don apos t blame your users in your error messages

Don’t Waste Your Life doc

Don’t Waste Your Life doc

... “seeing through” things forever The whole point of seeing through something is to see something through it It is good that the window should be transparent, because the street or garden beyond it ... learning the obvious—that there is Truth, that there is objective being and objective value Like a fish going to school to learn that there is water, or a bird that there is air, or a worm that there ... PM DON T WASTE YOUR LIFE of lectures at Wheaton College that in 1968 became the book, The God Who Is There.1 The title shows the stunning simplicity of the thesis God is there Not in here, defined...

Ngày tải lên: 22/03/2014, 22:20

192 579 0
Don't believe your eyes!

Don't believe your eyes!

... created with pdfFactory trial version www.pdffactory.com PDF created with pdfFactory trial version www.pdffactory.com PDF created with pdfFactory trial version www.pdffactory.com PDF created with ... pdfFactory trial version www.pdffactory.com PDF created with pdfFactory trial version www.pdffactory.com PDF created with pdfFactory trial version www.pdffactory.com PDF created with pdfFactory trial ... www.pdffactory.com PDF created with pdfFactory trial version www.pdffactory.com PDF created with pdfFactory trial version www.pdffactory.com PDF created with pdfFactory trial version www.pdffactory.com...

Ngày tải lên: 24/05/2014, 20:20

13 271 0
Don’t Quit your Day Job! By Leland Stafford Kropp pot

Don’t Quit your Day Job! By Leland Stafford Kropp pot

... first thing that they will look at is total cost The one thing that you don t want to happen is for them to think that you are too expensive You want to be in front the client to explain your ... proceeded to inform me that I was sitting with the world’s best networkers, and that I was not giving them a chance to help me What could it hurt to listen to what he had to say? His point was that there ... know to every meeting, because every business person can turn into a client Every client that I talked to and found out that they were in business I’d bring to a meeting The hardest thing to get...

Ngày tải lên: 27/06/2014, 23:20

64 258 0
Don’t cross your bridges until you come to them ppsx

Don’t cross your bridges until you come to them ppsx

... come to it" để ám t i/ không lo lắng điều th t xảy Ví dụ:  A (man): I'll introduce you to my parents tonight (Anh đưa em m t bố mẹ anh t i nay.)  B (the man's girlfriend): Okay , but they might ... Ta dùng thành ngữ để diễn t ý việc chưa xảy không cần phải lo lắng nó, chờ đợi đến đâu ta t nh đến Ví dụ:  A: Our proposal is ready, but what if the committee doesn 't accept it? (Đề ...  B: Don' t cross your bridges before you come to them We will see what happens then (Em đừng lo lắng đến chuyện xa vời Rồi bi t điều xảy mà.) Mọi người thường nói: "I/ we will cross that bridge...

Ngày tải lên: 02/08/2014, 10:20

4 468 0
Báo cáo y học: " Intensivists: don’t quit your day job" docx

Báo cáo y học: " Intensivists: don’t quit your day job" docx

... recognized by the institution Exactly what constitutes institutional recognition and how many of the physicians in this database are classified as such is unclear, but perhaps differences in training or ... to institute “comfort measures” than are non-intensivists [9] Could this have accounted for the mortality difference? Second, as the authors point out, the in uence of where/how long and the type ... association between critical care physician management and patient mortality in the Project IMPACT database, a consortium of ICUs that receive benchmarking data in an effort to improve their care...

Ngày tải lên: 13/08/2014, 20:21

3 267 0
Nghiên cứu kỹ thuật tạo giống dưa chuột đơn bội nuôi cấy in vitro bao phấn

Nghiên cứu kỹ thuật tạo giống dưa chuột đơn bội nuôi cấy in vitro bao phấn

... 0,04 TDZ+1,0 BAP 1,5 0,04 TDZ+1,5 BAP 2,0 0,04 TDZ+2,0 BAP CTTN CT1 CT2 CT3 CT4 CT7 CT8 CT11 CT12 0,02 0,03 0,04 CT13 Ký hi u Sau thí nghi m t m ñư c môi trư ng thích h p nh t cho s t i sinh t nuôi ... chu t ñơn b i invitro Trư c yêu c u c a th c t c a s n xu t v i vi c k th a k t qu nghiên c u nư c, ti n hành ñ t i: "Nghiên c u k thu t t o dưa chu t ñơn b i t nuôi c y in vitro bao ph n’’ Trên ... ti n Vitamin A 0,3 mg; vitamin B1 0,04 mg; vitamin PP 0,1 mg Vitamin C 5mg [1],[4] Ngoài nh ng giá tr v dinh dư ng dưa chu t có giá tr m t v thu c quý Trung Qu c ngư i ta dùng làm thu c nhi t, ...

