citizens perceptions of the eu as a global actor
Searching for a Mate: The Rise of the Internet as a Social Intermediary potx
... the ACS) The higher rate of interraciality in HCMST is mainly due to the fact that the HCMST survey was offered only in English, whereas the ACS was offered in a variety of languages Asians and ... Kennedy and Davis 1993), but gay bars were not always safe or pleasant, and the bars inevitably reached only a small percentage of the local gay and lesbian communities Compared to the gay bar, the ... through almost all of the traditional ways has fallen Family of origin and primary and secondary school (the “traditional” institutions based around place of origin) had already declined in importance...
- 50
- 470
- 0
A Portrait of the Artist as a Young Man ppt
... was not like the smell of the old peasants who knelt at the back of the chapel at Sunday mass That was a smell of air and rain and turf and corduroy But they were very holy peasants They breathed ... would be dark and sleeping There was cold night air in the chapel and the marbles were the colour the sea was at night The sea was cold day 16 A Portrait of the Artist as a Young Man and night: ... had big voices and big boots and they studied trigonometry That was very far away First came the vacation and then the next term and then vacation again and then again another term and then again...
- 317
- 341
- 0
The Project Gutenberg E Book of The Argentine as a Market, by N. L. Watson potx
... rise as, in all probability they will, a rise in wages will be imperative This, in the case of railways would mean an increase in rates, as there are few who are earning more than a reasonable ... canvas shoe factories and similar works Even the production of such essentially native goods as “ponchos” has lapsed in favour of German and Italian wares While the manufacture of matches—in the ... commercial development there is certain of an unfavourable reception But as sand and mud are the only base from Santa Fé to Bahia Blanca—in some cases there being not even firm sand—and as dredging...
- 199
- 354
- 0
báo cáo khoa học: " Osteonecrosis of the jaw as a possible rare side effect of annual bisphosphonate administration for osteoporosis: A case report" ppsx
... Oral Maxillofac Surg 2003, 61(9):1115-1117 Advisory Task Force on Bisphosphonate-Related Osteonecrosis of the Jaws, American Association of Oral and Maxillofacial Surgeons: American Association ... by mild to moderate pain on palpation A panoramic radiograph and cone beam computed tomography identified radiolucent areas at the resected apices of teeth 22 and 23 as well as the region surrounding ... http://www.jmedicalcasereports.com/content/5/1/477 Page of Figure a) intraoral examination of her left lower jaw with fistula formation and pus on palpation in region 38; b) panoramic radiograph with mixed radiopaque and radiolucent areas surrounding...
- 4
- 233
- 0
Students perceptions of using portfolios as a means of evaluation in an english foreign language translation course
... studies have been involved ii STATEMENT OF AUTHORSHIP Title: Students’ Perceptions of Using Portfolios as a Means of Evaluation in an English Foreign Language Translation Course, a Case Study at the ... Faculty of Foreign Languages, Hanoi Pedagogical University N02” (Graduation paper submitted in partial fulfillment of The Degree of Bachelor of Arts in English) I certify that all the materials ... portfolios in their learning process; therefore teacher should apply portfolios in more foreign language classes Based on the results of the survey, it is clear that portfolio has a great of benefits;...
- 7
- 361
- 1
Native and Non-Native approaches to teaching English as a Global Lingua Franca as perceived by teachers and students at the Faculty of English Language Teacher Education, ULIS – VNU
... Multiingual Matters, 96-116 Canagarajah, A S (2006) Negotiating the local in English as a lingua franca Annual Review of Applied Linguistics 26, 1970218 Canagarajah, A S (2005) Changing communicative ... English as a global language TESOL Quarterly, 35, 605-606 Nunan, D (2003) The impact of English as a global language on educational policies and practices in the Asia-Pacific Region TESOL Quarterly, ... communication: Interactions in English as a lingua franca and the myth of mutual intelligibility In: Gnutzmann, C (Ed.) Teaching and Learning English as a Global Language Tubingen: Stauffenburg,...
- 12
- 816
- 7
A delicate stage the future of renminbi as a global investment currency chinese
... effort has been taken to verify the accuracy of this information, neither The Economist Intelligence Unit Ltd nor the sponsor of this report can accept any responsibility or liability for reliance ... “Boardroom risk in a changing economic climate—Executive Summary”; 《经 济学人》会议，2015年9月2日 http://www.goldmansachs.com/gsam/glm/insights/market-insights/china-bondmarket/china-bond-market.pdf © The ... 1301 Cityplaza Four 12 Taikoo Wan Road Taikoo Shing Hong Kong Tel: (852) 2585 3888 Fax: (852) 2802 7638 E-mail: hongkong@eiu.com Geneva Boulevard des Tranchées 16 1206 Geneva Switzerland Tel: (41)...
