contracting+for+consensus+at+the+gatt+wto

Determinants of Job Satisfaction for  Staff at The University of Danang

Determinants of Job Satisfaction for Staff at The University of Danang

... development of the organization INTRODUCTION Statement of the Problem (cont’d)  Need to get some research data for the director of UD to improve job satisfaction at the UD in the future  Create employee ... employee engagement for organizations  Be the foundation for the organization to increase staff’s loyalty for the University of Danang That’s the reason why research of staff’ s job satisfaction is ... Development, Information Resources, Continuous Education  The English Language Institute INTRODUCTION Statement of the Problem  Importance of job satisfaction  Importance of job satisfaction at The University...

Ngày tải lên: 18/04/2014, 16:25

20 423 0
báo cáo sinh học:" Human resources for health at the district level in Indonesia: the smoke and mirrors of decentralization" ppt

báo cáo sinh học:" Human resources for health at the district level in Indonesia: the smoke and mirrors of decentralization" ppt

... situation is further complicated by the fact that the government has inadequate information about the stock of health care providers at the district level, especially the rapidly increasing private ... resources for health at the district level? • What are the implications of the results for future development of the health sector? East Java Number of subdistricts Methods As much of the information ... the information on each provider did not include employment status and/or primary place of work The aggregate information on employment status and primary place of work for the districts in these...

Ngày tải lên: 18/06/2014, 17:20

16 547 0
Praise for Enemy at the Water Cooler pptx

Praise for Enemy at the Water Cooler pptx

... had their information compromised California was the first state to address this issue California Senate Bill 1386—also known as the California Information Practice Act—states that organizations ... Sector Chief for Information Technology at The FBI’s InfraGard® and a Member and Director of Education at the International Information Systems Forensics Association (IISFA) Dave was the technical ... investigators In fact, some law enforcement stings operate by paying for the information and when the criminal goes to collect the money, that’s when they arrest them However, as with most crimes, there...

Ngày tải lên: 28/06/2014, 23:20

285 258 0
32907 english for tourism  at the hotel reception

32907 english for tourism at the hotel reception

... Type) Configuration) Adults and Children Room Adults Children (Room (Room Type) Configuration) Write and role-play the following conversation At the Rainbow Hotel A lady phones the Rainbow ... reservation She can choose a single or double room, with or without breakfast, smoking or non-smoking The receptionist asks the lady how many nights she wants to stay at the hotel Finally, the ... she wants to stay at the hotel Finally, the clerk asks the lady to spell her name, and then asks for her credit card number and expiration date ...

Ngày tải lên: 28/08/2016, 10:04

2 212 0
Designing an esp syllabus for the second-year students of library study at the national teachers training college

Designing an esp syllabus for the second-year students of library study at the national teachers training college

... study at the NTTC is the subject matter chosen for my thesis Aims and Objectives The study aims at designing an appropriate ESP syllabus for the second year students of library study at the NTTC ... guarantee the effectiveness of the course In order to design and ESP syllabus for the second year SLS at the NTTC, an integrated approach will be the choice, the rationale for this to maximize the ... has the authors name or other persons or institutions The second has the title of the book or other item on the top line the third has the subject of the item on the top line Figure : Organization...

Ngày tải lên: 07/11/2012, 14:36

76 738 4
Techniques for developing content reading skills for the third year students at the university of odonto and stomatology

Techniques for developing content reading skills for the third year students at the university of odonto and stomatology

... possibly express all the ideas and features of what reading is However, from the opinions above, the authors all concentrate on the nature of reading that is the necessity for the reader while dealing ... get the information on the problems they experienced and recommendations as well for improving the students’ ESP reading skills Specifically, the concerning information is as follows: - The students’ ... clear to state that the teachers and students did not share the same idea of making sense of the text based on the context The reason for this is that the teachers found it difficult for the students...

Ngày tải lên: 07/11/2012, 14:50

49 1.2K 2
A study on possible effective pre-reading activities to improve reading skills for 2nd- year english majors at the military science academy

A study on possible effective pre-reading activities to improve reading skills for 2nd- year english majors at the military science academy

... teachers explain that there is no time for these activities, and that their students’ level is already at the intermediate, they understand thoroughly what they have to do, and that there is no need ... activities They want their students to read the text at once and to exploit the text themselves before checking for the feedback later Question is aimed at finding out what the teachers think about the ... classes The analysis of the data is presented in parts The first part is the results based on the questionnaires for the students and the teachers The second part is the results of the class observation...

