dopamine signaling in the bee
Tài liệu Báo cáo khoa học: Osmosensing and signaling in the regulation of mammalian cell function docx
Ngày tải lên :
18/02/2014, 16:20
... Thus, integrin-dependent cell volume sensing and signaling integrates into the overall context of insulin signaling Similarly, sensing of glutamine-induced hepatocyte swelling by integrins feeds into ... Osmosensing and signaling in mammalian cell function F Schliess et al [7] On the other hand, hyperosmotic shrinkage prevents insulin-induced hepatocyte swelling and proteolysis inhibition, indicating ... swelling [12–14] Integrin-inhibitory peptides exhibiting an arginine-glycine-aspartic acid (RGD) motif abolish hypoosmotic osmosignaling towards Src-type kinases, mitogen-activated protein kinases...
- 5
- 792
- 0
Báo cáo hóa học: "Involvement of aryl hydrocarbon receptor signaling in the development of small cell lung cancer induced by HPV E6/E7 oncoproteins" ppt
Ngày tải lên :
18/06/2014, 16:20
... in the S phase [37] Furthermore, other members of aryl hydrocarbon receptor signaling, the inhibitors of cyclin-dependent kinases (p16 and p21), have been demonstrated to bind E7 increasing the ... subsequently leading to progression of the cell into the S-phase [14] Furthermore, E7 binds to inhibitors of cyclin-dependent kinases (p16, p21), increasing the level of phosphorylated pRb In this way, ... results tissue remodelling has been associated with its deregulation In the absence of such induction, other studies have highlighted the aryl receptor signaling involvement in other pathophysiological...
- 11
- 471
- 0
Báo cáo y học: "Antigen receptor signaling in the rheumatic diseases" doc
Ngày tải lên :
09/08/2014, 01:22
... dephosphorylates the inhibitory tyrosine of Lck [54] Pep cooperatively inhibits TCR signaling by binding Csk and this association in turn is mediated by a proline-rich sequence in the C-terminal region ... defenses against impaired TCR signaling This might make teleogical sense since the overwhelming evolutionary pressure on the immune system has been infection, not autoimmunity, driving the system ... receptor signaling In T cells, for instance, the coreceptors CD4 and CD8 play a positive regulatory role not only by facilitating MHC recognition, but also by bringing the SFK Lck into the proximity...
- 9
- 507
- 0
Báo cáo khoa học: " Bioinformatic evidence for a stem-loop structure 5''''-adjacent to the IGR-IRES and for an overlapping gene in the bee paralysis dicistroviruses" pptx
Ngày tải lên :
12/08/2014, 04:20
... (A2) The corresponding region in [GenBank:NC_006559] (SINV-1) (B) Amino acid alignment of the translated ORFX assuming initiation at the normal IGR-IRES initiation site but in the +1 reading frame ... of ribosomes initiate at or near the usual IGR-IRES initiation site but in the +1 reading frame If ORFX initiation occurs at the normal IGR-IRES initiation site but in the +1 frame then translation ... than in the bee paralysis viruses - 125 codons if initiated in the +1 frame at the IGR-IRES normal initiation site; 83 codons if initiated at the tandem AUG codons (which are present in SINV-1...
- 8
- 258
- 0
Hedgehog signaling in the zebrafish embryo role of kif7 and DZIP1 1
Ngày tải lên :
10/09/2015, 15:49
... Chapter Introduction 1.1 1.2 1.3 Origin of the Hedgehog (Hh) pathway Drosophila Hedgehog Signaling Pathway Vertebrate Hedgehog Signaling Pathway 1.3.1 Genetics in Vertebrate Models 1.3.2 The Signaling ... through to the vertebrates However, amongst them, the kinesin-like protein Costal2 (Cos2), which plays an important role in controlling the transcriptional activity of the Hh pathway, remained elusive ... effect of Cos2 and Su(fu) in regulating Gli activity is a conserved event in the Hh signaling cascade v The Iguana/Dzip1 protein is important in Ciliogenic pathway Cilia are tiny hair-like organelles,...
- 10
- 319
- 0
Hedgehog signaling in the zebrafish embryo role of kif7 and DZIP1 2
Ngày tải lên :
10/09/2015, 15:49
... lack of involvement in mammalian Hh signaling Another hypothesis will be the redundancy of 12 the mammalian Fu in the Hh pathway which will explain for the absent of obvious Hh phenotypes in Fu ... and some of the mutants displayed situs inversus of the heart The mammalian node is important in determining the left-right asymmetry of organs and the beating of the motile cilia in the node creates ... regulated by Inversin (Inv) They are both found to be involved in the Wnt pathway (Simons et al., 2005) Inv and Dvl are distributed in the cytoplasm as well as at the cell membrane Inv has been specifically...