Ngày tải lên: 06/12/2013, 19:43

119 596 2
I know that women don’t like me!’ Presuppositions in therapeutic discourse Marta Andersson pot

I know that women don’t like me!’ Presuppositions in therapeutic discourse Marta Andersson pot

... discernible on the basis of the correction that the latter utterance makes to the first two The presupposition triggered by the it-cleft in (c) points to something that might have been mistakenly inferred ... presupposition (know that Janet wasn t interested in you) This eventually leads to the patient corroborating his views in (c) and to the reconstruction of the situation that is obscurely introduced in ... these feelings is important I think that’s the first step in realizing that it’s OK or it’s safe to have these feelings and to show them to the other person (b) T: Are you talking about yourself,...

Ngày tải lên: 07/07/2014, 02:20

17 473 2
sloan - don't blame the shorts; why short sellers are always blamed for market crashes and how history is repeating itself (2010)

sloan - don't blame the shorts; why short sellers are always blamed for market crashes and how history is repeating itself (2010)

... worldview? What is it about shorting that drives our political and financial institutions to distraction? How does short selling manage to bring Washington elites and corporate chieftains together in rare ... nothing to with the downturn The misguided attack on short selling, perhaps the most intricately interconnected piece of our markets, has turned into a distraction Last fall as Lehman stood on the ... Washington’s first move was to go after the shorts who had bet against it In choosing to go after what it believed was the cause of Lehman’s problems—rather than actually attempting to save the...

Ngày tải lên: 03/11/2014, 18:31

272 381 0
Adding Users in Windows 2000

Adding Users in Windows 2000

... was just created, log back on to the system Note: Since the student is now a new user, Administrative tools will not be available Follow these steps to add Administrative tools to the start menu: ... Management only 12 Repeat steps 2-7 to create the second user Troubleshooting To create accounts in Windows 2000, the user must be either logged onto the server as Administrator or operating the tools ... Systems, Inc 11 Right-click on Computer Management and select Run As Enter the Administrator Account Information and click OK This grants administrator privileges to this instance of Computer Management...

Ngày tải lên: 05/11/2013, 12:15

4 224 0
Bài giảng TU CHON T 7 TIET 21 IN NGAY

Bài giảng TU CHON T 7 TIET 21 IN NGAY

... ? Hs trả lời theo chứng minh cách ta có ∧ ∧ cân B2 = C lên tam giác IBC ? Vậy theo C1 câu b ta chứng minh Gv gọi Hs lên bảng trình bày Hs theo dõi nhận x t làm bạn Gv nhận x t khai thác toán ... 3.Củng cố :Lồng vào ti t luyện t p 4.Hướng dẫn nhàø : Ôn t p đònh nghóa t nh ch t tam giác cân, tam giác Cách chứng minh tam giác tam giác cân Bài t p nhà 72; 73; 74; 75; 76 / 107 SBT ... ghi GT , KL HS : lớp vẽ hình , vi t giả thi t , k t luận vào Gv: Muốn so sánh ta làm ACE ABD Gv: quan s t hình vẽ dự đoán k t ? HS : nêu dự đoán Gv: chứng minh dự đoán dó Gv: để chứng minh = ta...

Ngày tải lên: 28/11/2013, 16:11

3 333 0
c.t. jones - step 7 in 7 steps

c.t. jones - step 7 in 7 steps

Ngày tải lên: 11/12/2013, 22:42

468 588 13
Tài liệu Adding Users in Linux pdf

Tài liệu Adding Users in Linux pdf

... studentA2 studentA3 studentA4 instructorB1 studentA1 studentA2 studentA3 studentA4 instructorB1 B2 B3 B4 C1 studentB2 studentB3 studentB4 instructorC1 studentB2 studentB3 studentB4 instructorC1 C2 C3 ... studentC2 studentC3 studentC4 studentD1 studentD2 studentD3 studentD4 studentC2 studentC3 studentC4 studentD1 studentD2 studentD3 studentD4 - IT Essentials II v2.0 - Lab 10.2.2 Instructor, Windows ... Copyright  2002, Cisco Systems, Inc Step 5: Account Verification In this step, verify that the accounts were created correctly in step by using the finger command To learn about the finger command...