- 27
- 278
- 0
Tài liệu THIS DISPOSTION IS NOT CITABLE AS PRECEDENT OF THE T.T.A.B04/3/02 Paper No. 12 RFC docx
... its application are completely unrelated to those set forth in the registration cited as a bar to registration of applicant’s mark The Examining Attorney was not persuaded by applicant’s arguments, ... in the application and the written arguments presented in the appeal briefs After careful consideration of these materials, we hold that the refusal to register must be affirmed As applicant ... instituted the appeal and both applicant and the Examining Attorney filed briefs Applicant did not request an oral hearing before the Board Accordingly, we have considered this appeal based on the written...
- 8
- 416
- 0
Smoking and reproduction: The oviduct as a target of cigarette smoke ppt
... had a picomolar LOAEL in the ciliary beat frequency assay Many of the compounds in Table were also screened using a chick chorioallantoic membrane (CAM) assay that measures growth of the CAM and ... oviduct: a regulator of local contraction and gamete transport J Cardiovasc Pharmacol 2004, 44 Suppl 1:S248-51 111 Wijayagunawardane MP, Miyamoto A, Taquahashi Y, Acosta TJ, Nishimura M, Sato K: Angiotensin ... femtomolar range (Table 1) In general, if a chemical were inhibitory, it acted in all three bioassays, although the potency and efficacy for a particular chemical varied among the assays Some of the...
- 17
- 733
- 0
Báo cáo khoa học: Zinc-binding property of the major yolk protein in the sea urchin ) implications of its role as a zinc transporter for gametogenesis ppt
... as a substrate for localization of the labeled MYP Statistical analysis Data were expressed as the mean ± SEM Statistical analysis was performed using instat software (GraphPad Software) The ... testis at stage 1, and eggs In all of the samples analyzed, a large protein peak was observed at an elution position of 72 mL (peaks a, b, c, and d), where the estimated molecular mass was about ... on a shaker at °C, the solutions were withdrawn from each cell The zinc concentration of the solutions was measured by ICP-AES The data were analyzed using prism software (GraphPad Software, San...
- 14
- 442
- 0
Báo cáo Y học: The mitochondrial-lysosomal axis theory of aging Accumulation of damaged mitochondria as a result of imperfect autophagocytosis ppt
... aging A number of early explanations of aging, such as Orgel’s error catastrophe theory and the somatic mutation theory, were based on the idea that aging results from the accumulation of synthetic ... imperfect, thereby initiating the age-related accumulation of garbage Given this, it is reasonable to expect a further decrease in autophagocytotic capacity at old age and this may be related to the ... Martinuzzi, A. , Hurko, O & Attardi, G (1992) Marked replicative advantage of human mtDNA carrying a point mutation that causes the MELAS encephalomyopathy Proc Natl Acad Sci USA 89, 11164–11168 49 Wallace,...
- 7
- 444
- 0
modeling of the conduction in a wo3 thin film as ozone sensor
... by the gas and removed from the surface, the depletion layer and the resistivity are then decreased [9–12] The numerous approaches differ by the adsorption isotherm and the way of evaluating the ... in the atmosphere, the influence of another gas is not studied The action of oxygen is first analyzed, then the ozone one The combined action of the two mixed gases is finally studied at the end of ... described in the literature In a previous paper [23], a model of gas sensor based on the conductivity decrease of a polycrystalline film of metal oxide (WO3 ), in an oxidizing atmosphere, was already described...
- 8
- 662
- 0
Báo cáo khoa học: Lack of stabilized microtubules as a result of the absence of major maps in CAD cells does not preclude neurite formation pot
... GCTTGAAGGCGCTGGATCTGCGACAATAG GACTGGGCTTTCATCAGCGACAGGTGGC GTGAACCACCAAAATCGGAGAACGAAGC CAGGTTCTCAGTAGAGCCAATCTTCGACCTGAC AGAGTCGGATGCAGTTGCCCGGGCAACA GGCTCCTCCAGCACCCTCCGGGTCCCG CCCCAAACTTGTGACCATCATTC GGAGAAATCATCTTGAGCATAGCG ... GGCTCCTCCAGCACCCTCCGGGTCCCG CCCCAAACTTGTGACCATCATTC GGAGAAATCATCTTGAGCATAGCG CGAACTCTCAAGGGC ATGCATCAGAACCATGCACG AGCCCTACAATTCCATCCTCACC GCTGAAGGAGACGATGAGGGTGA 82898–82923 83581–83552 91489–91517 92431–92404 ... biochemical basis of lissencephaly, a human neurological disease characterized by an abnormal layering of brain cortex, led to the discovery of these two proteins, which are lacking or mutated in patients...