- 132
- 339
- 0
WNT signaling in the early development of zebrfish swimbladder and xenopus lung
Ngày tải lên :
11/09/2015, 09:07
... fibroblast growth factor (FGF) signaling by trapping FGF receptors in the ER Finally, insulin-like growthfactor (IGF) binding protein-4 (IGFBP-4) antagonizes Wnt signaling by binding to both LRP6 and Fz ... from Winata et al., 2009 1.7 The Wnt signaling 1.7.1 The discovery of Wnt signaling The first wnt gene, mouse wnt1, originally named Int-1, was identified in 1982 Int-1 encodes a secreted protein ... Hh signaling and is negatively regulated by Hh signaling 4.7.2 Hh signaling might be required to maintain wif1 expression 133 4.8 Crosstalk between Wnt signaling and tbx2a signaling regulated the...
- 208
- 287
- 0
Characterization of sema5a plexin b3 signaling in the oligodendrocyte cell line OLN 93
Ngày tải lên :
03/10/2015, 20:32
... intracellular domain containing proline-rich motifs Class semaphorins have PDZ-binding domain at their C-termini of intracellular domain The specific receptors for semaphorins are plexins The plexins are ... GTPase-binding domain Plexins can function as both ligand-binding receptor and signaling receptors for semaphorins Most plexins interact with semaphorin through the sema domains of both proteins, ... family including c-Met and Ron among plexin families Furthermore, the cytoplasmic domain of plexin-B family has a specific sequence responsible for binding PDZ domain-containing protein (PDZ-binding...
- 170
- 383
- 0
Tài liệu Báo cáo khoa học: Modulation of a-synuclein aggregation by dopamine in the presence of MPTP and its metabolite pptx
Ngày tải lên :
14/02/2014, 19:20
... solid line), in the presence of 100 lM neurotoxin ( , dotted line), in the presence of 200 lM neurotoxin ( , dotted line) and in the presence of neurotoxin and 50 lM dopamine (h, dashed line) • 1692 ... and 50 lM dopamine (F), in the presence of 200 lM MPTP and 50 lM dopamine (G), in the presence of 100 lM MPP+ and 50 lM dopamine (H) and in the presence of 200 lM MPP+ and 50 lM dopamine (I) Discussion ... results obtained when a-synuclein was incubated in the absence of MPTP When a-synuclein was incubated alone in the presence of dopamine, it led to inhibition of fibrillation, probably by the accumulation...
- 11
- 754
- 0
Tài liệu www.it-ebooks.info.www.it-ebooks.info.www.it-ebooks.infoOffice 2010THE MISSING MANUALThe book that should have been in the box®ˇDownload from Wow! eBook .www.it-ebooks.infoDownload from Wow! eBook .www.i docx
Ngày tải lên :
17/02/2014, 15:20
... When the button shows two overlapping windows, then the Word screen is at full size; click the button to shrink the window When the button shows a single window (as in Figure 1-1), the window ... Creating Lists Linking Text to a Web Page Checking Your Spelling Turning Text into WordArt Embedding Other Files in Slides Embedding an Existing File in a ... www.it-ebooks.info Keeping Track of Who’s Attending Canceling a Meeting Editing Events Turning an Appointment into a Meeting Making an Event Recur Getting Reminders...
- 956
- 6.4K
- 0
Signaling at the Cell Surface in the Circulatory and Ventilatory Systems docx
Ngày tải lên :
05/03/2014, 22:21
... During integrin outside in signaling, the binding of integrins to their extracellular ligands changes the integrin conformation and promotes integrin clustering The unidirectional signalings, in ... (juxtacrine signaling) as well as over short (auto- and paracrine signaling) and long (endocrine signaling) distances In juxtacrine signaling, plasma membranes of interacting cells come into contact ... often closely linked, as ligand binding associated with outside in signaling stimulates integrins and, conversely, integrin activation increases ligand binding for inside–out signaling 1.1.5.3 Modularity...
- 999
- 3.2K
- 0
Báo cáo khoa học: Intrabodies against the EVH1 domain of Wiskott–Aldrich syndrome protein inhibit T cell receptor signaling in transgenic mice T cells potx
Ngày tải lên :
16/03/2014, 14:20
... at the C-terminus We compared the quantity of scFv intrabodies and assessed their binding activity to the WASP-EVH1 domain in the scFv gene-transfected T cells Finally, we succeeded in expressing ... 10 The third PCR products were mixed in the following combinations: 18SVH–linker and linker) 18VL, 18VH–linker and linker)18VL, 21SVH–linker and linker)21VL, 21VH–linker and linker)21VL and singlechain ... coding linker containing a NotI site at the 5¢ end of the linker (5¢-GGC CGCAGGTTCGGAGCAGAAGCTGATCAGCGAGGAG GACCTGTAG-3¢) and noncoding linker containing an EcoRI site at the 5¢ end of the linker...