Ngày tải lên: 07/11/2012, 14:50

45 1.7K 22
Evaluating the Reliability and Validity of an English Achievement Test for Third-year Non- major students at the University of Technology, Ho Chi Minh National University and some suggestions for chan

Evaluating the Reliability and Validity of an English Achievement Test for Third-year Non- major students at the University of Technology, Ho Chi Minh National University and some suggestions for chan

... reliability, N: the number of raters whose combined estimates form the final mark for the examinees, rA, B: the correlation between the raters, or the average correlation among the raters if there are ... Implications The study aims at evaluating the reliability and the validity of the final achievement test for the third-year students at the University of Technology To deal with the stated aims, the ... relevant cue for the study Finally, the writer collected the data, analysed and evaluated the data in order to find answers to the research questions raised at the very beginning of the study The study...

Ngày tải lên: 07/11/2012, 15:05

38 1.9K 13
TECHNIQUES FOR DEVELOPING CONTENT READING SKILLS FOR THE THIRD YEAR STUDENTS AT THE UNIVERSITY OF ODONTO AND STOMATOLOGY

TECHNIQUES FOR DEVELOPING CONTENT READING SKILLS FOR THE THIRD YEAR STUDENTS AT THE UNIVERSITY OF ODONTO AND STOMATOLOGY

... possibly express all the ideas and features of what reading is However, from the opinions above, the authors all concentrate on the nature of reading that is the necessity for the reader while dealing ... get the information on the problems they experienced and recommendations as well for improving the students’ ESP reading skills Specifically, the concerning information is as follows: - The students’ ... skill for reading comprehension for these reasons: firstly learners not need to read all the words in the text, secondly they can read at their own speed and if they not understand the sentence, they...

Ngày tải lên: 07/09/2013, 13:45

24 789 0
Using compensation strategies in listening for 10th form students a case study at the high school for gifted students of vinh university

Using compensation strategies in listening for 10th form students a case study at the high school for gifted students of vinh university

... and the research questions The interview consists of two parts: the first one for personal information and the second one for the content information The number of prepared questions for the ... over the country for some recent years There are two reasons for choosing the 10th form students as the participants of the study Firstly, both the authority and teachers at the high school for ... orientation); negotiating meaning with the speaker and responding (collaborative orientation); and, creating meaning through involvement, imagination and empathy (transformative orientation) Howatt...

Ngày tải lên: 27/12/2013, 20:26

99 805 0
Designing an esp reading syllabus for the second year students at the faculty of urban planning hanoi architectural university (HAU)

Designing an esp reading syllabus for the second year students at the faculty of urban planning hanoi architectural university (HAU)

... syllabuses at the same time One of them will probably be used as the principal organizing feature, but the others are still there, even if they are not taken into account in the organization of the material” ... reading syllabus for the second-year students at the Urban Planning Faculty The setting for the needs analysis including the teaching and learning situation, the details of the subjects (the target ... get the necessary information in the shortest time Of these skills, in their opinions, guessing the meaning of the new words from the contextual clues and using non-text information are the most...

Ngày tải lên: 29/01/2014, 14:39

65 567 1
IN SEARCH OF SOLUTIONS TO IMPROVING THE ENGLISH LANGUAGE PROFICIENCY FOR UNDER GRADUATE STUDENTS AT THE COLLEGE OF TECHNOLOGY (COT)   VIETNAM NATIONAL UNIVERSITY, HANOI

IN SEARCH OF SOLUTIONS TO IMPROVING THE ENGLISH LANGUAGE PROFICIENCY FOR UNDER GRADUATE STUDENTS AT THE COLLEGE OF TECHNOLOGY (COT) VIETNAM NATIONAL UNIVERSITY, HANOI

... that those graduate students who want to further their education in the master course have to take the entrance exam for English at the pre-intermediate level With that low expectation from the ... to use the various formal and informal forms of the language in different situations to arrive at the same thing, that is they have the inherent ability to use just the right word or grammatical ... English For the educational authorities, the results of the study may encourage them to create better syllabi and implement better language policies For the teachers, the study hopes to show them the...

Ngày tải lên: 05/02/2014, 21:52

88 676 1
Tài liệu Priority Setting for Reproductive Health at the District Level in the context of Health Sector Reforms in Ghana doc

Tài liệu Priority Setting for Reproductive Health at the District Level in the context of Health Sector Reforms in Ghana doc

... district level There is, therefore, a gap between the RH components as stated in the national policy and the components available at the district level The reality districts face is that they not have ... recommendations that are negotiated at the summit The last component of the health summit is the business meeting, which is attended by delegates of the MOH and funding partners It is at the business ... district level There is therefore a gap between the RH components as stated in the national policy and the components available at the district level The reality districts face is that they not have...

