d byron and a stent

An α-D-galactan and a β-D-glucan from the mushroom Amanita muscaria: Structural characterization and antitumor activity against melanoma

An α-D-galactan and a β-D-glucan from the mushroom Amanita muscaria: Structural characterization and antitumor activity against melanoma

... mushroom Amanita muscaria: Structural characterization and antitumor activity against melanoma Matheus Zavadinack a, Daniel de Lima Bellan b, Jessica Loren da Rocha Bertage a, Shayane da Silva Milhorini ... Based on derived O-methylalditol acetates GAL-Am: α -D- galactan isolated from A muscaria GLC-Am: β -D- glucan isolated from A muscaria temperature for 20 h, neutralized with acetic acid and dialyzed ... 3.27 Assignments are based on 13C NMR, 1H and HSQC analysis and are expressed as ppm GAL-Am: α -D- galactan isolated from A muscaria GLC-Am: β -D- glucan isolated from A muscaria GLC-Sm: GLC-Am that

Ngày tải lên: 01/01/2023, 13:09

12 7 0
Think like a freak: Steven D. Levitt and Stephen J. Dubner

Think like a freak: Steven D. Levitt and Stephen J. Dubner

... claims admitted... he showed up anyway and, in the excitement, jumped onstage He was promptly handcuffed and arrested It was an uncharacteristically brash move for such a disciplined man ... weapons of mass destruction and was in league with al Qaeda To be sure, there was more to it than that—politics, oil, and perhaps revenge—but it was the al Qaeda and weapons claims that ... that sealed the deal Eight years, $800 billion, and nearly 4,500 American deaths later—along with at least 100,000 Iraqi fatalities—it was tempting to consider what might have happened had the

Ngày tải lên: 05/06/2014, 05:28

138 886 0
Báo cáo hóa học: " Audio watermarking robust against D/A and A/D conversions" pptx

Báo cáo hóa học: " Audio watermarking robust against D/A and A/D conversions" pptx

... RESEARCH Open Access Audio watermarking robust against D/ A and A /D conversions Shijun Xiang 1,2 Abstract Digital audio watermarking robust against digital-to-analog (D/ A) and analog-to-digital (A /D) ... D A/ AD conversions on audio watermarking can be formulated as, f  (i)=λ · f  i α  + η , (2) where a is a time scaling factor in the DA/AD, l is an amplitude scaling factor, and h is an additive ... the A /D conversion), and the simulation results are similar. Wave magnitude distortion Under the DA/AD conversions, anot her kind of degra- dation on the digital audio files is wave magnitude dis-

Ngày tải lên: 21/06/2014, 03:20

14 381 0
báo cáo khoa học: " 3-D reconstruction of a human fetus with combined holoprosencephaly and cyclopia" pptx

báo cáo khoa học: " 3-D reconstruction of a human fetus with combined holoprosencephaly and cyclopia" pptx

... severe malformation and absence of the facial midline bones above the maxilla, and a malformation of the maxilla and sphenoid bone The mandible, posterior cranial bones, cranial nerves and blood vessels ... Head & Face Medicine BioMed Central Open Access Research 3 -D reconstruction of a human fetus with combined holoprosencephaly and cyclopia Wolfgang H Arnold*† and Veronika Meiselbach† Address: Department ... to determine the internal structure and extent of the malformation Methods: The head from a human fetus at 20 weeks gestation and a diagnosis of holoprosencephaly and cyclopia was investigated

Ngày tải lên: 11/08/2014, 20:20

11 292 0
DSpace at VNU: Numerical modeling of 3-D inclusions and voids by a novel adaptive XFEM

DSpace at VNU: Numerical modeling of 3-D inclusions and voids by a novel adaptive XFEM

... proposed A- XFEM are analyzed and discussed Four representative numerical examples of 3 -D single and multiple inclusions embedded in a matrix are hence considered and analyzed All the numerical results ... than that by the non-adaptive counterpart, reflecting the advantages of the A- XFEM Also, this feature makes the method to be an ideal candidate for practical applications Table presents the strain ... integration technique is its simplicity and accuracy as a domain integral is transformed into a boundary integral and a 1D integral The integration technique in [43] is interesting, and generally

Ngày tải lên: 15/12/2017, 15:07

18 166 0
DO IT Trial: Vitamin D Outcomes and Interventions in Toddlers – a TARGet Kids! randomized controlled trial

DO IT Trial: Vitamin D Outcomes and Interventions in Toddlers – a TARGet Kids! randomized controlled trial

