... Chem 26 6, 11 62 11 69 54 Brondello, J.M., Pouyssegur, J & McKenzie, F.R (19 99) Reduced MAP kinase phosphatase -1 degradation after p 42/ p44MAPK-dependent phosphorylation Science 28 6, 2 514 2 517 55 Saxena, ... receptor by protein kinase C J Biol Chem 2 71, 12 8 91 12 896 51 El-Shemerly, M.Y., Besser, D., Nagasawa, M & Nagamine, Y (19 97) 12 -O-Tetradecanoylphorbol -13 -acetate activates the Ras/ extracellular ... respectively References Palsson, B (20 00) The challenges of in silico biology Nat Biotechnol 18 , 11 47 11 50 Kitano, H (20 02) Systems biology: a brief overview Science 29 5, 16 62 16 64 Kholodenko, B.N., Demin,...
Ngày tải lên: 19/02/2014, 16:20
Ngày tải lên: 08/04/2017, 09:22
Báo cáo khoa học: Membrane type-1 matrix metalloprotease-independent activation of pro-matrix metalloprotease-2 by proprotein convertases docx
... type 15 16 17 18 19 20 21 22 23 24 25 26 1- matrix metalloproteinase (MT1-MMP) to tissue inhibitor of metalloproteinase (TIMP) -2 regulates MT1MMP processing and pro-MMP -2 activation J Biol Chem 27 5, ... expressing pro-MMP -2 (WT), pro-MMP -2 N66I ⁄ L67V mutant (N66I ⁄ L67V), pro-MMP -2 N109I ⁄ Y 110 F mutant (N109I ⁄ Y 110 F) and pro-MMP -2 N66I ⁄ L67V ⁄ N109I ⁄ Y 110 F mutant (N66I ⁄ L67V ⁄ N109I ⁄ Y 110 F) The ... metalloproteinases Ann NY Acad Sci 7 32, 11 – 21 FEBS Journal 27 6 (20 09) 62 71 628 4 ª 20 09 The Authors Journal compilation ª 20 09 FEBS B.-H Koo et al Activation of pro-matrix metalloprotease -2 by proprotein convertases...
Ngày tải lên: 16/03/2014, 00:20
342 Toeic vocabulary tests words by meaning Episode 1 Part 2 potx
... Test 19 TOEIC Vocabulary / Word by Meaning / Test # 19 Q1 abbr describing something that can be left out isn't required (a) I.P.O Q2 (c) C.F.O (b) Inc (d) Ltd (b) C.O.D ... accord (b) rear Q10 n resident; native of a country (a) interpreter 41 (b) citizen PHOTOCOPIABLE © www.english-test.net Test 24 TOEIC Vocabulary / Word by Meaning / Test # 24 Q1 v to ask for; ... a price (a) delete 42 (b) take PHOTOCOPIABLE © www.english-test.net Test 25 TOEIC Vocabulary / Word by Meaning / Test # 25 Q1 abbr large company; firm; business (a) C.T.O Q2 (d) ROI (b) C.O.D...
Ngày tải lên: 22/07/2014, 01:21
342 Toeic vocabulary tests meanings by word Episode 1 Part 2 pdf
... midnight; in the afternoon; after the hour of 12 :00 noon 37 PHOTOCOPIABLE © www.english-test.net Test 20 TOEIC Vocabulary / Meaning by Word / Test # 20 Q1 Answers Index adv below (a) clearly; in ... excellent; of high quality 38 PHOTOCOPIABLE © www.english-test.net Test 21 TOEIC Vocabulary / Meaning by Word / Test # 21 Q1 Answers Index n infancy (a) a support that consists of a horizontal ... between two or more countries 39 PHOTOCOPIABLE © www.english-test.net Test 22 TOEIC Vocabulary / Meaning by Word / Test # 22 Q1 Answers Index adj waste (a) inventive; innovative; artistic (b) firm;...
Ngày tải lên: 22/07/2014, 01:21
Crc Press Mechatronics Handbook 2002 By Laxxuss Episode 1 Part 2 pptx
... computational power equal to that of one 19 92 vintage computer notebook This single-chip microcontroller has the computational power equal to four 19 81 vintage IBM personal computers, or to two 19 72 vintage ... correct value is recognized because between the logical value voltages there is a gap (see Fig 4 .1) We can arbitrarily improve the resolution of signals by simply using more bits 20 02 CRC Press ... In the case of memory elements, it is equal to approximately 1. 5 times the current amount In the case of other digital ICs, it is equal to approximately 1. 35 times the current amount In digital...
