptidase (data not shown) These results suggest that the VH signal peptide sequence was cleaved from the N-terminal VH region The culture supernatant of 21SHL-CL scFvexpressed T cells was examined but the scFv could not be detected (data not shown) These results suggest that, even if scFvs are expressed with a signal sequence, they not enter the secretory pathway Generation of anti-WASP scFv transgenic mice scFv 21SHL and 21SHL-CL vector DNAs were chosen as the transgenes for development of transgenic mice with the functional knockdown WASP-EVH1 domain High expression of 21SHL and 21SHL-CL was detected in T and B cells from the spleens of the 21SHL ⁄ 21SHL-CL scFv transgenic mice (Fig 4A) Eight 21SHL transgenic founders and 10 21SHL-CL transgenic founders carrying the scFv intrabody expression vectors were obtained In four of eight 21SHL lines and five of 10 21SHL-CL lines, the same levels of expression of 21SHL and 21SHL-CL were L-C L 21 SH L SH 21 21 SH L SH 21 (kD) B cell L-C L T cell A 49.9 21SHL-CL-Myc WB: anti-Myc tag 21SHL-Myc 32.3 B 49.9 21SHL-CL-Myc IP: anti-WASP WB: anti-Myc tag 21SHL-Myc detected (data not shown) Furthermore, T and B cells from the spleens of both scFv transgenic mice were solubilized with 1% digitonin buffer and immunoprecipitated with WASP mAb and Myc tag mAb to examine the in vivo interaction between scFvs and endogenous WASP Binding of intracellular scFvs and WASP was detected in both T and B cells from scFv transgenic spleens by immunoprecipitation (Fig 4B–D) Impaired antigen receptor-induced proliferation in anti-WASP scFv transgenic T cells, but not B cells To assess the effects of the anti-WASP scFvs 21SHL and 21SHL-CL on T-cell function, the proliferative response to stimulation with CD3e antibody (2c11) was examined Compared with the wild-type, T cells from 21SHL transgenic mice and 21SHL-CL transgenic mice were impaired in their proliferative response to CD3e antibody stimulation to the same extent as in WASP15 transgenic T cells [24] (Fig 5A) These findings indicate that the function of the WASP N-terminal EVH1 domain is blocked by scFv 21SHL and 21SHL-CL intrabodies in the T cells In contrast with T cells, proliferative responses to antigen receptor stimulation with anti-IgM Ab F(ab¢)2 or CD40 antibody were normal in the scFv transgenic B cells (Fig 5B) Therefore, the EVH1 domain of WASP is not functional, at least in the Ag receptor-induced proliferative response of B cells T cells from the other three 21SHL transgenic lines and the other four 21SHL-CL transgenic lines were also impaired in their proliferative response to stimulation with CD3e antibody (data not shown), confirming that there were no problems in the integration site of the transgene 32.3 C IP: anti-Myc tag WB: anti-WASP WASP WB: anti-WASP WASP D Fig Expression of anti-WASP scFvs and in vivo interaction between scFvs and WASP in scFv transgenic mice T and B cells (A) Western blot analysis of protein extracts of T and B cells from the spleens of the 21SHL and 21SHL-CL scFv transgenic mice The immunoblot was probed with Myc tag mAb (B, C) In vivo association between scFvs and WASP The scFv 21SHL and 21SHL-CL transgenic T and B cell lysates were immunoprecipitated with WASP mAb and Myc tag mAb and analyzed by Western blotting with Myc tag mAb and WASP mAb Arrowheads indicated secondary antibody cross-reactive nonspecific proteins (D) Both scFv transgenic mice T and B cell lysates were analyzed by Western blotting with WASP antibody Lymphoid development in anti-WASP scFv transgenic mice T-cell development in the spleen can be followed by examining the expression patterns of the CD4 and CD8 surface antigens The population of mature single-positive thymocytes (either CD4+CD8– or CD4–CD8+) was almost the same in wild-type, 21SHL transgenic, and 21SHL-CL transgenic mice (Fig 5C) Likewise the expression pattern of CD3 was nearly the same Furthermore, the percentages of splenic T and B lineage cell populations were normal (Fig 5C) In addition, T lineage cell populations in the thymus and B lineage cell populations in the bone marrow were almost the same for wild-type, 21SHL transgenic and 21SHL-CL transgenic mice (Fig 5D,E) These results FEBS Journal 272 (2005) 6131–6144 ª 2005 The Authors Journal Compilation ª 2005 FEBS 6135 Impaired TCR signaling in anti-WASP scFv Tg mice M Sato et al A B wild 21SHL Tg 1.5 11.7 21SHL-CL Tg 1.5 13.4 1.5 CD8 10.7 24.5 22.1 C 25.8 CD4 7.3 37.9 9.5 35.4 7.6 B220 36.3 33.4 31.5 34.5 CD3 D 85.9 4.1 83.6 3.7 82.3 CD8 3.6 5.5 7.0 8.0 CD4 E 3.6 9.7 4.7 9.1 4.7 B220 7.1 0.4 0.1 0.1 IgM indicate that anti-WASP scFvs not have a marked effect on lymphocyte development Impaired interleukin (IL)-2 production induced by TCR stimulation, but not antigen receptor capping To assess whether the 21SHL and 21SHL-CL scFvs affect IL-2 production induced by TCR stimulation, 6136 Fig Antigen receptor-induced proliferation in anti-WASP scFv transgenic T and B cells, and lymphoid development in anti-WASP scFv transgenic mice (A) T-cell proliferation Splenic T cells from anti-WASP scFv 21SHL transgenic, 21SHL-CL transgenic, WASP15 transgenic and wild-type mice were cultured in medium alone or in the presence of CD3e antibody (B) B-cell proliferation Splenic B cells from anti-WASP scFv 21SHL transgenic, 21SHL-CL transgenic, WASP15 transgenic and wild-type mice were cultured in medium alone or in the presence of IgM antibody F(ab¢)2 or CD40 antibody Each stimulation was performed in the presence of exogenous IL-4 In each experiment, cells were cultured for 48 h, then 10 lM BrdU was added to the T and B-cell cultures The cells were reincubated for an additional 16 h, and BrdU incorporation was quantified by ELISA Values represent means ± SE of triplicate cultures