cancer stem cells a revisitation of the anaplasia concept

Báo cáo y học: "Deciphering the molecular machinery of stem cells: a look at the neoblast gene expression profile" pps

Báo cáo y học: "Deciphering the molecular machinery of stem cells: a look at the neoblast gene expression profile" pps

... untreated planarian and (d) a planarian days after 30 Gy X-ray treatment Expression of the EST clone 32903884 (Sam68-like mammalian protein 1) in (e) an untreated planarian and (f) a planarian days ... Taira M, Sanchez Alvarado A, Agata K: FGFRrelated gene nou-darake restricts brain tissues to the head region of planarians Nature 2002, 419:620-624 Ogawa K, Ishihara S, Saito Y, Mineta K, Nakazawa ... lowdose X-ray treatment On the basis of data presented in the literature we hypothesize that most of them act in a coordinated manner, as part of a complex network of signal cascades that are known...

Ngày tải lên: 14/08/2014, 20:22

17 310 0
Báo cáo y học: " Gene expression profiling of human prostate cancer stem cells reveals a pro-inflammatory phenotype and the importance of extracellular matrix interactions" pps

Báo cáo y học: " Gene expression profiling of human prostate cancer stem cells reveals a pro-inflammatory phenotype and the importance of extracellular matrix interactions" pps

... through the JAK-STAT (Janus activated kinase-signal trans- ducer and activator of transcription) pathway and the interaction of cell surface receptors with the extracellular matrix and associated ... MYC activation in high-grade papillary renal cell carcinoma Cancer Res 2007, 67:3171-3176 Kanehisa M, Goto S, Hattori M, Aoki-Kinoshita KF, Itoh M, Kawashima S, Katayama T, Araki M, Hirakawa M: ... Functional annotation of the cancer stem cell signature by GSEA led us to four main pathways: JAK-STAT signaling; cell adhesion and extracellular matrix-interactions; focal adhesion signaling; and...

Ngày tải lên: 14/08/2014, 08:21

13 682 0
Báo cáo y học: "Immunomodulatory properties of mesenchymal stem cells: a review based on an interdisciplinary meeting held at the Kennedy Institute" potx

Báo cáo y học: "Immunomodulatory properties of mesenchymal stem cells: a review based on an interdisciplinary meeting held at the Kennedy Institute" potx

... On the other hand, MSCs may also actively participate in initiating AD [3], they have the potential to favour spread of melanoma metastases [4] and, although mostly immune privileged, they may ... KW, MacKenzie TC, Shaaban AF, Radu A, Moseley AM, Deans R, Marshak DR, Flake AW: Human mesenchymal stem cells engraft and demonstrate site-specific differentiation after in utero transplantation ... ensure that bioassays include animal based, cellular and biochemical systems A model of vasculogenesis in a SCID mouse was presented as an example Conclusion The potential antiproliferative and immunodulatory...

Ngày tải lên: 09/08/2014, 08:23

10 559 0
Báo cáo y học: "Hedgehog overexpression leads to the formation of prostate cancer stem cells with metastatic property irrespective of androgen receptor expression in the mouse model" pps

Báo cáo y học: "Hedgehog overexpression leads to the formation of prostate cancer stem cells with metastatic property irrespective of androgen receptor expression in the mouse model" pps

... the Care and Use of Laboratory Animal that had been promulgated by the Institute of Laboratory Animal Resources and had been approved by the animal care and use committee of Chung Shan Medical ... contrast to the normal slim and flat basal cells (indicated by arrows in the magnified areas of Figure 2A to 2E) These data strongly suggest that the prostate cancer cells are likely to be transformed ... formation by the transformed P63+ basal /stem cells in the metastatic loci The data evidently demonstrated both cancer cell and stem cell characteristics of the transformed P63+ basal /stem cells, ...

