botany taxonomy and cytology of c sativus l and its allies
Hexane extract of raphanus sativus l roots inhibits
Ngày tải lên :
18/10/2016, 08:08
... epithelial carcinoma cell line), MCF-7 (human mammary epithelial carcinoma cell line) and PC-3 (human prostate epithelial carcinoma cell line) were obtained from American Type Culture Collection (ATCC) ... cancer and normal cells could be due to a fact that it could be targeting a particular molecular event exclusively present in cancer cells, but absent in normal cells Morphological Changes Following ... inhibitory effect on all human cancer cells examined In line with these findings, IC50 values clearly indicated anti-proliferative efficacy of R sativus root extract (Table 2) All cancer cell lines exhibited...
- 11
- 420
- 0
Customer Service - Principles of Service Marketing and Management - C Lovelock & L Wright
Ngày tải lên :
07/02/2013, 09:52
... is itself a c o m p l e x service organization In addition to educational services, today's college facilities usually include libraries and cafeterias, counseling, a bookstore, placement offices, ... resources industries So-called internal s e r v i c e s cover a w i d e array of activities including recruitment, publications, legal and accounting services, payroll administration, office cleaning, ... upholstery, customers focus on price, location and appearance of pickup and delivery facilities, extent of insurance coverage, cleanliness and maintenance of vehicles, provision of free shuttle buses...
- 387
- 1.2K
- 6
Báo cáo khoa học: Characterization of c-tocopherol methyltransferases from Capsicum annuum L and Arabidopsis thaliana pptx
Ngày tải lên :
17/03/2014, 09:20
... enrichment of tocopherols Materials and methods Plant material Mature Capsicum annuum L fruits of the red variety were obtained from a local market Chemicals The ( ) c- and ( ) d-tocopherols were ... (BioSep–Sec-S3000) and Pharmacia (all others) All other chemicals were of analytical grade and obtained from various suppliers Preparation and purification of c- TMT from pepper fruits Chromoplast membranes ... detection (Jasco FP-920 detector; kex: 295 nm and kem: 332 nm) Elution of tocopherols was isocratically with 100% methanol at a flow rate of mLÆmin)1 Photolabelling of Capsicum c- TMT Enzyme kinetics The...
- 9
- 581
- 0
Function of Soils for Hum a n Societies and the Environment .The G e o l o g i c a l Society of L ppt
Ngày tải lên :
06/07/2014, 08:20
... substantial discounts on publications of GSL and other societies worldwide, consult www.geolsoc.org.uk, or contact the Fellowship Department at: The Geological Society, Burlington House, Piccadilly, London ... lithogenic and anthropogenic contents by pedogenetic processes, and implications for ecological risk assessment 63 BA~UELOS, G S & LIN, Z.-O Reuse of agricultural drainage water in central California: ... BURGHARDT,W Soil sealing and soil properties related to sealing 117 WELLS, E C Cultural soilscapes 125 LANDA, E R From agricultural geology to hydropedotogy: forging links within the twenty-first-century...
- 5
- 287
- 0
Summary of Phd. dissertation in forestry Research on scientific bases and propose some conservation measures for Pseudotsuga brevifolia W. C Cheng & L. K. Fu, 1975 in Ha Giang province
Ngày tải lên :
01/11/2016, 22:32
... cool and cold Due to climatic characteristics, it is a good condition of growing trees, especially the species are predominant in Pinaceae family, hence this is the vital ecological factor which ... height of 0.7-1m The fresh floor layer are mainly Miccostegium ciliatum, Imperata cylindrica, Centosteca latifolia, Selaginella sp, Lemmaphyllum microphyllum, Drynaria bonii, Thysanolaena maxima, Cymbidium ... brevifolia Observation Schedule (day) Experimental No of Formulas cutting CT1A CT1B CT 1C CT1D CT2A CT2B CT 2C CT2D CT3A CT3B CT 3C CT3D CT4 Total/AVG 90 120 150 180 Survival Rate Survival Rate...