and are representative of three independent experiments Statistical significance is indicated by *(P < 0.05) and **(P < 0.005) (C)–(E) FACS analyses of lymphocytes from wildtype, anti-WASP scFv 21SHL transgenic and 21SHL-CL transgenic mice Two-color flow cytometric analyses were performed on spleen (C), thymus (D) and bone marrow (E) Percentages of representative lymphoid populations are noted The results shown are representative of at least three male mice for each analysis at the age of weeks purified T cells from spleens of wild-type, WASP15 transgenic, 21SHL transgenic and 21SHL-CL transgenic mice were stimulated with immobilized CD3e antibody and IL-2 in the culture supernatant and determined by ELISA T cells expressing 21SHL and 21SHL-CL scFvs were impaired in IL-2 production induced by TCR stimulation, whereas the defect in IL-2 production of scFv transgenic T cells was slight compared with the WASP15 transgenic T cells (Fig 6A) In addtion, purified T cells were incubated in vitro with fluorescein isothiocyanate (FITC)-conjugated CD3e antibody at either 37 °C or °C (stimulation or nonstimulation) to assess whether the 21SHL and 21SHL-CL scFvs affect TCR-induced capping The rate of antigen-receptor capping of T cells was the same in all the mice (Fig 6B) These results indicate that the anti-WASP scFvs 21SHL and 21SHL-CL inhibit the signaling cascade of IL-2 production via TCR stimulation without affecting the regulation of the cytoskeleton, including antigen-receptor capping These findings strongly indicate that IL-2 synthesis is mediated directly by the WASP EVH1 domain and not by secondary events resulting from WASP-mediated actin cytoskeletal rearrangements induced by TCR signaling Subcellular localization of anti-WASP scFvs To examine the subcellular localization of anti-WASP scFvs 21SHL and 21SHL-CL in T cells, cell extracts of their scFv-transgenic T cells were fractionated into the subcellular compartments, cytosolic proteins and FEBS Journal 272 (2005) 6131–6144 ª 2005 The Authors Journal Compilation ª 2005 FEBS M Sato et al Impaired TCR signaling in anti-WASP scFv Tg mice A Fig IL-2 production was impaired, but not antigen receptor capping induced by TCR stimulation (A) Splenic T cells from anti-WASP scFv 21SHL transgenic, 21SHLCL transgenic, WASP15 transgenic and wild-type mice were cultured in medium alone or in the presence of anti-CD3e Ab Each cell culture supernatant was collected at 24 h IL-2 in the supernatant was quantified by ELISA Values are mean ± SE from triplicate cultures and are representative of three independent experiments Statistical significance is indicated by *(P < 0.005) and **(P < 0.001) (B) Splenic T cells from antiWASP scFv 21SHL transgenic, 21SHL-CL transgenic, WASP15 transgenic and wildtype mice were incubated with FITC-conjugated CD3e antibody at either °C or 37 °C for 30 The treated cells were placed on polyethylenimine coated eight-well tissue culture glass slides, fixed, analyzed and photographed at · 100 using confocal microscopy The rate of capping of unstimulated and stimulated T cells was determined by counting the number of caps in  200 cells ⁄ experiment The wild-type and transgenic mice used for these experiments were weeks old B wild WASP-15 21SHL 21SHL-CL unstimulate 20µm 20µm 20µm 20µm 20µm 20µm 20µm 20µm stimulate membrane ⁄ membrane organelles In general, the scFv intrabodies (VH–linker–VL format) with heavy chain signal peptide sequences cross the rough ER membrane and enter the secretory pathway through the trans-Golgi network However, equivalent amounts of scFv 21SHL were detected in both the cytosol and membrane fractions, and most of the scFv 21SHL-CL was detected in the cytosol fraction in anti-WASP scFv transgenic T cells (Fig 7A) To confirm the presence of cross-contamination in both fractions of scFv 21SHL-CL transgenic T cells, each fraction was examined by Western blotting with WASP antibody and Ribophorin I antibody specifically expressed in the cytosolic and membrane fractions, respectively These results show that neither fraction was cross-contaminated (Fig 7A) When scFv intrabodies were expressed in NIH-3T3 fibroblastic cells, the scFvs were localized in the subcellular compartments NIH-3T3 cells were transfected with scFv 21SHL-CL (with leader signal sequence) or 21HL-CL (without leader signal sequence) genes and then their subcellular fractions were subjected to Western blotting with Myc tag antibody The majority of the intrabodies expressed without signal sequence were detected in the cytosol, whereas most of the intrabodies expressed with the signal sequence were detected in the membrane fraction (Fig 7B) These results indicate that the post-translational processing of ER-coupled protein synthesis must be different among cell types such as lymphocytes and fibroblasts On immunostaining, colocalization of 21SHL-CL scFv and endogenous WASP was observed in the cytosol of the scFv DNA transfected T cells (Fig 7C) Again these results indicate that scFv intrabodies expressed with the VH signal peptide sequence are localized in the cytosol of T cells Taken together, the results strongly suggest that scFv intrabodies synthesized in the ER are released from the ER membrane into the cytosol by retro-translocation in lymphocytes including T cells [25] In general, when proteins synthesized in the ER are misfolded or incompletely assembled into oligomeric forms, they are transferred from the lumen of the ER into the cytosol, so-called retro-translocation In the cytosol, the retro-translocated proteins are polyubiquitinated and degraded by proteasomal proteolysis [26–29] Our results suggest that the WASP scFv intrabodies expressed with the VH signal sequence are translocated across the ER membrane