Ngày tải lên: 05/08/2014, 21:21
McGraw-Hill- PDA Robotics - Using Your PDA to Control Your Robot 1 Part 2 doc
... peripheral bus 32 16 16 SDRAM memories 32 E M I F F MPU Bus 32 32 32 32 32 32 MPU public peripherals McBSP2 MPU peripheral bridge System DMA controller 32 MPU public peripherals bus I M I F SRAM 1. 5M bits ... least Palm OS version 1. 1 will be sufficient for this project Look around if you don’t have one, and you will likely find a very good deal on a used PDA 11 12 DSP MMU 32 TMS 320 C55x DSP (instruction ... Triscend, Virata, Yamaha, Zarlink, and ZTEIC The SA -11 10: An Example of ARM Architecture The SA -11 10 is a general-purpose, 32- bit RISC microprocessor with a 16 kB instruction cache (Icache), an kB write-back...
Ngày tải lên: 10/08/2014, 04:23
báo cáo khoa học: " FCR (Fludarabine, Cyclophosphamide, Rituximab) regimen followed by 90yttrium ibritumomab tiuxetan consolidation for the treatment of relapsed grades 1 and 2 follicular lymphoma: a report of 9 cases" pot
... Experimental & Clinical Cancer Research 2 011 , 30 :16 http://www.jeccr.com/content/30 /1/ 16 Received: 30 September 2 010 Accepted: February 2 011 Published: February 2 011 References Tam CS, Wolf M, Prince ... followed by autologous stem cell transplantation (Table 2) Restage before RIT: CT, PET, BMB Zevalin® FCR -28 CYCLES 11 .1- 14.8 MBq/Kg CR/CRu or PR F: 25 mg/m2 i.v days 1- 3 C: 1gr/m2 i.v day R: 375mg/m2 ... patients with follicular lymphoma treated by ibritumomab tiuxetan Y90: multicentric study Ann Oncol 2 010 , 21 : 1877 -18 83 Page of doi :10 .11 86 /17 56-9966-30 -16 Cite this article as: Pisani et al.: FCR...
Ngày tải lên: 10/08/2014, 10:21
Báo cáo khoa học: " A real-time RT-PCR for detection of clade 1 and 2 H5N1 Influenza A virus using Locked Nucleic Acid (LNA) TaqMan probes" pps
... Plas PF Stool Total 0 10 rRT-PCR positive Clade 10 Clade 2 .1 17 0 25 23 Clade 2. 3 2 23 23 Total 14 31 2 58 56 rRT-PCR positive 13 30 2 56 NS = Nasal swab; TS = Throat swab; TA = Tracheal aspirate; ... Primers and probe used in this study Name Sequencea Nucleotideb Sense 5’-TTGGTTACCATGCAAACAAYT-3’ 91- 111 Antisense 5’-TRTCTTGGGCRTGTGTAACA-3 15 2 -17 1 Probe 11 9 -14 3 5’-FAM-CAGGTTGACACAATAATGGAAAAGBHQ3-3’ ... virus in eastern Asia Nature 20 04, 430(6996) :20 9- 21 3 WHO: Evolution of H5N1 avian influenza viruses in Asia Emerg Infect Dis 20 05, 11 (10 ) :15 15 -15 21 Smith GJ, Naipospos TS, Nguyen TD, de Jong MD,...
Ngày tải lên: 12/08/2014, 04:21
Báo cáo y học: " Caveolin-1 and -2 in airway epithelium: expression and in situ association as detected by FRET-CLSM" pps
... Primer Product length (bp) Position of amplified DNA (bp) cav -1 Z46 614 .1 123 25 14 7 cav -1 Z46 614 .1 1 21 165 28 5 cav -2 BC0 620 59 .1 106 3 92 497 cav -2 BC0 620 59 .1 127 17 6–3 02 β-MG NM_ 0 12 5 12 Forward: CAGCATGTCTGGGGGTAAAT ... Lisanti MP: Caveolin -1 null mice are viable but show evidence of hyperproliferative and vascular abnormalities J Biol Chem 20 01, 27 6:3 8 12 1-3 813 8 22 23 24 25 26 27 28 29 30 31 32 33 34 Drenckhahn ... correction of the manuscript 16 19 20 21 References 10 11 12 13 14 15 Razani B, Woodman SE, Lisanti MP: Caveolae: from cell biology to animal physiology Pharmacol Rev 20 02, 54:4 31- 467 Cohen AW, Hnasko...