- 27
- 367
- 0
Tài liệu Báo cáo khoa học: Interaction between very-KIND Ras guanine exchange factor and microtubule-associated protein 2, and its role in dendrite growth – structure and function of the second kinase noncatalytic C-lobe domain docx
Ngày tải lên :
14/02/2014, 19:20
... Materials and methods Animals Primary cultures, transfection and imaging of hippocampal and cerebellar neurons Hippocampal and cerebellar dissociated primary cultures were prepared from ICR mice ... suppresses and v-KIND knockdown promotes dendrite growth of cultured cerebellar granule cells and hippocampal neurons, suggesting that v-KIND acts as a signaling molecule in controlling or limiting ... pEGFP -C1 (Clontech Laboratories, Inc., Mountain View, CA, USA) and pGEX-4T-2 (GE Healthcare UK Ltd, Little Chalfont, UK) vectors for EGFP and GST fusion constructs, respectively HMW MAP2 cDNA and its...
- 11
- 658
- 0
Báo cáo khoa học: Increased expression of c-Fos by extracellular signal-regulated kinase activation under sustained oxidative stress elicits BimEL upregulation and hepatocyte apoptosis pot
Ngày tải lên :
06/03/2014, 00:21
... 5¢-CTCCCTGGTCTCTCATCTGTCCTTCCCA CC-3¢; Myb3 Se, 5¢-CCTCCTGAGGCTTCCATCTGGCG GCCGCGG-3¢) Mutations were confirmed by nucleotide sequencing Transfection and luciferase activity assays Cells were cotransfected ... et al Clara, CA, USA) (primers: AP-1 Se, 5¢-CCGTCAGCGGT GACTTGGATTCACAGAGAC-3¢; FOXO Se, 5¢-CAAGT CACTAGGGTACCCACGCCGGGGTGG-3¢; Myb1 Se, 5¢-GACCAAGATGGTCCATCGGTGGGACGACAG-3¢; Myb2 Se, 5¢-CTCCCTGGTCTCTCATCTGTCCTTCCCA ... the accumulation of total and phosphorylated c- Fos in the presence of ATZ + mercaptosuccinic acid (Fig 2) In contrast, there were no changes in the levels of total and phosphorylated nuclear c- Jun...
- 9
- 556
- 0
Báo cáo khoa học: Crystal structure of salt-tolerant glutaminase from Micrococcus luteus K-3 in the presence and absence of its product L-glutamate and its activator Tris pdf
Ngày tải lên :
06/03/2014, 09:22
... nonliganded structure of Bacillus glutaminase the displacement of all the backbone atoms of Mglu and Bacillus glutaminase induced by ligand binding Mglu shows no significant conformational change ... that the catalytic mechanism of Mglu is similar to the proposed catalytic mechanism of Bacillus glutaminase [5] The structure of Bacillus glutaminase that covalently binds 5-oxo -l- norleucine (PDB ... displacement of the overall amino acid residues in Mglu is also small compared with those of Bacillus glutaminase Figure shows a comparison of Table Displacement of the backbone atoms of Mglu and Bacillus...