into the cytosol without degradation The cell lysates or immunopre- FEBS Journal 272 (2005) 6131–6144 ª 2005 The Authors Journal Compilation ª 2005 FEBS 6137 Impaired TCR signaling in anti-WASP scFv Tg mice M Sato et al anti-WASP scFv-Tg T cell A (kD) C M 40.1 21SHL 32.3 49.9 C: Cytosolic 40.1 M: Membrane/ Organelle 21SHL-CL 87 WASP 50.7 87 Ribophorin I 50.7 anti-WASP scFv transfected NIH-3T3 B 21HL-CL (kD) C 21SHL-CL M C Discussion M 49.9 40.1 C anti-Myc tag D anti-WASP merged image anti-Myc tag (kD) 199 anti-Ub 4 133 87 40.1 31.6 Fig Subcellular localization of anti-WASP scFvs Cell extracts of (A) anti-WASP scFvs transgenic T cells and (B) anti-WASP scFv DNA-transfected NIH-3T3 cells were fractionated into the subcellular compartments, cytosolic proteins and membrane ⁄ membrane organelles The fractionated cell extracts were analyzed by Western blotting with Myc tag, WASP or Ribophorin I antibodies (C) Co-localization of anti-WASP scFv and endogenous WASP in the cytosol of T cells Anti-WASP scFv 21SHL-CL DNA electroporated T cells were fixed and incubated with Myc tag antibody or WASP mAb After being washed, the cells were stained with FITC-conjugated anti-rabbit IgG or Alexa Fluor 546-conjugated anti-mouse IgG The treated cells were analyzed and photographed at · 100 using immunofluorescence microscopy (D) Anti-WASP scFvs were not polyubiquitinated in the scFv transgenic mice T cells Immunoprecipitates with Myc tag antibody (lanes and 2) and cell lysates (lanes and 4) from anti-WASP scFv 21SHL transgenic (lanes and 3) or 21SHL-CL transgenic (lanes and 4) mice T cells were analyzed by Western blotting with Myc tag or ubiquitin antibody The smear bands (arrow) indicate polyubiquitination of nonspecific proteins in the T cells The arrowhead indicates secondary antibody cross-reactive nonspecific proteins 6138 cipitates with Myc tag antibody were immunoblotted with ubiquitin antibody to determine if polyubiquitination of the anti-WASP scFv 21SHL and 21SHL-CL occurs in the T cells 21SHL and 21SHL-CL were not polyubiquitinated in the scFv-transgenic T cells However, the polyubiquitination of nonspecific proteins was observed in the scFv-transgenic T cell lysate (Fig 7D) These results indicate that the scFv genes with signal sequence are translated in the ER, and, after cleavage of the signal peptide sequence, are translocated from the ER into the cytosol without polyubiquitination and degradation In this study, we show that the scFv intrabodies constructed with a leader signal sequence at the N-terminus inhibited the domain function of a cytosolic protein, and preserved the strong binding activity for target molecules under the reducing conditions of the cytosol in scFv-transgenic lymphocytes This study also demonstrates that the successful expression of intrabodies in the cytosol is related to translational efficiency, post-translational processing, and modification of scFvs We constructed several scFvs with or without the N-terminal leader signal sequence of the VH region and with or without the CL(j) region following the VL region (Fig 2B) Fusion of scFvs with the CL(j) region has already been shown to increase intracellular stability and target protein inactivation in some cases, but not all [30,31] scFvs containing the VH signal sequence and CL(j) region (SHL or SHL-CL formats) were highly expressed in T cells compared with scFvs not containing the VH signal sequence (HL or HL-CL formats) (Fig 3A) Binding activity of 18SHL ⁄ SHL-CL and 21SHL ⁄ SHL-CL scFvs was detected, but not in the HL ⁄ HL-CL formats, by in vitro binding assay using GST pull-down (Fig 3B) These results strongly suggest that scFvs with the native VH signal sequence and CL(j) region increase the binding capabilities of scFv intrabodies in T cells In this study, we established two hybridoma cell lines (clones 18 and 21) producing WASP EVH1 mAbs which were able to equivalently immunoprecipitate with native WASP in T cells Then we isolated cDNA fragments for assembling anti-WASP scFvs from them Although the expression levels of 18SHL ⁄ SHL-CL and 21SHL ⁄ SHL-CL were almost the same in the scFv gene-transfected T cells, 21SHL ⁄ SHL-CL bound more strongly to GST-WASP15 than 18SHL ⁄ SHL-CL (Fig 3A,B) Furthermore, a strong interaction between native WASP and 21SHL ⁄ SHL-CL scFvs was detected FEBS Journal 272 (2005) 6131–6144 ª 2005 The Authors Journal Compilation ª 2005 FEBS M Sato et al by immunoprecipitaion analysis, whereas 18SHL ⁄ SHL-CL scFvs and other scFvs were not able to associate with the native WASP in vivo (Fig 3C) Also, the EVH1 domain-specific binding of 21SHL ⁄ SHL-CL was demonstrated (Fig 3D) These results indicate that the differences in in vivo binding activity between 18SHL ⁄ SHL-CL and 21SHL ⁄ SHL-CL may be due to folding This structural property is necessary for antigen binding, when antibody fragments are converted into the scFv format and expressed in the reducing environment of the cytosol The primary mechanism for protein degradation of misfolded proteins is the ubiquitin–proteasome system which governs the quality control of proteins Misfolded proteins synthesized by cotranslational or posttranslational events in the ER are retro-translocated from the ER into the cytosol and rapidly degraded after polyubiquitination [26–29] Immunoglobulin heavy and light chains are cotranslated and assembled with disulfide bonds in the ER lumen An ER resident chaperone, Bip, binds to the constant region of immunoglobulin and stabilizes and maintains the integrity of the immunoglobulin form [32,33] Bip contains the ER retention signal sequence KDEL (Lys-Asp-Glu-Leu) at the C-terminus and elaborates the tertiary structure of immunoglobulin during translocation from the ER to the secretory