Ngày tải lên: 13/02/2014, 10:20

42 1.4K 0
Tài liệu Opportunity for All - How the American Public Benefits from Internet Access at U.S. Libraries pptx

Tài liệu Opportunity for All - How the American Public Benefits from Internet Access at U.S. Libraries pptx

... can strengthen the impact of local economic development efforts by building broader and more seamless workforce information networks for the public State and local education reform initiatives should ... the Graduate Assistant Crew at the University of Washington Information School for their background research and responsiveness to the needs of the project Opportunity for All: How the American ... fortunate to have the enthusiastic participation of many students enrolled at the University of Washington Student volunteers from the Information School came from the undergraduate Informatics program,...

Ngày tải lên: 18/02/2014, 00:20

212 1.4K 0
Tài liệu Báo cáo khoa học: The Saccharomyces cerevisiae vacuolar acid trehalase is targeted at the cell surface for its physiological function docx

Tài liệu Báo cáo khoa học: The Saccharomyces cerevisiae vacuolar acid trehalase is targeted at the cell surface for its physiological function docx

... AGCAAGCACTACGTATCACGACAAACCAAC GCTTCTGGATCGTAGTTCAA CATTATTGGAATGAGGAAAT ATTTCCTCATTCCAATAATG TTGAACTACGATCCAGAAGC GGATCCTCATTGAGAACAATTTCCTTGA GGATCCATCATGTTCTCATCATCATAATATG GGATCCGTTAAATATAATGCAGTGACGAAGATA GGATCCAAGTCAAACCTTGAGAAAGAACGA ... ATGATGATGATAACAAAGGAGCTACAATCAAGGAAATTGTTCTCAATGATCGGATCCCCGGGTTAATTAA ATCCAAACTTATAATATTAAAAAAAGCGCTACTTATATGCATCATTTCATGAATTCGAGCTCGTTTAAAC GCACTAGTATGAAAAGAATAAGATCGCTTT GCCCCGGGATCATTGAGAACAATTTCC GCGGATCCGTATGACCACATTCTATACTGA ... CACGGCATATTATGATGATGAGAACATGATGGATCTCG CGCGGATCCCCGGGTTAATTAA TTTAGAATGGCTTTTGAAAAAAATAAAAAAGACAATAAGTTTTATAACCTGAATTCGAGCTCGTTTAAAC ATTTCCTCATTCCAATAATG TACCCATACGATGTTCCTG CAAAGCGATCTTATTCTTTT...

Ngày tải lên: 18/02/2014, 06:20

15 475 0
Báo cáo khoa học: Binding of ATP at the active site of human pancreatic glucokinase – nucleotide-induced conformational changes with possible implications for its kinetic cooperativity doc

Báo cáo khoa học: Binding of ATP at the active site of human pancreatic glucokinase – nucleotide-induced conformational changes with possible implications for its kinetic cooperativity doc

... mm The fact that the kinetic cooperativity is dependent on the MgATP concentration is consistent with previous data reported for the rat liver isoform [33,34] With MgATP as the variable substrate, ... molecular motion was further indicated by the dyndom algorithm [30], with the coordinates obtained for the ligand-free form and the hGK–ATP complex at the end of the simulations (Figs 6B,C and ... and the subsequent higher affinity for Glc efficiently accelerate the chemical reaction (k3) on binding of the cosubstrate MgATP The overall binding constant K1 for Glc and the values for the forward...

Ngày tải lên: 06/03/2014, 00:20

15 374 0
look at the important information in this header.1look at the important information in this header.We encourage you to keep this file on your own disk, keeping an electronic path open for the next readers. Do not remove this. **Welcome To The World o doc

look at the important information in this header.1look at the important information in this header.We encourage you to keep this file on your own disk, keeping an electronic path open for the next readers. Do not remove this. **Welcome To The World o doc

... heredity, or rather the radical and violent contrast of her maternal and paternal heredity By her father she was an aristocrat and related to the reigning houses Information prepared by the Project ... perhaps in the hope that the remembrance of the days of their engagement might have some effect on them It was there, in 1824, that the famous scene of the blow took place They were playing at a regular ... legal advisor 18 is that their nature should not change, that they should not deteriorate, as is so often the case When they remain intact to the end, they leave behind them, in the soul, a trail...

Ngày tải lên: 06/03/2014, 23:21

94 671 0
Xem thêm
w