Ngày tải lên: 12/08/2014, 16:20
INNOVATION TEACHING METHODS EDUCATION PROJECT GRADE 3 ENGLISH COURSES FROM WEEK TO WEEK 1 2 BY KNOWLEDGE SKILLS STANDARDS.
... GRADE ENGLISH COURSES FROM WEEK TO WEEK , BY KNOWLEDGE SKILLS STANDARDS Legs to thank! WEEK: Period Unit 1: HELLO Lesson 1( 1, 2, 3) I Objectives: Knowledge: - By the end of the lesson Ps will be able ... exercises in workbook, learn by heart the new words WEEK Period 7: UNIT 2: WHAT’S YOUR NAME? Lesson 1: Part 1- 2- 3 http://vn.ipanelonline.com/register?inviter_id =19 65836 https://vn.ann-kate.com/registration/index.php?inviter=VNMT1306030 025 ... of the listening text Answer: 1. b 2. a http://vn.ipanelonline.com/register?inviter_id =19 65836 https://vn.ann-kate.com/registration/index.php?inviter=VNMT1306030 025 Let’s write - Have pupils open...
Ngày tải lên: 02/06/2015, 16:08
Financial risk manager handbook plus test bank part 1 and 2 sixth edition by philippe jorion GARP
Ngày tải lên: 01/04/2017, 09:51
Manual of business accounting 1 and 2 11e by frank wood
... Tred 18 41 67 11 22 16 19 25 95 19 14 27 83 24 21 527 Cash Balance c/d (a) 1, 153 340 68 640 42 12 4 1, 710 Motor Exps Cleaning Casual Labour 18 41 67 11 22 16 19 25 95 19 14 27 83 24 65 335 26 21 1 01 ... 46 LIFO 15 ,840 11 ,3 92 4,448 1, 520 11 1 14 1, 645 2, 803 16 ,0 32 5, 624 10 ,408 16 ,0 32 450 4 ,19 0 FIFO 21 / 2% @ 5,4 32 = 13 5.80 LIFO 21 / 2% @ 4,448 = 11 1 .20 FIFO 1/ 8 @ months @ 384 = 12 .00 LIFO 1/ 8 @ months ... 18 12 5 15 0 @ 19 Inventory after each transaction 12 0 @ 16 12 0 @ 16 1, 920 80 @ 18 1, 20 0 75 @ 16 75 @ 16 15 0 @ 19 60 @ 16 15 0 @ 19 21 0 1, 920 3 , 12 0 1, 20 0 1, 20 0 2, 850 15 @ 16 Frank Wood...
Ngày tải lên: 04/04/2017, 15:29
Cơ học kết cấu tập 1 chương 2.pdf
... 0,9 52 0,8 42 0,6 92 0, 615 0, 529 Page 42 (T) Mk (T.m) Qk (T) Nk (T) 3,75 3,75 3,75 3,75 -1, 25 -1, 25 -1, 25 -1, 25 -1, 25 -1, 25 -1, 25 -1, 25 -1, 25 1, 50 3,50 4,69 4,69 3,50 1, 50 -1, 00 -1, 50 -1, 50 -1, 00 ... H .23 a A HA VA 2, 5m 2, 5m 10 m Nk = - Qkd sinak - H.cosak B HB 5m z VB M (T.m) Q (T) 1, 5 1, 8 2, 0 2, 0 1, 9 1, 9 0,4 0,6 1, 1 2x1m 2x1m 5x1m 2x0,5m H .23 b VB 1, 9 VA z 0,66 1, 1 1, 5 1, 9 1, 8 4,7 1, 7 1, 2 ... = 2. VA - 2. q .1 = 2. 3 ,1 - 1, 2. 2 .1 = 4,4 MBC = -2. VD = -2. 2 ,2 = -4,4 QBA = VA - 2. q = 3,4 - 2 .1, 2 = 1; NBA = QBC = 0; NBC = -VD = -2, 2 Tải C: MCB = -2. VD = -2. 2 ,2 = -4,4; QCB = 0; NCB = -VD = -2, 2...