pathway In general, it was thought that the scFv intrabodies constructed with leader signal sequences cross the rough ER membrane and enter the secretory pathway through the trans-Golgi network However, in this study the majority of scFvs were detected in the cytosolic fraction (Fig 7A), and not in the T-cell culture supernatant (data not shown) These results indicate that the scFvs constructed with the signal sequence can be transferred from the ER to the cytosol by retro-translocation without polyubiquitination and proteasome degradation We propose two possible interpretations of these results One is that ubiquitination is not coupled with retro-translocation as has been shown for cholera toxin release from the ER into the cytosol accompanied by rapid folding [34] The other is that the scFv modifications of the N-terminal residues occur after cleavage of the signal sequence in the ER In MyoD, which is a tissue-specific transcriptional activator that acts as a master switch for muscle development, modification of the N-terminal residue protects it from ubiquitination and protein degradation irrespective of the presence of internal lysine residues [35] In T cells, scFvs constructed with the VH signal sequence seem to be modified at the N-terminal residue after cleavage of the signal peptide sequence in the ER However, we Impaired TCR signaling in anti-WASP scFv Tg mice have not yet confirmed the N-terminal amino-acid sequence of scFvs by the Edman method Interestingly, when NIH-3T3 cells were transfected with the 21SHL-CL scFv (containing the VH signal sequence) or the 21HL-CL scFv (not containing the VH signal sequence), most of the 21SHL-CL scFv was detected in the membrane fraction, whereas the 21HLCL scFv accumulated in the cytosol (Fig 7B) These results indicate that the mechanisms of retro-translocation differ among different cell types Although we not know the mechanisms leading to retro-translocation without proteasome degradation, the scFv intrabodies constructed with signal sequences may be designed for practical use in functional knockdown of cytosolic proteins in T cells T cells from WASP-deficient mice showed a marked reduction in antigen receptor capping accompanied by actin polymerization and IL-2 production induced by TCR stimulation It has been hypothesized that defects in IL-2 production in WASP-deficient T cells may be a secondary phenomenon resulting from defects in actin remodeling and immune synapse formation induced by TCR stimulation [17,18,36,37] However, we previously demonstrated that T cells from WASP15 transgenic mice that overexpress WASP-EVH1 domain were impaired with respect to proliferation and IL-2 production induced by TCR stimulation, but antigen receptor capping and actin polymerization were normal [24] This suggest the direct involvement of the EVH1 domain in the IL-2 synthesis pathway In the present study, purified anti-WASP scFv 21SHL and 21SHL-CL transgenic T cells were impaired with respect to proliferation and IL-2 production induced by CD3e antibody stimulation (Figs 5A and 6A) In terms of cytoskeletal rearrangement, normal antigen receptor capping induced by CD3e antibody stimulation was observed similar to the wild-type and WASP15 transgenic mice T cells (Fig 6B) These results indicate that the role of WASP in regulating IL-2 production is independent of its role in immune synapse formation The following experimental data support this hypothesis WASP-deficient T cells form conjugates with antigen-specific B cells normally and can form immune synapses accompanied by polarization of cytoskeleton-regulating proteins, but defects in IL-2 production are observed [38] Furthermore, analysis of a series of WASP-deletion mutants shows that the WASP homology-1 (WH1) ⁄ EVH1 domain is responsible for NF-AT transcriptional activation [39] These findings indicate that the functions of WASP may be more complex than previously believed The inability of WASP-deficient, WASP15 transgenic, and anti-WASP scFv 21SHL ⁄ SHL-CL transgenic FEBS Journal 272 (2005) 6131–6144 ª 2005 The Authors Journal Compilation ª 2005 FEBS 6139 Impaired TCR signaling in anti-WASP scFv Tg mice M Sato et al T cells to proliferate in response to TCR stimulation is similar to the defects observed in T cells from Vavdeficient mice [40,41] It has been previously shown that Vav is a potent regulator of the IL-2 promoter, in particular NF-AT ⁄ AP-1-mediated gene transcription [42] Furthermore, the WASP-interacting protein (WIP) and WASP interaction is important for Vavmediated activation of NF-AT ⁄ AP-1 gene transcription induced by TCR stimulation [43] WIP-deficient T cells were impaired in proliferation and immune synapse formation induced by TCR stimulation [44] It is possible that the overexpressed WASP15 and antiWASP 21SHL ⁄ SHL-CL scFvs inhibit WIP and endogenous WASP interactions, because the WIP-binding site in endogenous WASP is included in WASP15 and may overlap the target region of our anti-WASP scFvs The molecules that interact with the EVH1 domain which overlaps our scFv intrabody-binding epitope need to be identified We examined the effects of anti-WASP 21 SHL ⁄ SHL-CL scFvs on lymphocyte development and B-cell function The anti-WASP scFvs did not have a marked effect on lymphocyte development (Fig 5C–E) Furthermore, B cells from anti-WASP 21 SHL ⁄ SHL-CL scFv transgenic mice proliferated normally in response to stimulation by IgM and CD40 antibodies (Fig 5B) B cells from WASP-deficient and WASP15 transgenic mice also proliferated normally after IgM antibody stimulation [17,18,24] We have not yet clarified the significance of WASP expression in B lymphocytes Finally, we demonstrate here that scFv intrabodies bind to the EVH1 domain of WASP and