... Research Team: Charmaine Camacho, Diviya Elango, Julie DeGroot, Shanique Edwards, Nadia Kabir, Marina Khovratovich, Tarandeep Malhi, Juela Sejdo, Laurie Thompson, Mandy Tran Applied Health Research ... Markestad T, Aksnes L, Ulstein M, Aarskog D: 25-Hydroxyvitamin D and 1,25-dihydroxyvitamin D of D2 and D3 origin in maternal and umbilical cord serum after vitamin D2 supplementation in human ... the practice sites RAVE™ has extensive built in reporting capabilities, and data can be exported to standard formats for data analysis (e.g., SAS) Laboratory tests are directly uploaded to RAVE™

Ngày tải lên: 02/03/2020, 17:25

14 15 0
slide 1 matching 2 hairdresser’s 3 drugstore 4 swimming pool 5 stadium 1 grocery store 6 wet market f e d c b a unit 7 my neighborhood lesson 1 getting started listen and read vocabulary delicious ad

slide 1 matching 2 hairdresser’s 3 drugstore 4 swimming pool 5 stadium 1 grocery store 6 wet market f e d c b a unit 7 my neighborhood lesson 1 getting started listen and read vocabulary delicious ad

... vocabulary delicious (adj) (to) servea pancakeclose byclose by (7)(8) 1.Na came to the neighborhood yesterday/ last week (9)(10) 1.Na came to the neighborhood yesterday / last week 4.Nam doesn’t ... neighborhood b) She and her family arrived _ c) Na’s mother is very _ d) There is a _ in the area. e) The restaurant serves food from new last week tired (12)Nam Na How long have ... eat in the restaurant 2.Nam has lived in the area for ten / twenty years 3.Na wants to go to the restaurant / grocery store. last week restaurant likes (11) Complete the sentences. a) Na’s

Ngày tải lên: 20/04/2021, 10:41

18 12 0
Emotional intelligence works think, be and work smarter, 3rd edition by s  michael kravitz, ph d  susan d  schubert, m a

Emotional intelligence works think, be and work smarter, 3rd edition by s michael kravitz, ph d susan d schubert, m a

... wisdom, creativity, and gifts of everyone to achieve individual and organizational as well as community success S Michael Kravitz, Ph .D Dr Kravitz is a speaker and educator He provides practical, ... situations that are motivating and positive Motivators: Situations that tend to be most satisfying and stimulating to you De-motivators: Situations that tend to be irritating and annoying and cause you ... Obtain tools for assessing individual and organizational strengths and opportunities for improvement 4) Understand model strategies and examples for using emotional intelligence in business and

Ngày tải lên: 30/04/2021, 17:38

45 7 0
BAI d THI VIETNAM m and a CONTEST 2018

BAI d THI VIETNAM m and a CONTEST 2018

... https://ourworldindata.org/meat -and- seafood-production-consumption StockPlus (2016) Vietnam Animal Feed Market Review 2016 Hanoi The Global Feed Industry (n .d. ) Retrieved from International Feed Industry ... https://e.vnexpress.net/news/business/economy/vietnamese-food -and- beveragebehemoth-masan-to-attack-asean-market-3393652.html Hải, Đ (2015, May 17) Masan, C.P Vietnam đua khốc liệt thị trường quy mô 24 tỷ USD Retrieved from CafeF: http://cafef.vn/doanh-nghiep/masan-c-p-vietnam-va-cuocdua-khoc-liet-tren-thi-truong-quy-mo-24-ty-usd-20150517134101839.chn ... Sullivan Retrieved from Can the Shifting Food & Beverage Market Feed the World in 2015 and Beyond?: https://ww2.frost.com/news/press-releases/can-shifting-food-beverage-market-feedworld-2015 -and- beyond/

Ngày tải lên: 17/12/2021, 15:40

35 5 0
A progressive mind - Louis D. Brandeis and the origins of free sp

A progressive mind - Louis D. Brandeis and the origins of free sp

... Baker, Leonard Brandeis and Franlifurter: A Dual Biography New York: Harper & Row, 1984 Baker, Ray Stannard and William E Dodd The New Democracy: Presidential Messages, Addresses, and Other Papers ... American public The Abrams case created the "imminent threat" standard, which Holmes and Brandeis solidified in the coming years Their dissent in Abrams demonstrated how Holmes and Brandeis had taken ... present" standard needed to be reworked and defined Drawing on the power of judicial review, Brandeis included large passages referring to the Founding Fathers and what they meant by speech freedoms

Ngày tải lên: 23/10/2022, 09:36

143 0 0
AP 3 d art and design sustained investigation portfolio sample   score of 1 (row a)