Ngày tải lên: 10/08/2014, 05:21

11 446 0
Báo cáo y học: "Preferential expression of potential markers for cancer stem cells in large cell neuroendocrine carcinoma of the lung. An FFPE proteomic study" pptx

Báo cáo y học: "Preferential expression of potential markers for cancer stem cells in large cell neuroendocrine carcinoma of the lung. An FFPE proteomic study" pptx

... (DAKO Japan, Kyoto, Japan) and monoclonal mouse anti SYN antibody (DAKO Japan, Kyoto, Japan) The staining of these antibodies was performed automatically on a Ventana Benchmark® XT (Ventana Japan, ... Immunoreactivitiy with AL 1A1 , AK1C1, AK1C3, and CD44 The immunoreactivity was indicated as the percentage of immunopositive area at the maximal cut-surface of tumors Nomura et al Journal of Clinical ... base of Japanese Ministry of Health, Labor and Welfare [http:// www.mhlw.go.jp/toukei/saikin/hw/jinkou/geppo/nengai09/kekka3.html] The data base of National Cancer Institute at the National Institute...

Ngày tải lên: 10/08/2014, 09:22

13 375 0
Tài liệu Cancer Pain Management: A perspective from the British Pain Society, supported by the Association for Palliative Medicine and the Royal College of General Practitioners docx

Tài liệu Cancer Pain Management: A perspective from the British Pain Society, supported by the Association for Palliative Medicine and the Royal College of General Practitioners docx

... physicians and other healthcare professionals who treat pain from cancer at any stage of the disease with the hope of raising awareness of the types of therapies that may be appropriate and increasing ... thought and interest through a multimodal approach to the management of cancer pain, and not just towards the end of life, but also pain at diagnosis, as a consequence of cancer therapies and in cancer ... working and the education of all healthcare professionals involved in the treatment of cancer pain • The principles of pain management and palliative care for adult practice are relevant to paediatrics,...

Ngày tải lên: 14/02/2014, 21:20

116 548 0
Tài liệu What Lung Cancer Patients Need to Know About Bone Health: A Publication of The Bone and Cancer Foundation pdf

Tài liệu What Lung Cancer Patients Need to Know About Bone Health: A Publication of The Bone and Cancer Foundation pdf

... throughout the body The cancer cells that have spread to other parts of the body are the same as those in the original tumor Radiation therapy: Treatment with radiation to kill cancer cells Steroids: A ... Nonsteroidal Anti-inflammatory Drugs: Drugs such as acetaminophen, aspirin, and ibuprofen used to treat pain and inflammation Metastasis (plural: metastases, verb: metastasize): The spread of cancer cells ... produce and release a hormone (PTHrP) into the bloodstream that can increase the rate at which bones release calcium Lung cancer that has spread to bone can also cause an increased release of calcium...

Ngày tải lên: 15/02/2014, 05:20

8 444 0
Nutrition and cancer: A review of the evidence for an anti-cancer diet pptx

Nutrition and cancer: A review of the evidence for an anti-cancer diet pptx

... to a standardized amount of carbohydrate in a food The glycemic load takes into account the amount of food eaten An international table of the glycemic index and glycemic load of a wide variety ... bacterial populations were seen between patients who recently had a colon polyp removed, Japanese-Hawaiians, North American Caucasians, native rural Japanese, and rural native Africans Lactobacillus ... vitamin E, and 69 percent less of the minerals (USDA Food database, data not shown) Concentrated sugars and refined flour products make up a large portion of the carbohydrate intake in the average...

Ngày tải lên: 06/03/2014, 02:21

21 740 0
Toxic chemicals and childhood cancer: A review of the evidence docx

Toxic chemicals and childhood cancer: A review of the evidence docx

... respiratory cancer, urinary tract cancer, prostate cancer, and NHL (Hooiveld, et al., 1998) A study of the adult population of Seveso, Italy revealed an elevated occurrence of gastrointestinal cancer ... exposures The Mt Sinai panel estimated that the annual cost of environmentally related childhood cancer due to hospitalization and treatment, treatment of secondary cancers, lost parental wages, and ... than the national average—16.7 new cases versus 16.1 per 100,000 per year African American and Latino children in Massachusetts had approximately 25% more diagnosed cancers than white and Asian and...