- 14
- 416
- 0
THE ECONOMIC CONSEQUENCES OF AGEING POPULATIONS (A COMPARISON OF THE EU,US AND JAPAN) ppt
... and Japan respectively (Graph 1) These increases in the overall total reflect a broadly stabilising youth ratio and a sharp increase in the old age share of the total As regard the latter old age ... close to ½ a percentage point in the case of the EU and Japan and around a ¼ of a percentage point in the US In absolute terms the EU s and Japan’s annual average growth rate over the period ... PERIOD 2000-2050 EU1 5 Annual Change Average Relative % To Change Baseline US Annual Change Average Relative % To Change Baseline Japan Annual Change Average Relative % To Change Baseline Employment...
- 74
- 489
- 0
A Study on the Effects of Argentine Tango as a Form of Partnered Dance for those with Parkinson Disease and the Healthy Elderly pptx
... suggested that the basal ganglia, the area of neurological degeneration in those with PD, are specifically involved in the control of dance movements Increased activity in the basal ganglia was observed ... for their assistance with this study This work was supported by a grant from the Marian Chace Foundation to Madeleine Hackney and a grant from the American Parkinson Disease Association to Gammon ... questionnaire what they liked best and least about the program They greatly appreciated the camaraderie and socialization engendered by the program Being able to meet others with PD and their caregivers...
- 19
- 648
- 0
báo cáo hóa học: " Considerations for the future development of virtual technology as a rehabilitation tool" doc
... sends the data to a specific device or machine that then copies the data to the various people that are subscribers to the data For example, a user send their data to a multicast address and the ... estimated that only about 5–10% of the available fiber has been lit, and each fiber has several terabits/s of capacity The dot-com implosion has made this dark fiber and wavelengths of light in the ... Journal of NeuroEngineering and Rehabilitation 2004, 1:13 the remote collaborator (this often is referred to as an avatar); the video and/or audio channel (that facilitates face-to-face conversation.)...
- 10
- 449
- 0
báo cáo khoa học: " Using the theory of planned behaviour as a process evaluation tool in randomised trials of knowledge translation strategies: A case study from UK primary care" pot
... was calculated as the mean of all items contributing to the construct Cronbach’s alpha was used to ascertain the reliability of each of the scales If reliability was lower than 0.7, an exploratory ... intention and behaviour, because the behaviour data were at a practice level, a summary measure of intention for each practice had to be calculated This was generated in two ways – by taking the mean ... the measurement of serum ferritin in the assessment of microcytic anaemia (ferritin), the measurement of serum follicle stimulating hormone (FSH) in the assessment of menopausal status, and the...
- 9
- 367
- 0
Báo cáo y học: " Toxoplasmosis presenting as a swelling in the axillary tail of the breast and a palpable axillary lymph node mimicking malignancy: a case report" potx
... Sasaki H, Takada E, Sunagawa M, Masawa N: Fine needle aspiration of toxoplasmic lymphadenitis in an intramammary lymph node A case report Acta Cytol 2001, 45:259-262 Siriwardana et al Journal ... several weeks [2] Page of Conclusions Toxoplasmosis rarely presents as a mass in the axillary tail of the breast and may be considered as a differential diagnosis in patients presenting with axillary ... biopsy The results of a histological examination (Figures and 2) of the resected specimens of breast and axillary lesions were suggestive of an intramammary and axillary lymph node mass with marked...
- 4
- 399
- 0
Báo cáo khoa hoc:" Posterior dislocation of the elbow as an unusual presentation after a total hip replacement: a case report" pdf
... defined as the Lateral collateral ligament (LCL) with its ulnar and radial components and the annular ligament The lateral ulnar collateral ligament (LUCL) is described as a discrete part of the ... BFSWC: Anatomy of the ulnar part of the lateral collateral ligament of the elbow Clin Anat 1992, 5:296-303 Beighton PH, Solomon L, Soskolone CL: Articular mobility in an African population Am Rheum ... intravenous sedation X Figure Elbow AP xray AP xray Elbow ray of the dislocated elbow was not performed in view of the pain and the obvious clinical appearance confirming the diagnosis A check x-ray following...
- 4
- 327
- 0
Báo cáo y học: " Bullet-induced synovitis as a cause of secondary osteoarthritis of the hip joint: A case report and review of literature" ppt
... review and formatting the material All authors read and approved the final manuscript Consent The authors confirm that a formal written consent was taken for the publication of this case report ... mechanical destruction of joint may be caused by several factors Firstly the initial trauma may cause fractures of articular bone, leading to an incongruous and irregular joint surface Motion of ... effects of intra-articular lead implants on the synovium, articular cartilage and meniscus of white rabbits at 4, 6, 10 and 14 weeks Articular and meniscal changes that Harding et al came across were...
- 4
- 343
- 0
Tìm thêm: xác định các nguyên tắc biên soạn khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ rôto dây quấn đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008