exceptions may be either thrown or caught by a calling method
Báo cáo khoa học: "An Automatic Method for Summary Evaluation Using Multiple Evaluation Results by a Manual Method" pptx
... investigated an automatic method that uses several evaluation results from a manual method based on Kazawa’s and Yasuda’s methods From the experimental results based on Kazawa’s method, we found that ... investigated an automatic method based on Yasuda’s method and found that the method using ROUGE-2 and -3 could accurately estimate manual scores, and could outperform Kazawa’s method and the other automatic ... coefficients, because evaluation scores are not always calculated by a Kazawabased method, which we described in Exp-1 Therefore, we ranked the summaries instead of the summarization systems Two arbitrary...
Ngày tải lên: 17/03/2014, 04:20
Báo cáo hóa học: " Bi-Functional Silica Nanoparticles Doped with Iron Oxide and CdTe Prepared by a Facile Method" doc
... Jun, D.J Zaziski, E.M Chan, A Corrias, A. P Alivisatos, J Am Chem Soc 128, 1675 (2006) doi:10.1021/ ja056139x 25 J Giri, S Guha Thakurta, J Bellare, A Kumar Nigam, D Bahadur, J Magn Magn Mater 293, ... Section Chemical Reagents Tellurium powder was purchased from Shanghai Chemical Reagents Factory, China NaBH4 was commercially available from Guangming Reagent Company, China Ferric chloride (FeCl3 ... indicated the FSCS nanoparticles could also be collected by a magnet The color of the FSCS nanoparticles in Fig 6b was orange, which indicated the quantum dots had been entrapped in the silica matrix...
Ngày tải lên: 22/06/2014, 00:20
Báo cáo y học: "Brain choline concentrations may not be altered in euthymic bipolar disorder patients chronically treated with either lithium or sodium valproate" pps
... seenhuman brain at 3.0 T A A typical A typical 1H-MRS spectrum of the human brain at 3.0 T A number of metabolites can be seen 1: creatine (methylene) + phosphocreatine, 2: glutamate + glutamine, ... Acknowledgements This work was supported in part by peer-reviewed grants from the Canadian Institutes of Health Research (CIHR) and the Alberta Heritage Foundation for Medical Research (AHFMR) References ... myo-inositol and mood in bipolar disorder: a proton magnetic resonance spectroscopic imaging study of the anterior cingulate cortex Bipolar Disord 2000, 2:207-216 Hamakawa H, Kato T, Murashita J, Kato...
Ngày tải lên: 08/08/2014, 20:23
Báo cáo y học: "The association of meat intake and the risk of type 2 diabetes may be modified by body weight"
... or as part of an unfavourable dietary pattern High levels of saturated fat, cholesterol, animal protein, and heme-iron in red meat have all been suggested as reasons behind the higher risk for ... similar results and the test for interaction between processed meat intake and BMI categories was of marginal significance (P=0.08) Processed meats contain preservatives and additives that may ... TM, Harris SB, Harris-Giraldo R, Hanley AJ, Zinman B Specific patterns of food consumption and 19 20 21 22 23 24 25 26 preparation are associated with diabetes and obesity in a Native Canadian...
Ngày tải lên: 31/10/2012, 16:49
Báo cáo khoa học: ADPase activity of recombinantly expressed thermotolerant ATPases may be caused by ppt
... thermophilic archeaons can also use ATP as a phosphoryl transfer donor [9–12] Here we report an apparent ADPase activity in preparations of the recombinant ATPase domain of the AAA+ ATPase NtrC1 ... distantly related ClpX ATPase, and the transcription terminator Rho Hence, the apparent Copurification of NtrC1 ATPase and adenylate kinase ADP hydrolysis was clearly stimulated by a factor that ... the transcriptional activator NtrC1: structural studies of the regulatory and AAA+ ATPase domains Genes Dev 17, 2552–2563 Copurification of NtrC1 ATPase and adenylate kinase 22 Rappas M, Schumacher...
Ngày tải lên: 16/03/2014, 04:20
The Goal Setting ReportA 6-Step Plan to Achieving Your GoalsBy Paul Smithson Smashwords Edition Copyright 2013 Paul Smithson ###Smashwords Edition, License NotesThis ebook is licensed for your personal enjoyment only. This ebook may not be re-sold or pot
... important phase in your life In this case having balanced goals may mean that you have five family related goals and only one goal in each of the other major categories Similarly, if you are ... of goals usually dominates the list at any particular time, it is always healthy to have at least one goal in each of the main areas as otherwise it is easy to become obsessive about an area of ... janitor it may be unrealistic to set a goal to be a Senior Manager within a year (not necessarily though if you are willing to put in a LOT of hard work), but if you are already on this career path...