inhibit IL-2 synthesis in T cells Therefore, scFv intrabodies should be valuable tools for identifying novel protein functions, and transgenic mice that express scFv intrabodies may be useful in functional knockdown models Experimental procedures Construction of GST fusion protein and mAb preparation A cDNA fragment for mouse WASP exon 1–5 (amino acids 1–171) which includes the EVH1 domain (designated WASP15) was generated by PCR (sense primer, 5¢-CGA ATGCGGCCGCAATGAATAGTGGCCCTG-3¢; reverse primer, 5¢-CGAATGCGGCCGCTCACTCCTCATTGATT GG-3¢) [24], digested with NotI, and subcloned into the pGEX-4T-2 expression vector (Amersham Biosciences, Piscataway, NJ, USA) The GST-WASP15 fusion protein was produced in BL21 Escherichia coli cells and purified on a glutathione–Sepharose 4B affinity chromatography column (Amersham Biosciences) according to the manufacturer’s 6140 instructions mAbs were prepared from mice immunized with GST-WASP15 fusion protein by the conventional procedure Cloning and construction of WASP-EVH1 scFv intrabodies We identified subtype mAbs (18, 21) using a mouse mAb isotyping kit IsoStrip (Roche Diagnostics, Mannheim, Germany) We performed a four-step PCR to generate appropriate cDNA fragments that encoded the VH and VL region Total RNA from hybridoma cells was reverse-transcribed using the SMARTTM RACE cDNA Amplification Kit (Clontech, Palo Alto, CA, USA) The cDNA fragments for the VH and VL regions containing the leader signal sequence and CH1 or CL constant region sequences were generated by PCR using subtype-specific primers (heavy chain, clone 18, IgG3: sense primer 5¢-CTAATACGACTC ACTATAGGGCAAGCAGTGGTATCAACGCAGAGT-3¢ and reverse primer 5¢-GTACTGGGCTTGGGTATTCT AGGCTC-3¢; clone 21, IgG2b: sense primer 5¢-AAGCAG TGGTATCAACGCAGAGTACGCG-3¢ and reverse primer 5¢-GGACAGGGGTTGATTGTTGAAATGGG-3¢; light chain, clone 18 and 21, j: sense primer 5¢-CTAATAC GACTCACTATAGGGCAAGCAGTGGTATCAACGCA GAGT-3¢ and reverse primer 5¢-CCTGTTGAAGCTCTTG ACAATGGGTG-3¢) The second PCR products for VH region were classified into two forms containing the native VH leader signal sequence at the 5¢ end of the VH fragment (SVH form) or no VH leader signal sequence (VH form) The second PCR amplification was performed with the following primers: 18SVH, sense primer and reverse primer 2; 18VH, sense primer and reverse primer 2; 21SVH, sense primer and reverse primer 5; 21VH, sense primer and reverse primer 5; 18VL, sense primer and reverse primer 8; 21VL, sense primer and reverse primer 10 Primer sequences are shown in the legend to Fig The third PCR products were amplified using the following primers: 18SVH–linker, sense primer and reverse primer 11; 18VH– linker, sense primer and reverse primer 11; 21SVH–linker, sense primer and reverse primer 12; 21VH–linker, sense primer and reverse primer 12; linker)18VL, sense primer 13 and reverse primer 8; linker)21VL, sense primer 14 and reverse primer 10 The third PCR products were mixed in the following combinations: 18SVH–linker and linker) 18VL, 18VH–linker and linker)18VL, 21SVH–linker and linker)21VL, 21VH–linker and linker)21VL and singlechain antibodies, scFvs, designated 18SHL, 18HL, 21SHL, and 21HL assembled by the fourth PCR amplification using the following primers: 18SHL, sense primer and reverse primer 8; 18HL, sense primer and reverse primer 8; 21SHL, sense primer and reverse primer 10; 21HL, sense primer and reverse primer 10 The fourth PCR products were digested with HindIII–NotI and cloned into the pCAGGS-MCS expression vector [45,46] The Myc tag FEBS Journal 272 (2005) 6131–6144 ª 2005 The Authors Journal Compilation ª 2005 FEBS M Sato et al (EQKLISEEDL) was generated as follows: coding linker containing a NotI site at the 5¢ end of the linker (5¢-GGC CGCAGGTTCGGAGCAGAAGCTGATCAGCGAGGAG GACCTGTAG-3¢) and noncoding linker containing an EcoRI site at the 5¢ end of the linker (5¢-AATTCTACAGG TCCTCCTCGCTGATCAGCTTCTGCTCCGAACCTGC-3¢) were annealed and inserted into the NotI ⁄ EcoRI site of all pCAG ⁄ anti-WASP EVH1 scFvs All anti-WASP scFvs were fused with the Myc tag at the C-terminus Moreover, to generate a cDNA fragment for the CL(j) region, total RNA from hybridoma producing clone 18 mAb was reverse-transcribed and a two-step PCR amplification performed using the following primers: first PCR, sense primer 5¢-GAGGCACCAAGCTGGAAATCAAACGG-3¢ and reverse primer 5¢-TGGTGGTGGCGTCTCAGGACCT TTG-3¢; second (nested) PCR, sense primer 5¢-CGAATGC GGCCGCAGCTGATGCTGCACCAACTGTATCC-3¢ and reverse primer 5¢-CGAATGCGGCCGCACACTCATTCC TGTTGAAGCTCTTGAC-3¢ The PCR product for the CL(j) region was digested with NotI and cloned into the NotI site between the scFv and Myc tag sequences These constructs were designated pCAG ⁄ 18SHL-CL, 18HL-CL, 21SHL-CL and 21HL-CL, respectively All scFv constructs were confirmed by DNA sequencing analysis A DNA construct, pCAG ⁄ T7-WASP15 [24], which contained T7-tagged WASP exon 1–5, was used for evaluation of EVH1 domain-specific binding Cells and electroporation ⁄ transfection The T-cell hybridoma DO-11.10 [47] was maintained in RPMI 1640 medium supplemented with 10% fetal calf serum, 100 mL)1 penicillin, 100 lgỈmL)1 streptomycin, mm l-glutamine, 50 lm 2-mercaptoethanol (2-ME) and 10 mm Hepes (all obtained from Gibco, Carlsbad, CA, USA) DO-11.10 cells, adjusted to a concentration of · 106 cells ⁄ 400 lL culture medium with 1.25% dimethyl sulfoxide per cuvette, were electroporated using a Gene Pulser (BioRad, Hercules, CA, USA) with 40 lg plasmid DNA at 290V and 960lF NIH-3T3 cells were maintained in Dulbecco’s modified Eagle’s medium supplemented with 10% fetal calf serum, 50 mL)1 penicillin, 50 lgỈmL)1 streptomycin and mm l-glutamine NIH-3T3 cells adjusted to a concentration of · 106 cells ⁄ 10 cm dish were transfected