... 5¢-UCAUCGCAUUCC UUGCAAAdTdT-3¢, antisense strand 5¢- UUUGCAAGGAAUGCGAUGAdTdT-3¢; ERa siRNA #3 sense strand 5¢- GGAGAAUGUUGAAACA CAAdTdT-3¢, antisense strand 5¢- UUGUGUUUCAA CAUUCUCCdTdT-3¢ The transfection ... miR-15 and miR-16 induce apoptosis by targeting BCL2 Proc Natl Acad Sci USA 102, 13944–13949 Ma L, Teruya-Feldstein J & Weinberg RA (2007) Tumour invasion and metastasis initiated by microRNA-10b in ... Wang X, Shelton J, Shingara J et al (2007) The let-7 microRNA represses cell proliferation pathways in human cells Cancer Res 67, 7713–7722 Hayashita Y, Osada H, Tatematsu Y, Yamada H, Yanagisawa...
... Lin B: Quantitative proteomics analysis integrated with microarray data reveals that extracellular matrix proteins, catenins, and p53 binding protein are important for chemotherapy response in ... defined as having benign pathology, patients Page of 14 with clear cell and serous ovarian cancer were defined as having cancer and patients diagnosed as having low malignant potential disease ... F, Tanaka Y, Tateishi K, Ikenoue T, Obi S, Sato S, Teratani T, Shiina S, et al: Proteomic analysis of sera from hepatocellular carcinoma patients after radiofrequency ablation treatment Proteomics...
... CGGTTCACTAAACGAGCTCTGCTGCAGaaaaaatccaaaaaaaatctaaaaaaatcttttaaaa aaccccaaaaaaatttacaaaaaaGTCGACaatgc gcattGTCGACttttttgtaaatttttttggggttttttaaaagatttttttagattttttttg gattttttCTGCAGCAGAGCTCGTTTAGTGAACCG Ccttctccccggcggttagtgctgagagtgc aaaaaatccaaaaaaaatctaaaaaaatcttttaaaaaaccccaaaaaaatttacaaaaaa ... Transcription start site β-gal AR S 5’-aaaaaatccaaaaaaaatctaaaaaaatcttttaaaaaaccccaaaaaaatttacaaaaaa-3’ (3) TOP-β-gal CMV Transcription start site β-gal Relative abundace of β-gal A PABP expression during ... aaaaaatccaaaaaaaatctaaaaaaatcttttaaaaaaccccaaaaaaatttacaaaaaa Primer with NcoI site Sense ARS with PstI and SalI Antisense ARS with PstI and SalI TOP ARS Acknowledgements This work was supported by funds from a...
... 19 Matsuno K, Yamada H, Iwata K, Jin D, Katsuyama M, Matsuki M, Takai S, Yamanishi K, Miyazaki M, Matsubara H et al (2005) Nox1 is involved in angiotensin II-mediated hypertension: a study in ... 13438–13442 Katsuyama M, Fan C, Arakawa N, Nishinaka T, Miyagishi M, Taira K & Yabe-Nishimura C (2005) Essential role of ATF-1 in induction of NOX1, a catalytic subunit of NADPH oxidase: involvement ... MEF2binding site, 5¢-CTA (A ⁄ T)4TAG ⁄ A- 3¢, was located (Fig 3A) The introduction of mutations at this site (5¢-CTATAAATAG-3¢ to 5¢-CTATAgccAG-3¢) abolished PGF 2a- induced transcriptional activation...
... adhesion and activation Three such molecules, LAPP (an approximately 13 kDa leech antiplatelet protein isolated from Haementeria officinalis) and calin and saratin (approximately 65 kDa and 12 kDa proteins, ... of saratin as a tool to inhibit platelet–collagen interactions, and may provide the basis for the therapeutic use of saratin as apotent antithrombotic agent Results Delayed collagen-induced aggregation ... Saratin, an inhibitor of collagen–platelet interaction, decreases venous anastomotic intimal hyperplasia ina canine dialysis access model Vasc Endovascular Surg 37, 259– 269 21 Davis JA, Brown AT, Alshafie...