Ngày tải lên: 22/03/2014, 16:21

54 318 0
Báo cáo khoa học: Lack of stabilized microtubules as a result of the absence of major maps in CAD cells does not preclude neurite formation pot

Báo cáo khoa học: Lack of stabilized microtubules as a result of the absence of major maps in CAD cells does not preclude neurite formation pot

... GTTGGTCTCGTCGCTCATCACATCACGAGG GCTTGAAGGCGCTGGATCTGCGACAATAG GACTGGGCTTTCATCAGCGACAGGTGGC GTGAACCACCAAAATCGGAGAACGAAGC CAGGTTCTCAGTAGAGCCAATCTTCGACCTGAC AGAGTCGGATGCAGTTGCCCGGGCAACA GGCTCCTCCAGCACCCTCCGGGTCCCG ... GGCTCCTCCAGCACCCTCCGGGTCCCG CCCCAAACTTGTGACCATCATTC GGAGAAATCATCTTGAGCATAGCG CGAACTCTCAAGGGC ATGCATCAGAACCATGCACG AGCCCTACAATTCCATCCTCACC GCTGAAGGAGACGATGAGGGTGA 82898–82923 83581–83552 91489–91517 ... MAPs) and stabilize them are absent in CAD cells A possible explanation is that the expression of all these MAPs is under a common regulatory mechanism Alternatively, the expression of each MAP...

Ngày tải lên: 23/03/2014, 05:22

14 416 0
Báo cáo sinh học: "The iSBTc/SITC primer on tumor immunology and biological therapy of cancer: a summary of the 2010 program" doc

Báo cáo sinh học: "The iSBTc/SITC primer on tumor immunology and biological therapy of cancer: a summary of the 2010 program" doc

... inflammation and cancer: inflammation can cause cancer; inflammation can cause mutation; mutation can cause inflammation; mutation can cause cancer; and cancer can cause inflammation Inflammation may also ... inflammation is a classic hallmark of cancer, the outcomes following activation of innate immunity and inflammation in cancer can vary In some cases inflammation can promote cancer; in other cases, ... therapy of cancer: a summary of the 2010 program James M Balwit1, Patrick Hwu2, Walter J Urba3, Francesco M Marincola1,4* Abstract The Society for Immunotherapy of Cancer, SITC (formerly the International...

Ngày tải lên: 18/06/2014, 19:20

15 602 0
báo cáo hóa học: " Bayesian bias adjustments of the lung cancer SMR in a cohort of German carbon black production workers" pdf

báo cáo hóa học: " Bayesian bias adjustments of the lung cancer SMR in a cohort of German carbon black production workers" pdf

... distribution of bias parameters, our prior knowledge about the target parameters and the observed data into account In summary, Bayesian bias analysis offers an analysis that adjusts the SMR (= target parameter) ... bet about the parameters after the data was observed and analyzed Therefore, we are interested in P(parameters | data), that is the posterior distribution of the parameters The factor 1/P(data) ... epidemiology there is no such data generating mechanism at work Page of 14 Thus, the Bayesian approach offers an advantage because interval estimates can be interpreted in a “natural” way As an introduction...

Ngày tải lên: 20/06/2014, 00:20

14 310 0
báo cáo hóa học:" Role of CA125 in predicting ovarian cancer survival - a review of the epidemiological literature" pptx

báo cáo hóa học:" Role of CA125 in predicting ovarian cancer survival - a review of the epidemiological literature" pptx

... Caramona M: CA-125 AUC as a predictor for epithelial ovarian cancer relapse Cancer Biomark 2008, 4:73-81 Mano A, Falcao A, Godinho I, Santos J, Leitao F, Oliveira C, Caramona M: CA-125 AUC as ... under the Curve (AUC) and Ovarian Cancer Survival A study evaluated the usefulness of CA125 normalized in time area under the curve (CA125 AUC) to signalise epithelial ovarian cancer relapse Data ... patients with relapsed ovarian carcinoma In multivariate analysis only the variation of blood levels of CA125 and the free disease interval from the finalization of the first line chemotherapy were predictive...

Ngày tải lên: 20/06/2014, 07:20

20 508 0
báo cáo hóa học:"Transplantation of selected or transgenic blood stem cells – a future treatment for HIV/AIDS?" pot

báo cáo hóa học:"Transplantation of selected or transgenic blood stem cells – a future treatment for HIV/AIDS?" pot

... utilization of health-care resources Therapy with CCR5-negative stem cells In the early 1980s, alloHSCT appeared to be attractive as a therapy for HIV in patients with advanced disease because it was ... homozygous carriers is in the range of 1% to 3% among caucasians Future approaches to HIV therapy by CCR5-negative alloHSCT may thus be limited by the availability of HLA-matched donors in general and ... CCR5delta32 status appears to have several beneficial effects on the alloHSCT setting: previous analyses revealed that the CCR5-delta32 allele appears to protect against acute graft versus host disease...