AP 3 d art and design sustained investigation portfolio sample score of 1 (row a)

... evidence Written evidence identifies an inquiry that relates to the sustained investigation Written evidence identifies an inquiry that guides the sustained investigation OR AND AND Written evidence ... 2022 AP® 3 -D Art and Design Sustained Investigation Row A? ??Score Written Evidence Student Response Writing Prompt #1: In my sustained investigation, I discussed how self-identity is a paramount ... evidence does not identify an inquiry Visual evidence demonstrates the sustained investigation Visual evidence demonstrates the sustained investigation Score Rationale While the written evidence identifies

Ngày tải lên: 22/11/2022, 19:24

10 2 0
AP 3 d art and design sustained investigation portfolio sample   score of 2 (row a)

AP 3 d art and design sustained investigation portfolio sample score of 2 (row a)

... investigation OR AND AND Written evidence does not identify an inquiry Visual evidence demonstrates the sustained investigation Visual evidence demonstrates the sustained investigation Score Rationale ... method A stronger connection between the visual evidence and the investigation would guide the viewer more clearly The overarching inquiry goal to “seek, search, and discover” is not adequately addressed ... written and visual evidence identifies an inquiry related to the sustained investigation For example, the student asks, "how can I use recycled materials to create a non-objective sculpture that represents

Ngày tải lên: 22/11/2022, 19:24

11 4 0
(TIỂU LUẬN) leadership and decision making individual assignment as maxwell (n d) once said “a leader is one who knows the way, goes the way, and shows the way

(TIỂU LUẬN) leadership and decision making individual assignment as maxwell (n d) once said “a leader is one who knows the way, goes the way, and shows the way

... Reference list Algattan, A. A., 1984.The path-goal theory of leadership: an empirical and longitudinal analysis Anderson, A (2012), Good Leaders Are Invaluable To A Company Bad Leaders Will Destroy It, ... Trungpa, C., 2011 The path is the goal: A basic handbook of Buddhist meditation Shambhala Publications Zaccaro, S.J., Kemp, C and Bader, P., 2004 Leader traits and attributes The nature of leadership, ... Leadership and Decision Making Individual Assignment RMIT International University Vietnam Individual Assignment Subject Code: BUSM4188 Subject Name: Leadership and Decision Making Location

Ngày tải lên: 02/12/2022, 22:14

15 12 0
An analysis of the suggested translation of chapter 3 from the book foundations of lodging management by david k hayes, jack d  ninemeier and allisha a  milner, 2012

An analysis of the suggested translation of chapter 3 from the book foundations of lodging management by david k hayes, jack d ninemeier and allisha a milner, 2012

... Lodging Management" by David K Hayes, Jack D Ninemeier and Allisha A Milner , 2012 Due to a time constraint, I decided to translate chapters of this book, and I created the recommended translation ... terminologies, and sophisticated structures, all of which are combined in the graduation paper In addition, towards the conclusion of my graduation paper, I noticed certain obstacles and proposed some strategies ... OF EDUCATION AND TRAINING DUY TAN UNIVERSITY FACULTY OF ENGLISH GRADUATION PAPER AN ANALYSIS OF THE SUGGESTED TRANSLATION OF CHAPTER FROM THE BOOK "FOUNDATIONS OF LODGING MANAGEMENT” BY DAVID K.HAYES,

Ngày tải lên: 25/02/2024, 08:23

100 1 0
Tài liệu Báo cáo khoa học: Proteomic analysis of dopamine and a-synuclein interplay in a cellular model of Parkinson’s disease pathogenesis docx

Tài liệu Báo cáo khoa học: Proteomic analysis of dopamine and a-synuclein interplay in a cellular model of Parkinson’s disease pathogenesis docx

... analysis of dopamine and a- synuclein interplay in a cellular model of Parkinson’s disease pathogenesis Tiziana Alberio1, Alessandra Maria Bossi2, Alberto Milli2, Elisa Parma1, Marzia Bruna Gariboldi1, ... 2D- PAGE database dehydrogenase and to mitochondrial ATP synthase a subunit by comparison with 2D electrophoresis (2-DE) maps available in the SWISS 2D- PAGE database (http://www.expasy.org) Additionally, ... silver-stained gels were analyzed by ANOVA DA, proteins that showed increased (›) or decreased (fl) expression after dopamine treatment; a- syn, proteins that displayed increased (›) or decreased (fl)

Ngày tải lên: 15/02/2014, 01:20

11 776 0
Tài liệu Đề tài " Logarithmic singularity of the Szeg¨o kernel and a global invariant of strictly pseudoconvex domains " docx