Ngày tải lên: 18/03/2014, 03:20
Báo cáo y học: "Inhibition of antithrombin by hyaluronic acid may be involved in the pathogenesis of rheumatoid arthritis" potx
... factor via NF-kappa B activation in synovial fibroblasts Ann Rheum Dis 1999, 58:55-60 Shin H, Nakajima T, Kitajima I, Shigeta K, Abeyama K, Imamura T, Okano T, Kawahara K, Nakamura T, Maruyama I: ... hyaluronan (hyaluronic acid) and hylans for the treatment of osteoarthritis: mechanisms of action Arthritis Res Ther 2003, 5:54-67 23 Nagaya H, Yamagata T, Yamagata S, Iyoda K, Ito H, Hasegawa Y, Iwata ... Rezaie AR: Calcium enhances heparin catalysis of the antithrombin-factor Xa reaction by a template mechanism Evidence that calcium alleviates Gla domain antagonism of heparin binding to factor...
Ngày tải lên: 09/08/2014, 06:22
Báo cáo khoa học: "Septic shock is correlated with asymmetrical dimethyl arginine levels, which may be influenced by a polymorphism in the dimethylarginine dimethylaminohydrolase II gene: a prospective observational study" docx
... sequences are listed in Table Available online http://ccforum.com/content/10/5/R139 Table Locus DDAHII-449 Primer Allele GAAGGTGACCAAGTTCATGCTGACTGGAAGTCCAGCCCGG Allele GAAGGTCGGAGTCAACGGATTGACTGGAAGTCCAGCCCGC ... whether the relationship between ADMA levels and SOFA score was entirely attributable to cardiovascular failure, a non-cardiac organ failure score was obtained by excluding the cardiovascular component ... NO by ADMA has biological significance, because elevated ADMA levels are seen in patients with vascular disease, hepatic failure and renal failure, and are linked with greater severity of organ...
Ngày tải lên: 13/08/2014, 03:20
The right of Matthew Harrison to be identified as the author of this work has been asserted in accordance with the Copyright, Designs and Patents Act 1988 No part of this publication may be reproduced in any material form (including photocopying or stori
... kh a điện 14 Đèn báo ch a kh a không nằm ổ 15 Đèn cảnh báo kh a bấm điều khiển từ xa hết pin 16 Đèn cảnh báo khoảng cách 17 Đèn báo nhấn chân côn 18 Đèn báo nhấn chân phanh 19 Đèn báo kh a vô-lăng ... Đèn sương mù (sau) Đèn cảnh báo nước r a kính mức thấp Đèn cảnh báo má phanh Đèn báo bật hệ thống điều khiển hành trình Đèn báo rẽ Đèn báo cảm ứng m a ánh sáng Đèn báo chế độ lái m a đông 10 Đèn ... Đèn báo làm tan băng kính chắn gió 59 Đèn báo cốp xe mở 60 Đèn báo tắt hệ thống cân điện tử 61 Đèn báo cảm ứng m a 62 Đèn cảnh báo động cơ/khí thải 63 Đèn báo làm tan băng c a sổ sau 64 Đèn báo...
Ngày tải lên: 15/03/2015, 21:24
The right of Matthew Harrison to be identified as the author of this work has been asserted in accordance with the Copyright, Designs and Patents Act 1988 No part of this publication may be reproduced in any material form (including photocopying or stori
... make a decision, make love… To have dinner, have a party, have a holiday… To some work, a job, homework,… III Cách sử dụng in on at thời gian At: mốc thời gian cụ thể Vd: At 6:00am, at noon, at ... which, what, who, why, how often Chú ý câu hỏi – trả lời phải phù hợp (Xem sgk p 7) II Các danh từ kèm động từ make, have, To make a phone call, make an arrangement, make a mistake, make an appointment, ... least far/farther(further)/the farthest(the furthest) Double comparison(So sánh kép) + Same adj: Short adj:S + V + adj + er + and + adj + er Long adj:S + V + more and more + adj Vd: The weather...
Ngày tải lên: 15/03/2015, 21:25
Thuyết trình tài chính quốc tế CAN CENTRAL BANKS’ MONETARY POLICY BE DESCRIBED BY A LINEAR (AUGMENTED) TAYLOR RULE OR BY A NONLINEAR RULE
... NGHIÊN CỨU TRƯỚC ĐÂY QUY TẮC TAYLOR TUYẾN TÍNH QUY TẮC TAYLOR PHI TUYẾN TÍNH KẾT LUẬN PHẦN PHẦN PHẦN PHẦN PHẦN Quy tắc Taylor tuyến tính Quy tắc Taylor tuyến tính Taylor đ a năm 1993 nhằm mô tả đặc ... tắc Taylor tuyến tính Vì NHTW không hướng tới lạm phát hay khứ mà hướng tới lạm phát kỳ vọng Clarida cộng (1998) đề xuất sử dụng quy tắc Taylor dạng forward-looking • E kỳ vọng • Ωt vector ch a ... spead futures interest rate spead Biến credit spread xem báo tốt cho chu kỳ kinh doanh căng thẳng tài chính, thay đổi mức chênh lệch lãi suất (interest rate spread) hợp đồng tương lai báo độ dao...