Ngày tải lên: 21/12/2013, 19:15

7 334 0
Báo cáo khoa học: Intrabodies against the EVH1 domain of Wiskott–Aldrich syndrome protein inhibit T cell receptor signaling in transgenic mice T cells potx

Báo cáo khoa học: Intrabodies against the EVH1 domain of Wiskott–Aldrich syndrome protein inhibit T cell receptor signaling in transgenic mice T cells potx

... 5¢-CACCCAAGCTT GCCACCATGGAGGTTCAGCTGCAGCAGTCTG-3¢; primer 7, 5¢-GGT GGAGGAGGTTCTGATGTTTTGATGACCCAAACTCCAC-3¢; primer 8, 5¢-CGAATGCGGCCGCCCGTTTGATTTCCAGCTTGGTGC-3¢; primer 9, 5¢-GGTGGAGGAGGTTCTGATGTTGTTCTGACCCAAACTCCACTC-3¢; ... noncoding linker containing an EcoRI site at the 5¢ end of the linker (5¢-AATTCTACAGG TCCTCCTCGCTGATCAGCTTCTGCTCCGAACCTGC-3¢) were annealed and inserted into the NotI ⁄ EcoRI site of all pCAG ⁄ anti-WASP ... CCTCCTCACCGGATCCTCCACCTCCAGAACCACCACCCCC-3¢; primer 13, 5¢-CGTCTCCTCAGGGGGTGGTGGTTCTGGAGGTGGAG GATCCGGTGGAGGAGGTTCT-3¢; primer 14, 5¢-CGTCTCCTCA GGGGGTGGTGGTTCTGGAGGTGGAGGATCCGGTGGAGGAGG TTCT-3¢ In all primers,...

Ngày tải lên: 16/03/2014, 14:20

14 493 0
van sickle, t. (2001). programming microcontrollers in c (2nd ed.)

van sickle, t. (2001). programming microcontrollers in c (2nd ed.)

... an integer and it expects no arguments The type int preceding the function name indicates that it returns an integer and that no arguments to the function are expected The line following the ... function that determines the number of bits in an integer on your machine 34 Chapter Introduction to C Write a program that will rotate the bits in the number 0x5aa5 to the left by n bits A rotate ... the data string “a * b * c = %d\n” contains a printer command character %d This character notifies the printf function that it is to take the first argument following the data string, convert...

Ngày tải lên: 18/04/2014, 12:27

470 715 1
báo cáo hóa học:" Prevalence of HIV among injection drug users in Georgia" doc

báo cáo hóa học:" Prevalence of HIV among injection drug users in Georgia" doc

... injection in the month prior to the survey; and being a resident of the selected survey location The interviews were conducted at fixed sites located in the centre of each city by trained interviewers ... only in pre-detention facilities While there are often political barriers to the implementation of harm-reduction interventions in correctional institutional settings, this analysis identifies ... imprisonment/ Page of detainment; and city of residence Those factors that were statistically significant in the univariate analysis were further included in the multivariate stepwise logistic regression...

Ngày tải lên: 20/06/2014, 08:20

7 454 0
Báo cáo toán học: " Protection of primary users in dynamically varying radio environment: practical solutions and challenges" pot

Báo cáo toán học: " Protection of primary users in dynamically varying radio environment: practical solutions and challenges" pot

... testbed This is due to the fact that the amplifier does not operate in its saturation region with respect to its input-output characteristic, but it is still highly nonlinear However, the quality ... BER due to increased interference relative to the method presented in [23] In [25], this method is improved by introducing the constraint on the self-interference power level An interesting approach ... attenuation, which is the typical value for the LTE user equipment transmitter that has to be obeyed in adjacent channels Note that in order to protect various types of PU signals present in the...

Ngày tải lên: 20/06/2014, 20:20

51 376 0
Báo cáo hóa học: "Research Article Securing Collaborative Spectrum Sensing against Untrustworthy Secondary Users in Cognitive Radio Networks" potx

Báo cáo hóa học: "Research Article Securing Collaborative Spectrum Sensing against Untrustworthy Secondary Users in Cognitive Radio Networks" potx

... round to start attack and which round to stop attack In Figure 12, the malicious users start to attack at t = 20 and stop to attack at time t = 100 In Figure 13, one user behaves badly in only ... between attack power and covertness, and find the attack parameters that maximize the damage To (iii) Thus, maximizing the total damage is equivalent to finding attack parameters in the undetectable ... the attack parameters that maximize D and are in the undetectable region Finding optimal attack has two purposes First, with the strongest attack (in our framework), we can evaluate the worst-case...

Ngày tải lên: 21/06/2014, 19:20

15 301 0
Báo cáo hóa học: " Capacity Planning for Group-Mobility Users in OFDMA Wireless Networks" pdf

Báo cáo hóa học: " Capacity Planning for Group-Mobility Users in OFDMA Wireless Networks" pdf

... (14) The role of problem (P1) is to find y that minimizes the outage ratio of ongoing connections subject to the constraint that the excess capacity ratio is not greater than γS (19) − This is ... shows the admission capacity versus the targeted outage ratio with respect to the transmit power It is observed ¯ that the admission capacity increases as the transmit power p increases In addition, ... group-mobility users because the users are located at the nearly same position with respect to the base station ¯ Second, the mean value G is an unbiased estimator that provides sufficient statistical information...

Ngày tải lên: 22/06/2014, 22:20

12 221 0
w