Ngày tải lên: 20/06/2014, 08:20

5 206 0
Báo cáo khoa học: " The impact of radiotherapy in the treatment of desmoid tumours. An international survey of 110 patients. A study of the Rare Cancer Network" pptx

Báo cáo khoa học: " The impact of radiotherapy in the treatment of desmoid tumours. An international survey of 110 patients. A study of the Rare Cancer Network" pptx

... a recurrence in the univariate analysis This analysis revealed radiotherapy at recurrence as a significantly worse prognostic factor compared with adjuvant radiotherapy The addition of radiotherapy ... following factors: additional irradiation, a fraction size of ≥ Gy with a hazard rate of 60%, a total dose > 50 Gy with a hazard rate of 59% (p = 0.028, Table 4) In multivariate analysis radiotherapy ... radiotherapy at recurrence The addition of radiotherapy at an earlier time point of the disease may be advisable We looked at the fraction size under the hypothesis that as desmoid tumours are...

Ngày tải lên: 09/08/2014, 10:21

11 350 0
Báo cáo y học: "Two specific drugs, BMS-345541 and purvalanol A induce apoptosis of HTLV-1 infected cells through inhibition of the NF-kappaB and cell cycle pathways" ppsx

Báo cáo y học: "Two specific drugs, BMS-345541 and purvalanol A induce apoptosis of HTLV-1 infected cells through inhibition of the NF-kappaB and cell cycle pathways" ppsx

... leukemia Carcinogenesis 2005, 26:1382-1388 Watanabe M, Ohsugi T, Shoda M, Ishida T, Aizawa S, Maruyama-Nagai M, Utsunomiya A, Koga S, Yamada Y, Kamihira S, Okayama A, Kikuchi H, Uozumi K, Yamaguchi ... (RelA) and RelB [19] There are multiple pathways to activate NF-κB The two most common pathways are the canonical and the non-canonical pathways [20,21] In the canonical pathway, proceeding the ... been established as a cellular target of Tax and an essential component in Tax-mediated NF-κB signaling in both canonical and non-canonical pathways Therefore, we reasoned that the specific targeting...

Ngày tải lên: 10/08/2014, 05:21

16 391 0
Báo cáo y học: "Sphingosine-1-phosphate promotes the differentiation of human umbilical cord mesenchymal stem cells into cardiomyocytes under the designated culturing conditions" pdf

Báo cáo y học: "Sphingosine-1-phosphate promotes the differentiation of human umbilical cord mesenchymal stem cells into cardiomyocytes under the designated culturing conditions" pdf

... thermo-responsive detachment of cell sheets MC and TW carried out the collection and assembly of data, data analysis HZ participated in the design of the study JRL participated in the design of the study and ... neurons, and endothelial cells[ 1-3] Given these characteristics, particularly the plasticity and developmental flexibility, UC stromal cells are now considered an alternative source of stem cells and ... anti-myosin cardiac heavy chain a/ b at a dilution of 1:4 (Millipore, Billerica, MA, USA) in PBS-1% BSA overnight at 4°C Excess primary antibody was removed by a triple wash in PBS, and the cells were then...

Ngày tải lên: 10/08/2014, 05:21

9 262 0
báo cáo khoa học: " MicroRNAs involved in neoplastic transformation of liver cancer stem cells" pot

báo cáo khoa học: " MicroRNAs involved in neoplastic transformation of liver cancer stem cells" pot

... GTGCAGGGTCCGAGGT F:GGTGGAATCACTAACCACACG R: GTGCAGGGTCCGAGGT F: TAGTACTGCGCAAGCTACTGC R: GTGCAGGGTCCGAGGT miR-10b GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCACAAA miR-470* GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTCTTCT ... GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTCTTCT miR-34c-3p GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCCTGGC let-7i* GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAGCAAG miR-20 0a* GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTCCAGC ... GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTCCAGC F: GAGTGCATCTTACCGGACAGT R: GTGCAGGGTCCGAGGT miR-148b* GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACGCCTGA F: GGCGCAAGTTCTGTTATACAC R: GTGCAGGGTCCGAGGT U6 CGCTTCACGAATTTGCGTGTCAT...

Ngày tải lên: 10/08/2014, 10:20

10 327 0
Xem thêm

Bạn có muốn tìm thêm với từ khóa:

w