Ngày tải lên: 23/08/2012, 15:03
Giáo án luyện tập cho ngưới mới tập (Từ 0 - 1 năm)- Upload by Trong Nhan.pdf
... anh Gia nhập: Sep 2 010 Bài gửi: 374 sonvalentine cảm ơn 16 tuổi,1m75- 70kg Dù thiếu thước không chùn bước Trích d ẫn #11 4-0 -20 11 12 :17 PM giangnam233 WTH Mem Gia nhập: May 2 011 Bài gửi: Anh em ... Jul 2 010 Nơi cư ngụ: QuangZ hou Bài gửi: 1, 7 52 Canon EOS 1Ds Mark III,Lens:Canon EF 70- 20 0mm /2. 8L IS II, Canon EF 85mm Honda CBR 600cc 20 08 Tôi Đi tim đẹp Trích d ẫn 4-0 -20 11 12 :16 PM #10 PDFmyURL.com ... Jul 2 010 Nơi cư ngụ: QuangZ hou Bài gửi: 1, 7 52 Sửa sonvalentine : 04-06 -2 011 lúc 12 :10 PM mrdang89, lionmonkey, Vnn_68 and 12 others like this Canon EOS 1Ds Mark III,Lens:Canon EF 70- 20 0mm /2. 8L...
Ngày tải lên: 27/08/2012, 09:21
Chương 1 Phần 2 PHÂN LOẠI VÀ PHƯƠNG PHÁP GIẢI MỘT SỐ BÀI TẬP VỀ HYDROCACBON TRONG CHƯƠNG TRÌNH THPT
... n CH2 C CH CH2 TH1 ,2 CH=CH2 CH2 CH3 n CH2 C CH CH2 TH3,4 CH3 CH2 CH2 CH CH3 C CH CH2 TH1,4 CH2 CH3 n CH CH CH2 C n CH3 n C CH2 C CH CH2 CH3 CH CH2 TH1 ,2 CH2 CH CH2 n n CH CH2 - Pentadien -1, 4 ... D→C2H4(F) + C A → D(C2H6) + F(C2H4) ⇒ A : C4H10 Vậy A : C4H10; C:H2 ; D:C2H6 ; F : C2H4; G:C2H4Br2 ; J:C2H2 Ptpứ : C4H10 Cracking→ C2H6 + C2H4 ,t C2H6 t C2H4 + H2 → C2H4 + Br2 → C2H4Br2 ... Ca(OH )2 dư, thu ↓ CaCO3 CO2 + Ca(OH )2 → CaCO3↓ + H2O • Thốt ngồi hỗn hợp khí CH4, C2H4, C2H2 dẫn qua dd AgNO3/NH3 C2H2 bị giữ lại ↓ C2Ag2, khí CH4, C2H4 C2H2 + 2AgNO3 (dd) + 2NH3 → C2Ag2↓ + 2NH4NO3...
Ngày tải lên: 04/09/2012, 22:47
PHÁT TRIỂN DỊCH VỤ THANH TOÁN QUỐC TẾ BẰNG PHƯƠNG THỨC THƯ TÍN DỤNG TẠI NGÂN HÀNG THƯƠNG MẠI CỔ PHẦN CÔNG THƯƠNG VIỆT NAM – VIETINBANK- CHI NHÁNH 1-TPHCM (2).docx
... động 2. 900 3.700 3.740 Cá nhân 1. 100 1. 400 1. 440 Doanh nghiệp 1. 800 2. 300 2. 300 Cho vay 1. 600 2. 200 2. 900 Cá nhân 20 0 26 0 430 Doanh nghiệp 1. 400 1. 940 2. 470 Lợi nhuận 10 2 88 11 1 Doanh số TTQT 14 0 ... hành ngày 25 /10 /20 06, có hiệu lực vào ngày 01/ 07 /20 07 Văn xuất năm 19 33 sau sửa đổi qua năm 19 51, 19 62, 19 74 sửa năm 19 83 (số 400.ICC) văn ICC – UCP – No500 có giá trị hiệu lực từ ngày 1/ 1 /19 94 UCP ... trực 20 USD 20 USD 20 USD 20 USD tiếp Thông báo 15 USD 10 USD 10 USD 10 USD sửa đổi 0 .15 % trị giá 0 .15 % trị giá Phí 0 .18 % trị giá 0 .2% trị giá LC LC (20 USD= 20 (5USD
Ngày tải lên: 17/09/2012, 16:46