Tài liệu Đề tài " Logarithmic singularity of the Szeg¨o kernel and a global invariant of strictly pseudoconvex domains " docx

... invariant of a domain Ω, or a CR invariant of the boundary ∂Ω, and moreover that the invariant is un- changed under perturbations of the domain (Theorem 1). We also show that the same invariant ... and has a singularity along the boundary diagonal. If we take a smooth defining function ρ of the domain, which is positive in Ω and d? ? =0on∂Ω, then (by [6] and [2]) we can expand the singularity ... sub-Laplacian, R and A 11, 11 are respectively the scalar curva- ture and the second covariant derivative of the torsion of the Tanaka-Webster connection for θ. Thus the integrand ψ θ θ ∧ d? ? is

Ngày tải lên: 16/02/2014, 05:20

18 564 0
Tài liệu Police Personnel Challenges After September 11 - Anticipating Expanded Duties and a Changing Labor Pool pdf

Tài liệu Police Personnel Challenges After September 11 - Anticipating Expanded Duties and a Changing Labor Pool pdf

... resources and leadership to local governments Data analysis and planning assistance to local jurisdictions and departments could achieve the economies of scale needed to conduct high-quality trend analysis ... peers, and thus may have the ability to meet academic standards but not have had the opportunity to develop that ability The Army, Navy, and Air Force each have preparatory schools for officer candidates ... contact Andrew Morral, Director, Safety and Justice Program, RAND Corporation, 1200 South Hayes Street, Arlington, VA 22202-5050 or Andrew_Morral@rand.org More information about RAND is available at

Ngày tải lên: 17/02/2014, 22:20

53 246 0
Tài liệu Báo cáo khoa học: How disorder influences order and vice versa – mutual effects in fusion proteins containing an intrinsically disordered and a globular protein docx

Tài liệu Báo cáo khoa học: How disorder influences order and vice versa – mutual effects in fusion proteins containing an intrinsically disordered and a globular protein docx

... N-terminus was obtained by PCR from the plasmid pET21 ⁄ SIC1 [32] with a forward primer (5¢-TAC CTGGCCAATGAATATGCATCATCATCATCATCATA CTCCGTCGACCCCACC-3¢) designed to introduce a hexahistidine tag and a ... chromophore, with a well-defined peak at 527 nm and a shoulder at A B Fig. 6. Near-UV and visible CD spectra for tertiary structure analy- sis. CD spectra acquired in the near-UV (A) and in the visible (B) wavelength ... of ordered structure as PNT, NTAIL or SIC1 are added (Fig. 6B). In conclusion, near and visible CD data are in good agreement with the data provided by far-UV and size- exclusion chromatography

Ngày tải lên: 18/02/2014, 04:20

14 673 0
Herpesviridae – A Look into This Unique Family of Viruses Edited by George D. Magel and Stephen Tyring docx

Herpesviridae – A Look into This Unique Family of Viruses Edited by George D. Magel and Stephen Tyring docx

... et al., 2008). The DNA damage response is also activated during HCMV replication, as indicated by the phosphorylation of ATM and H2AX and the downstream proteins Chk2 and p53. However, during ... Chudasama, Christian Zietz, Michael Stürzl and Andreas Konrad Part 3 Infection in Animals 215 Chapter 10 Herpesviruses of Fish, Amphibians and Invertebrates 217 Steven van Beurden and Marc ... to provide a logical, as well as practical, approach to understanding and treating the various conditions caused by this unique family of viruses. In addition to their up-to- date and extensive...

Ngày tải lên: 08/03/2014, 00:20

330 1,8K 0
Ele ctricity Use d by Office Equipment and Netw ork Equipment in the U.S.: Detailed Report and A ppendices ppt

Ele ctricity Use d by Office Equipment and Netw ork Equipment in the U.S.: Detailed Report and A ppendices ppt

... the t otal amount of paper used and then all ocate this t otal based on prof essional judgment and anecdotal data on typical imaging and paper use rates. We use thi s appr oach, relying on a mixture ... per work day, because this equipment is usually shared and ther efore used f or longer than an indivi dual’s work day. We also used “daytime” for residential equipm ent. We esti mated “dayti me” ... used in a week (hours/week) 2. Daytime status for PM-enabl ed machines Day Active = Average rate of “active” during dayt ime (% ) Day Low = Average rate of “l ow-power” during daytime (%) Day Off ...

Ngày tải lên: 23/03/2014, 23:20

50 455 0

Bạn có muốn tìm thêm với từ khóa:

w