Ngày tải lên: 21/06/2015, 23:44
Thuyết trình tài chính quốc tế Can central bank’s monetary policy be described by a linear (augmented) Taylor rule or by a monetary rule
... that rule can be augmented with a financial conditions index containing information from some asset prices and financial variables? COMPANY LOGO www.themegallery.com Theories Taylor rule Monetary ... of past or current values of these variables Fourc¸ ans and Vranceanu (2004) and Sauer and Sturm (2007) also stress the importance of considering a forward-looking Taylor rule in the analysis ... investigated by Montagnoli and Napolitano (2005) They build and use a financial conditional indicator that includes the exchange rate, share prices and house prices in the estimation of a Taylor rule...
Ngày tải lên: 14/07/2015, 08:34
Tiểu luận tài chính quốc tế Can central banks’ monetary policy be described by a linear (augmented) Taylor rule or by a nonlinear rule
... tế vĩ mô phi tuyến tính (Dolado et al., 2005), nonlinear central bank preferences (Dolado et al., 2000; Nobay and Peel, 2003; Ruge-Murcia, 2003 and Surico, 200 7a) or both (Surico, 2007b) Đặc ... lọc Kalman thông qua công thức (9) dạng state-space: Trong đó, sai số xem nhiễu trắng độc lập với ma trận phương sai – hiệp phương sai cho Var(µt) = Q Var(ωt) = R, Var(µtωs) = với tất t s X ma trận ... forward-looking Taylor khu vực EU Phương pháp GMM sử dụng để ước lượng hệ số quy tắc forward-looking Taylor có sử dụng điều chỉnh dần lãi suất (thể đâu quy tắc Taylor GMM?) Chỉ cần độ trễ (lag)...
Ngày tải lên: 14/07/2015, 08:37
Strategic environmental assessments may be used to compare different energy scenarios, and a more sustainable power plan can be developed by incorporating the wider impacts considered during the assessment process
... concentrated in central and northeast Thailand and along Viet Nam’s coastline; (ii) biomass potential is concentrated in the major rice-growing areas of the Chao Phraya basin, northeast Thailand, and ... Each additional 25% block of savings was assumed to have a payback period years longer The payback periods for Cambodia and the Lao PDR are weighted averages of those for Thailand and Viet Nam ... constitutes an attempt to introduce and incorporate a methodology for SEA in PDPs The findings and recommendations are by no means exhaustive and final, but are meant to serve as a springboard for more...
Ngày tải lên: 08/09/2015, 23:32
Hoàn thiện kế toán nguyên vật liệu tại Nhà máy Bê tông Amaccao
... tông Amaccao vào tháng 8/2010 có nội dung sau: Chuyên đề thực tập chuyên ngành 47 Nguyễn Thanh Hương Kế toán 49D Nhà máy Bê tông Amaccao Vân Nội – Viên Nội – Đông Anh – Hà Nội Mẫu số S0 3a- DNN (Ban ... người mua: Tên đơn vị: Nhà máy Bê tông Amaccao - CN Công ty Avinaa Đ a chỉ: Viên Nội - Vân Nội - Đông Anh - Hà Nội Số tài khoản: Hình thức toán: Tiền mặt MS 01 02709370-001 Số STT Tên hàng h a dịch ... người mua: Tên đơn vị: Nhà máy Bê tông Amaccao - CN Công ty Avinaa Đ a chỉ: Viên Nội - Vân Nội - Đông Anh - Hà Nội Số tài khoản: Hình thức toán: Tiền mặt MS 01 02709370-001 Số STT Tên hàng h a dịch...
Ngày tải lên: 11/04/2013, 09:42
Thiết kế nhà máy bê tông chế tạo sản phẩm
... vẽ: Vậy diện tích mặt cắt ngang kho : F = F1 + F2 + F3 F1 = 1 a a H = a tg1 = a tg1 2 = 10 tg 20 = 9m F2 = a. H2 = 1.10 = 10m2 F3 = a+ b a +b a b H3 = tg 2 2 a2 b2 10 0,4 = tg = tg 50 ... ximăng để định tỉ lệ N/X hay X/N Tính sơ giá trị X/N theo Bôlômây Skramtaep Khi X/N 2,5 X N = R 28 +0,5 A. RX A. RX Khi X/N > 2,5 X N = R 28 0,5 A. RX A. RX Từ hai trị số N X/N ta biết đợc lợng dùng ... vật liệu đợc a lên hai lần: Lần thứ nâng lên bunke trung gian cao từ 8-10m, lần thứ hai gầu nâng a vào thiết bị nạp lên máy trộn độ cao không lớn *Nhận xét: Qua phân tích nh trên, ta định chọn...
Ngày tải lên: 24/04/2013, 21:43
Select Whether the Report Will Be Displayed, Printed, or Exported Using Visual Basic .NET
... Export tab and click the Export button, a message appears stating that the data has been exported The last tab, View, displays the report in a Viewer Create a Windows Form Then place a Tab control ... Print Label Text # of Copies Label Text Start Page Label Text End Page TextBox Name txtNumOfCopies Text Name txtStartPage Text Name txtEndPage Text Button Name btnPrint Label Text Export Type Label ... gets or sets the export format type It can be one of the following: Excel, HTML32, HTML40, NoFormat, PortableDocFormat, RichText, or WordForWindows FormatOptions This gets or sets the FormatOptions...
Ngày tải lên: 20/10/2013, 13:15