... Painter CA, Covington JW, Dixon JD, Schoenhard JA & Vaughan DE (2004) Tumor necrosis factor alpha activates the human plasminogen activator inhibitor-1 gene through a distal nuclear factor kappaB ... were amplified in triplicate for both b-actin and each of the target genes to create a standard curve Likewise, lL of cDNA was amplified in triplicate in all isolated samples for each primer ⁄ probe ... et al After 48 h cells were treated with TNFa (50 ngÆmL)1) and total cellular RNA isolated h later by using the TRIzol Reagent Statistical analysis All values are expressed as mean ± SE compared...
... grant PI and clinical scoring CA Acquisition of data NKS Statistical analysis AA Interpretation and analysis of data, grant co PI and writing and editing of manuscript All authors read and approved ... VEGF -A (A) and CCL2 (B) in PBMCs of definite, probable and possible ALS patients Values are plotted as mean ± SE (Standard error) in the bar diagram Data was analyzed by one-way analysis of variance ... hand, chemokine ligand-2 (CCL2), a proinflammatory molecule, may impart neuroprotection in ALS against glutamate induced excitotoxicity either by reducing release of glutamate and/or increasing...
... synovial matrix metalloproteinases were significantly downregulated by treatment with infliximab Because matrix metalloproteinases are involved in neovascularization, matrix degradation, and cartilage ... hypervascularity typical of SpA and a reduction of the synovial lining hyperplasia, indicating that infliximab also modulates the structural synovial characteristics of the disease In another study ... years inflammation might be the driving force Invariably, a major improvement in the BASFI has been reported in all studies with infliximab Imaging data, especially by conventional radiographs, are...
... 5'-ACCATGAAAAGTGTGAATGCTTCA-3' and 5'-AGTATCTCCAAAGCTTTGAATAATCACTTTCT-3' TaqMan GAPDH and 18S primers and probes were purchased from Applied Biosystems GAPDH gene expression was used as an endogenous ... from cartilage as described [5] Hydroxyproline release was assayed as a measure of collagen degradation [10] and glycosaminoglycan release was assayed as a measure of proteoglycan degradation ... activation, inhibition, localization and clearance [6] Activation of pro- collagenases isa crucial control point in determining if cartilage collagen resorption occurs [7] Serine proteinases are involved...
... Denys A, Bizzini B, Zagury D, Boissier MC: Early and long-lasting protection from arthritis in tumour necrosis factor alpha (TNFalpha) transgenic mice vaccinated against TNFalpha Ann Rheum Dis 2008, ... analyzed by Spearman rho, and 95% confidence intervals (CIs) were given Histological scores were compared with ANOVA or Kruskal-Wallis and their appropriate post hoc analysis according to data ... Bensussan A, Bizzini B, Gallo RC, Koutouzov S: IFNalpha kinoid vaccine-induced neutralizing antibodies prevent clinical manifestations ina lupus flare murine model Proc Natl Acad Sci USA 2009,...
... therefore potentiate adjuvant therapy It is likely that the chemoresistance properties are potentiated by autocrine and paracrine pathways and facilitated by mitogenic agents Local tissue invasion distinguishes ... nuclear atypia, increased mitotic activity, vascular thrombosis, microvascular proliferation and necrosis Similar to anaplastic astrocytoma, glioblastoma may arise de novo as glioblastoma or may ... (paracrine) In addition, membrane-anchored growth factor isoforms generated by alternative splicing may bind to the same (juxtacrine) or adjacent tumour cells (paracrine) Intracellular interactions...