with 10 lg plasmid DNA using FuGENE Transfection Reagent (Roche Diagnostics) Immunoprecipitation and Western blot analysis The electroporated T cells and anti-WASP scFv transgenic T and B cells were lysed with digitonin buffer (10 mm triethanolamine, 10 mm iodoacetoamide, 1% digitonin, 0.15 m NaCl, mm EDTA, and CompleteTM protease inhibitor cocktail; Roche Diagnostics), incubated with lgỈmL)1 WASP mAb (Santa Cruz Biotechnology, Santa Cruz, CA, Impaired TCR signaling in anti-WASP scFv Tg mice USA), Myc tag mAb (MBL, Nagoya, Japan) or biotinylated T7 tag mAb (Novagen, Madison, WI, USA) and immunoprecipitated by the addition of 40 lL protein G–Sepharose or streptavidin–agarose (Upstate, Charlottesville, VA, USA) The cell lysates and immunoprecipitates were separated by SDS ⁄ PAGE (12.5% gel) and transferred to a polyvinylidene difluoride membrane (Bio-Rad) Blots were probed with Myc tag mAb, WASP mAb, T7 tag mAb, Ribophorin I mAb and ubiquitin mAb (Santa Cruz Biotechnology), followed by horseradish peroxidase-conjugated anti-mouse or anti-rabbit IgG (Dako, Glostrup, Denmark) Immunoreactive proteins were detected by ECL (Amersham Biosciences) Assay of GST fusion protein binding After 48 h of electroporation, cell lysates (1 · 107 cells) were prepared by lysis with 10 mm Tris/HCl, pH 7.8, 1% NP-40, 0.15 m NaCl, mm EDTA and CompleteTM protease inhibitor cocktail (TNE) buffer, cleared by centrifugation, and treated with excess glutathione–Sepharose beads (Amersham Biosciences) The precleared cell lysates were incubated at °C overnight with glutathione–Sepharose beads bound to 50 lg GST fusion proteins Beads were washed with TNE buffer, lysed with SDS sample buffer, and immunoblotted with Myc tag mAb Generation of transgenic mice The transgene was excised from the plasmid vector with SalI ⁄ NheI restriction enzyme, purified by agarose gel electrophoresis and a QIAquick Gel Extraction kit (Qiagen, Hilden, Germany), adjusted to a final concentration of lgỈmL)1, and microinjected into the fertilized egg pronuclei of C57BL ⁄ 6J inbred strain mice The injected eggs were then transferred into the oviducts of pseudopregnant female ICR mice Antigen receptor stimulation T and B cells were purified from WASP15 transgenic, anti-WASP scFv transgenic mice spleens or age-matched wild-type control mice by magnetic cell sorting using autoMACSTM (Miltenyi Biotec, Bergisch Gladbach, Germany) according to the manufacturer’s instructions T and B cells were isolated by negative or positive selection using microbeads conjugated to mouse CD45R (B220) antibodies (Miltenyi Biotech) The cell purity of both the resulting populations exceeded 90%, as confirmed by FACS analysis For the T-cell proliferation assay, CD3e antibodies (145– 2C11; BD PharMingen, San Diego, CA, USA) were adhered to 96-well tissue culture plates by incubating 20 lgỈmL)1 in NaCl ⁄ Pi, pH 8.0, at °C for h, after which the plates were washed with NaCl ⁄ Pi, pH 7.2 Purified T cells were added to the antibody-coated wells (5 · 104 cells ⁄ well) and cultured at FEBS Journal 272 (2005) 6131–6144 ª 2005 The Authors Journal Compilation ª 2005 FEBS 6141 Impaired TCR signaling in anti-WASP scFv Tg mice M Sato et al 37 °C in RPMI 1640 medium containing 10% fetal calf serum For the B-cell proliferation assay, B cells were cultured in 96-well tissue culture plates (5 · 104 cells ⁄ well) in culture medium alone or in the presence of mouse IgM antibody F(ab¢)2 (10 lgỈmL)1; Jackson ImmunoReseach Laboratories, West Grove, PA, USA) and CD40 antibody (10 lgỈmL)1; BD Pharmingen) Each stimulation was performed in the presence of exogenous IL-4 (2 ngỈmL)1; PeproTech, London, UK) After 48 h of incubation, 10 lm 5-bromo-2¢-deoxyuridine (BrdU) was added to the T and B cell cultures The cells were reincubated for an additional 16 h, and then BrdU incorporation during DNA synthesis in proliferating cells was quantified by Cell Proliferation ELISA (Roche Diagnostics) as described by the manufacturer For evaluation of cytokine production, purified T cells from the spleens of wild-type, WASP15 transgenic or anti-WASP scFv transgenic mice were cultured on CD3e antibody-coated 48-well tissue culture plates The cell culture supernatant was collected at 24 h IL-2 in the supernatant was quantified by ELISA using OptEIA set for mouse cytokine (BD Pharmingen) according to the manufacturer’s instructions FACS analysis Single-cell suspensions of lymphoid cells were prepared and stained with antibodies following standard procedures Antibodies to CD3, CD4, CD8, IgM or B220 (polyethylene or FITC conjugated; Immunotech, Marselle, France) were used to stain the cells into the subcellular compartments, cytosolic proteins and membrane ⁄ membrane organelles, by differential solubilities using a ProteoExtractTM Subcellular Proteome Extraction Kit (Calbiochem, San Diego, CA, USA) according to the manufacturer’s instructions Subcellular localization of scFv intrabodies was analyzed by Western blotting using the fractionated extracts Immunostaining After 48 h of scFv DNA electroporation, cells were placed on polyethylenimine-coated eight-well tissue culture glass slides (5 · 104 cells ⁄ well), fixed with 95% ethanol ⁄ acetic acid (99 : 1, v ⁄ v) at °C for 15 min, and blocked with NaCl ⁄ Pi containing 1% BSA and 5% normal goat serum (Sigma-Aldrich) for 15 Then cells were incubated with Myc tag mAb or WASP mAb and stained with FITC-conjugated anti-rabbit IgG (Biosource, Camarillo, CA, USA) and Alexa Fluor 546-conjugated antimouse IgG (Molecular Probes, Eugene, OR, USA) after being washed with NaCl ⁄ Pi ⁄ 0.05% Tween 20 The cells were photographed at · 100 by immunofluorescence microscopy (DM RBE; Leica Microsystems, Wetzlar, Germany) Statistical analysis Statistical