- 14
- 493
- 0
Báo cáo Y học: GPI-microdomains (membrane rafts) and signaling of the multi-chain interleukin-2 receptor in human lymphoma/leukemia T cell lines doc
Ngày tải lên :
17/03/2014, 23:20
... concentrate the a chains (CD25) in the vicinity of signaling IL-2R b and cc chains, forming a common signaling platform in the membrane, before cytokine stimulation This ÔfocusingÕ effect may enhance the ... CD8 in T cells, CD44 in various cell types or in uenza virus haemagglutinin in epithelial cells) [14] Thus, the present study aimed at investigating whether the molecular constituents of the ... raft-associated) signaling molecules to gain full signaling capacity This is possibly brought about by a conformation-dependent tightening of their interactions upon binding of the relevant cytokine [11]...
- 10
- 499
- 0
Báo cáo khoa học: Liver receptor homolog-1 localization in the nuclear body is regulated by sumoylation and cAMP signaling in rat granulosa cells docx
Ngày tải lên :
23/03/2014, 06:20
... is attenuated by the cAMP signaling pathway Our studies further indicate a novel regulatory mechanism of cAMP signaling for altering the sumoylation cycle, involving modulating the expression of ... associated with the targeting of LRH-1 into nuclear bodies that is inhibited by cAMP signaling Because the ovary expresses LRH-1, we further examined the effect of sumoylation site mutation on the nuclear ... western blotting E1 and E2 [44] In the present study, we observed that activation of the cAMP pathway caused a significant change in the sumoylation machinery The mRNA levels of the E1 activating subunit...
- 12
- 443
- 0
Báo cáo khoa học: RNAi-mediated knockdown of juvenile hormone acid O-methyltransferase gene causes precocious metamorphosis in the red flour beetle Tribolium castaneum pdf
Ngày tải lên :
23/03/2014, 07:20
... background The putative SAM-binding motif (motif I) is boxed The positions of the introns are indicated by red lines, and the numbers above indicate the positions of the introns as described in the ... gene more abundant in the posterior part of the sixth larval instar (Fig 3A,B) and at the beginning of the prepupal stage in the seventh larval instar (Fig 3D,E) In the sixth instar larvae, TcMT3 ... the beginning of the sixth instar to the larvae that had received TcMT3 dsRNA, the majority (94%, n = 16) moulted into the seventh instar (Table 3) Thus, JHM application at the beginning of the...
- 13
- 354
- 0
Báo cáo khoa học: Interactions of ultraspiracle with ecdysone receptor in the transduction of ecdysone- and juvenile hormone-signaling pdf
Ngày tải lên :
23/03/2014, 13:20
... receptors, including human RXR (which is the ortholog of USP) have shown that an area on the surface of the ligand binding domain involving the C-terminus of a-helix 3, a-helix 4, and the N-terminus ... promoter reporter These two motifs (DR1 and IR1) contain identical half sites and the same intervening single base, the difference being the orientation of the second half site as in the same direction ... receptor in hormone signaling a construct containing a single motif in the fi direction was used in this study Cell culture and transfections Spodoptera frugiperda cell line, Sf9, was maintained and...
- 13
- 414
- 0
Báo cáo khoa học: Functionally distinct dopamine and octopamine transporters in the CNS of the cabbage looper moth* potx
Ngày tải lên :
23/03/2014, 20:22
... for both dopamine and octopamine [12] This raises several issues: does the moth OAT substitute for DAT in dopaminergic signaling pathways in the moth CNS, and what is the nature of the mechanism ... TrnOATexpressing cells was assessed in cells incubated in Na+-free saline or in cells mock-infected with virus expressing a-glucuronidase (GUS) protein (Fig 6) [3H]DA binding ể FEBS 2003 Monoamine transporters ... [30] The existence of dopaminergic neurons in the insect CNS implies that a dopamine transporter would need to be expressed by these neurons to clear the chemical from the synaptic space Octopamine...
- 11
- 431
- 0
An Account of Some of the Principal Slave Insurrections, and Others, Which Have Occurred, or Been Attempted, in the United States and Elsewhere, During the Last Two Centuries. pptx
Ngày tải lên :
31/03/2014, 11:20
... the individual works in the collection are in the public domain in the United States If an individual work is in the public domain in the United States and you are located in the United States, ... in the South and in the West, and they continued to work on all the plantations There were, indeed, estates which had neither owners nor managers resident on them Some of these had been put in ... mind has been much involved in dangerous apprehensions concerning an insurrection of the negroes in several of the adjoining counties Such a thing has been in agitation by an ambitious and insidious...
- 25
- 523
- 0