... breakfast cereals were also included as a source of folate This type of diet is easier to follow on a long-term basis, and may be useful ina general population approach to increasing the intake ... exploratory analytic techniques Basal and follow-up values were measured at the beginning and at the end of each treatment phase, respectively Multivariate analysis of variance (MANOVA) was used ... not attain this daily amount from diet alone In Europe, mean dietary folate intake in adults is 291 µg (range:197-326) for men and 247 µg (range 168-320) for women [19] A reasonable approach...
... Long An, Tiền Giang, An -18- Giang, Kiên Giang, Cà Mau, Sóc Trăng, Bạc Liêu, Đồng Tháp, Bến Tre, Hậu Giang, Vónh Long, Trà Vinh thành phố Cần Thơ Vò trí đ a lí Nam Bộ: ph a bắc tây - bắc giáp Cam-pu-chia, ... ngữ Nam Bộ Như vậy, không gian đ a lí tiếng miền Nam, phương ngữ miền Nam hay phương ngữ Nam tác giả xác đònh rộng Không gian đ a lí phương ngữ Nam Bộ xác đònh hẹp Ranh giới PNNB trùng với ranh ... (từ thû ấy/ đến nay), thû (từ thû ấy/ đến giờ) V a rút gọn v a đảo trật tự câu nghi vấn tính chất, đặc điểm: bao cao (cao bao nhiêu), bao dai (dài bao nhiêu), bao lớn (lớn bao nhiêu)… Rút gọn,...
... 340 Table Cronbach’s alpha (standardized) for the subdomains and the lowest alpha that was reached by deleting an item in that sub-domain with 95% CIs A Schacht et al Sub-domains At baseline At ... were taken into account The sub-domains SS (baseline), 123 EC (baseline and for all visits), IRA (baseline), FI (baseline and for all visits), and SPS (baseline and for all visits) had values ... subdomains (see Tables 4, for the loadings) The factor analysis was based on baseline data only The first factor of the 12 -factor solution mainly consists of items from the subdomains IRA and TA,...
... CTAGCTAGAATTC-3¢ for a1 ; and 5¢-AGGTGATC ATATGCTTCTAGAGAAGAGTGAAATA-3¢ and 5¢-AG AGGATCCTCAGCCCATTTGGAGGGCGG-3¢ for b1 In each case, the forward primer introduced a unique NdeI restriction site that ... Kawakami et al FAD, FMN and ATP-containing amino-acid dehydrogenase (dye-l-proDH) [3,4], and found these enzymes to be highly stable and to exhibit a high potential for application in amino-acid ... ribonuclease A (13.7 kDa) serving as molecular standards (Amersham Bioscience) Analysis of the N-terminal amino-acid sequences The N-terminal amino-acid sequences of the enzymes were analyzed using an automated...
... as potential amidino group acceptors instead of glycine, such as l-alanine, b-alanine, c-aminobutyric acid, ethanolamine, taurine, l-lysine, a- amino-oxyacetic acid and l-norvaline, by measuring ... Ultra Clean Plant DNA Isolation Kit (MoBio, Carlsbad, CA, USA), according to the manufacturer’s instructions PCR amplification of cyrA was performed using primers cyrA-F (5¢-CATATGCAAACAGAATTGTAAATAGCT3¢) ... l-Alanine, b-alanine, c-aminobutyric acid, ethanolamine, taurine, l-lysine, a- amino-oxyacetic acid and l-norvaline were used as amidino group acceptors The limit of detection for the assays was...
... (Ser16Ala and Ser127Ala) and a double-mutant protein (Ser16AlaSer127Ala) In this article, we report that the replacement of both invariant serine residues (Ser16AlaSer127Ala double-mutant protein) ... Ser16AlaSer127Ala double-mutant protein, in contrast to the single-mutant proteins (Ser16Ala and Ser127Ala) is not capable of forming the flavin-derived intermediate The decay rate of the intermediate ... relay system in chorismate synthase G Rauch et al A B Fig Ser16 and Ser127 residues acting ina proton relay system among His106, FMN and EPSP via a water molecule in the chorismate synthase active...