significance was assessed using Student’s t test The differences were considered significant when P values were less than 0.05 T-cell capping Purified T cells from the spleens of wild-type, WASP15 transgenic or anti-WASP scFv transgenic mice were incubated in RPMI 1640 culture medium containing lgỈmL)1 FITC-conjugated CD3e antibody (145–2C11; BD Pharmingen) at either 37 °C or °C for 30 The treated cells (5 · 104 cells) were placed on polyethylenimine-coated eight-well tissue culture glass slides (BD Falcon, Bedford, MA, USA) that were preincubated with 0.01% polyethylenimine (Sigma-Aldrich, St Louis, MO, USA) at room temperature for h and dried at °C overnight They were then fixed in 3.5% paraformaldehyde (Sigma-Aldrich) After being washed with NaCl ⁄ Pi, cells were sealed with coverslips and immediately analyzed and photographed at · 100 by confocal microscopy (FV300; Olympus, Tokyo, Japan) The rate of capping of unstimulated and stimulated T cells was determined by counting the number of caps in  200 cells ⁄ experiment Subcellular localization of scFv intrabodies Cell extracts of anti-WASP scFv transgenic T cells and scFv DNA-transfected NIH-3T3 cells were fractionated 6142 Acknowledgements We thank Dr H Ohba for helpful discussions This work was supported by a Coordination Fund from the Ministry of Education, Culture, Sports, Science and Technology, Japan (to K.S and Y.K.) Dr R Iwaya died in September 2004 This paper is dedicated to his memory References Bird RE, Hardman KD, Jacobson JW, Johnson S, Kaufman BM, Lee SM, Lee T, Pope SH, Riordan GS & Whitlow M (1988) Single-chain antigen-binding proteins Science 242, 423–426 Huston S, Levinson D, Mudgett-Hunter M, Tai MS, Novotny J, Margolies MN, Ridge RJ, Bruccoleri RE, Haber E, Crea R & Oppermann H (1988) Protein engineering of antibody binding sites: recovery of specific activity in an anti-digoxin single-chain Fv analogue produced in Escherichia coli Proc Natl Acad Sci USA 85, 5879–5883 FEBS Journal 272 (2005) 6131–6144 ª 2005 The Authors Journal Compilation ª 2005 FEBS M Sato et al Barbas CF III, Kang AS, Lerner RA & Benkovic SJ (1991) Assembly of combinatorial antibody libraries on phage surfaces: the gene III site Proc Natl Acad Sci USA 88, 7978–7982 Zhu H, Biligin M & Snyder M (2003) Proteomics Annu Rev Biochem 72, 783–812 Tuschl T (2002) Expanding small RNA interference Nat Biotechnol 20, 446–448 Marasco WA, Haseltine WA & Chen SY (1993) Design, intracellular expression, and activity of a human antihuman immunodeficiency virus type gp120 singlechain antibody Proc Natl Acad Sci USA 90, 7889–7893 Steinberger P, Andris-Widhopf J, Buhler B, Torbett BE & Barbas CF III (2000) Functional deletion of the CCR5 receptor by intracellular immunization produces cells that are refractory to CCR5-dependent HIV-1 infection and cell fusion Proc Natl Acad Sci USA 97, 805–810 Richardson JH, Sodroski JG, Waldmann TA & Marasco WA (1995) Phenotypic knockout of the highaffinity human interleukin receptor by intracellular single-chain antibodies against the alpha subunit of the receptor Proc Natl Acad Sci USA 92, 3137–3141 Mhashilkar AM, Doebis C, Seifert M, Busch A, Zani C, Soo Hoo J, Nagy M, Ritter T, Volk HD & Marasco WA (2002) Intrabody-mediated phenotypic knockout of major histocompatibility complex class I expression in human and monkey cell lines and in primary human keratinocytes Gene Ther 9, 307–319 10 Tanaka T & Rabbitts TH (2003) Intrabodies based on intracellular capture frameworks that bind the RAS protein with high affinity and impair oncogenic transformation EMBO J 22, 1025–1035 11 Caron de Fromentel C, Gruel N, Venot C, Debussche L, Conseiller E, Dureuil C, Teillaud JL, Tocque B & Bracco L (1999) Restoration of transcriptional activity of p53 mutants in human tumour cells by intracellular expression of anti-p53 single chain Fv fragments Oncogene 18, 551–557 12 Alvarez RD, Barnes MN, Gomez-Navarro J, Wang M, Strong TV, Arafat W, Arani RB, Johnson MR, Roberts BL, Siegal GP, et al (2000) A cancer gene therapy approach utilizing an anti-erbB-2 single-chain antibodyencoding adenovirus (AD 21): a phase I trial Clin Cancer Res 6, 3081–3087 13 Worn A & Pluckthun A (2001) Stability engineering of antibody single-chain Fv fragments J Mol Biol 305, 989–1010 14 Ochs HD, Slichter SJ, Harker LA, Von Behrens WE, Clark RA & Wedgwood RJ (1980) The Wiskott–Aldrich syndrome: studies of lymphocytes, granulocytes, and platelets Blood 55, 243–252 15 Remold-O’Donnell E, Rosen FS & Kenney DM (1996) Defects in Wiskott–Aldrich syndrome blood cells Blood 87, 2621–2631 Impaired TCR signaling in anti-WASP scFv Tg mice 16 Molina IJ, Sancho J, Terhorst C, Rosen FS & RemoldO’Donnell E (1993) T cells of patients with the Wiskott–Aldrich syndrome have a restricted defect in proliferative responses J Immunol 151, 4383–4390 17 Snapper SB, Rosen FS, Mizoguchi E, Cohen P, Khan W, Liu CH, Hagemann TL, Kwan SP, Ferrini R, Davidson L, et al (1998) Wiskott–Aldrich syndrome protein · deficient mice reveal a role for WASP in T but not B cell activation Immunity 9, 81–91 18 Zhang J, Shehabeldin A, da Cruz LA, Butler J, Somani AK, McGavin M, Kozieradzki I, dos Santos AO, Nagy A, Grinstein S, et al (1999) Antigen receptor-induced activation and cytoskeletal rearrangement are impaired in Wiskott–Aldrich syndrome protein · deficient lymphocytes J Exp Med 190, 1329–1342 19 Symons M, Derry JM, Karlak B, Jiang S, Lemahieu V, Mccormick F, Francke U & Abo A (1996) Wiskott– Aldrich syndrome protein, a novel effector for the GTPase CDC42Hs, is implicated in actin polymerization Cell 84, 723–734 20 Rivero-Lezcano OM, Marcilla A, Sameshima JH & Robbins KC (1995) Wiskott–Aldrich syndrome protein physically associates with Nck through Src homology domains Mol Cell Biol 15, 5725–5731 21 She HY, Rockow S, Tang J, Nishimura R, Skolnik EY, Chen M, Margolis B & Li W (1997) Wiskott–Aldrich syndrome protein is associated with the adapter protein Grb2 and the epidermal growth factor receptor in living cells Mol Biol Cell 8, 1709–1721 22 Banin S, Truong O, Katz DR, Waterfield MD, Brickell PM & Gout I (1996) Wiskott–Aldrich syndrome protein (WASp) is a binding partner for c-Src family proteintyrosine kinases Curr Biol 6, 981–988 23 Blanchoin L, Amann KJ, Higgs HN, Marchand JB, Kaiser DA & Pollard TD (2000) Direct observation of dendritic actin filament networks nucleated by Arp2 ⁄ complex and WASP ⁄ Scar proteins Nature 404, 1007– 1011 24 Sato M, Tsuji NM, Gotoh H, Yamashita K, Hashimoto K, Tadotsu N, Yamanaka H, Sekikawa K & Hashimoto Y (2001) Overexpression of the Wiskott–Aldrich syndrome protein N-terminal domain in transgenic mice inhibits T cell proliferative responses via TCR signaling without affecting cytoskeletal rearrangements J Immunol 167, 4701–4709 25 Tsai B, YeY & Rapoport TA (2002) Retro-translocation of proteins from the endoplasmic reticulum into the cytosol Nat Rev Mol Cell Biol 3, 246–255 26 Hershko A, Ciechanover A & Varshavsky A (2000) The ubiquitin system Nat Med 6, 1037–1081 27 Weissman AM (2001) Themes and variations on ubiquitylation Nat Rev Mol Cell Biol 2, 169–178 28 Coux O, Tanaka K & Goldberg AL (1996) Structure and function of the 20S and 26S proteasomes Annu Rev Biochem 65, 801–847 FEBS Journal 272 (2005) 6131–6144 ª 2005 The Authors Journal Compilation ª 2005 FEBS 6143 Impaired TCR signaling in anti-WASP scFv Tg mice M Sato et al 29 Ellgaard L & Helenius A (2003) Quality control in the endoplasmic reticulum Nat Rev Mol Cell Biol 4, 181– 191 30 Mhashilkar AM, Bagley J, Chen SY, Szilvay AM, Helland DG & Marasco WA (1995) Inhibition of HIV-1 Tat-mediated LTR transactivation and HIV-1 infection by anti-Tat single chain intrabodies EMBO J 14, 1542– 1551 31 Zhu Q, Zeng C, Huhalov A, Yao J, Turi TG, Danley D, Hynes T, Cong Y, DiMattia D, Kennedy S, et al (1999) Extended half-life and elevated steady-state level of a single-chain Fv intrabody are critical for specific intracellular retargeting of its antigen, caspase-7 J Immunol Methods 231, 207–222 32 Munro S & Pelham HR (1986) An Hsp70-like protein in the ER: identity with the 78 kd glucose-regulated protein and immunoglobulin heavy chain binding protein Cell 46, 291–300 33 Flynn GC, Pohl J, Flocco MT & Rothman JE (1991) Peptide-binding specificity of the molecular chaperone BiP Nature 353, 726–730 34 Lencer WI & Tsai B (2003) The intracellular voyage of cholera toxin: going retro Trends Biochem Sci 28, 639– 645 35 Breitschopf K, Bengal E, Ziv T, Admon A & Ciechanover A (1998) A novel site for ubiqitination: the N-terminal residue, and not internal lysines of MyoD, is essential for conjugation and degradation of the protein EMBO J 17, 5964–5973 36 Dustin ML & Cooper JA (2000) The immunological synapse and the actin cytoskeleton: molecular hardware for T cell signaling Nat Immunol 1, 23–29 37 Krawczyk C & Penninger JM (2001) Molecular controls of antigen receptor clustering and autoimmunity Trends Cell Biol 11, 212–220 38 Cannon JL & Burkhardt JK (2004) Differential roles for Wiskott–Aldrich syndrome protein in immune synapse formation and IL-2 production J Immunol 173, 1658–1662 6144 39 Silvin C, Belisle B & Abo A (2001) A role for Wiskott– Aldrich syndrome protein in T-cell receptor-mediated transcriptional activation independent of actin polymerization J Biol Chem 276, 21450–21457 40 Fischer KD, Kong YY, Nishina H, Tedford K, Marengere LE, Kozieradzki I, Sasaki T, Starr M, Chan G, Gardener S, et al (1998) Vav is a regulator of cytoskeletal reorganization mediated by the T-cell receptor Curr Biol 8, 554–562 41 Holsinger LJ, Graef IA, Swat W, Chi T, Bautista DM, Davidson L, Lewis RS, Alt FW & Crabtree GR (1998) Defects in actin-cap formation in Vav-deficient mice implicate an actin requirement for lymphocyte signal transduction Curr Biol 8, 563–572 42 Wu J, Katzav S & Weiss A (1995) A functional T-cell receptor signaling pathway is required for p95vav activity Mol Cell Biol 15, 4337–4346 43 Savoy DN, Billadeau DD & Leibson PJ (2000) WIP, a binding partner for Wiskott–Aldrich syndrome protein, cooperates with Vav in the regulation of T cell activation J Immunol 164, 2866–2870 44 Anton IM, de la Fu nte MA, Sims TN, Freeman S, Ramesh N, Hartwig JH, Dustin ML & Geha RS (2002) WIP deficiency reveals a differential role for WIP and the actin cytoskeleton in T and B cell activation Immunity 16, 193–204 45 Niwa H, Yamamura K & Miyazaki J (1991) Efficient selection for high-expression transfectants with a novel eukaryotic vector Gene 108, 193–199 46 Takemoto Y, Furuta M, Sato M, Kubo M & Hashimoto Y (1999) Isolation and characterization of a novel HS1 SH3 domain binding protein, HS1BP3 Int Immunol 11, 1957–1964 47 Shimonkevitz R, Kappler J, Marrack P & Grey H (1983) Antigen recognition by H-2-restricted T cells I Cell-free antigen processing J Exp Med 158, 303–316 FEBS Journal 272 (2005) 6131–6144 ª 2005 The Authors Journal Compilation ª 2005 FEBS ... bind to the target 6132 proteins on the lumen side and inhibit transport of target proteins in the process of functional maturation [6,8] If the targets are cytosolic proteins, scFvs without the. .. 5¢-CACCCAAGCTT GCCACCATGGAGGTTCAGCTGCAGCAGTCTG-3¢; primer 7, 5¢-GGT GGAGGAGGTTCTGATGTTTTGATGACCCAAACTCCAC-3¢; primer 8, 5¢-CGAATGCGGCCGCCCGTTTGATTTCCAGCTTGGTGC-3¢; primer 9, 5¢-GGTGGAGGAGGTTCTGATGTTGTTCTGACCCAAACTCCACTC-3¢;... None of the constructs contained the KDEL sequence at the C-terminus We compared the quantity of scFv intrabodies and assessed their binding activity to the WASP -EVH1 domain in the scFv gene-transfected