- 11
- 521
- 0
Báo cáo khoa học: Characterization of a cathepsin L-associated protein in Artemia and its relationship to the FAS-I family of cell adhesion proteins pot
Ngày tải lên :
07/03/2014, 16:20
... CLAP_1:GTCATAAGGAAACTCCCTCCTGATGTGATTAAACACCTTGTTGATGACCCAGCTCTCCTAAAAGAAGTTTTAACCTACCATGTCTTGTCTGGAACCTTCT CLAP_2:GTCATAAGGAAACTCCCTCCTGATGTGATTAAACACCTTGTTGATGACCCAGCTCTCCTAAAAGAAGTTTTAACCTACCATGTCTTGTCTGGAACCTTCT V I R K L P P D V I K H L V D D P A L L K E V L T Y ... CLAP_1:TTGAATGCTGTCACCACTGAGCCAGAAGCTAAGCTAGAACATGCTGCTATCCCTATCAAAGATGGTGAGGCAAAAAACCTTGTGGATCTTGCAGAGTCTC CLAP_2:TTGAATGCTGTCACCACTGAGCCAGAAGCTAAGCTAGAACATGCTGCTATCCCTATCAAAGATGGTGAGGCAAAAAACCTTGTGGATCTTGCAGAGTCTC L N A V T T E P E A K L ... L R R C 600 532 188 CLAP_1:TCCAGTTTTTTCTGATCTTGTGGAGCTCATTGATAGAGCAGGTCTTGATGAAGCTCTTCAAACCCATGGACCTATTACTTTCTTTGCCCCAAGCAATGAT CLAP_2:TCCAGTTTTTTCTGATCTTGTGGAGCTCATTGATAAAGCAGGTCTTGATGAAGCTCTTCAAACCCATGGACCTATTACTTTCTTTGCCCCAAGCAATGAT...
- 12
- 772
- 0
C++?? A Critique of C++ and Programming and Language pot
Ngày tải lên :
08/03/2014, 23:20
... languages, local variables are automatically allocated on the stack, and automatically deallocated when the block exits This relieves the programmer of the burden of allocating and deallocating memory ... another class must be recompiled if the layout of that class changes Tools can automatically extract abstract class descriptions from class implementations, and guarantee consistency Splitting C and ... arguably the best commercial OO language in terms of its technical capabilities.” [RBPEL91], p327 The object model of Eiffel is certainly closer to OMT than C+ + In conclusion, if CASE tools and...
- 63
- 511
- 0
Báo cáo khoa học: Structural flexibility of the methanogenic-type seryl-tRNA synthetase active site and its implication for specific substrate recognition pptx
Ngày tải lên :
16/03/2014, 06:20
... 5¢-CCTGTGGAACTCGTCGACCGCTTCGATTCCG 5¢-GAAAAGCAAGAGTTACCCCCGCGTTTATGGCACAGGAAG 5¢-CTTCCTGTGCCATAAACGCGGGGGTAACTCTTGCTTTTC 5¢-GCTTGAGTTCCAGGCTGTGAGCATCAATGGAGATAAGTATC 5¢-GATACTTATCTCCATTGATGCTCACAGCCTGGAACTCAAGC ... 5¢-CCCACAGGTATGCGAGTGGTGGAATTCACGG 5¢-CCGTGAATTCCACCACTCGCATACCTGTGGG 5¢-CCACAGGTATGAGAGTGTTGCAATTCACGGAATCGAAAGG 5¢-CCTTTCGATTCCGTGAATTGCAACACTCTCATACCTGTGG 5¢-CGGAATCGAAGCGGTCGACGAGTTCCACAGG 5¢-CCTGTGGAACTCGTCGACCGCTTCGATTCCG ... 5¢-GATACTTATCTCCATTGATGCTCACAGCCTGGAACTCAAGC 5¢-GGCTTGAGTTCCAGAATGTGGCCATCAATGGAGATAAG 5¢-CTTATCTCCATTGATGGCCACATTCTGGAACTCAAGCC 5¢-AATGGCTTGAGTTCCAGGCTGTGGCCATCAATGGAGATAAGTATC 5¢-ATACTTATCTCCATTGATGGCCACAGCCTGGAACTCAAGCCATTC Combination...
- 14
- 357
- 0
Báo cáo khoa học: Production and characterization of a thermostable L-threonine dehydrogenase from the hyperthermophilic archaeon Pyrococcus furiosus docx
Ngày tải lên :
16/03/2014, 14:20
... l- glutamine, l- alanine, l- arginine, l- cysteine, l- proline, l- phenylalanine, l- lysine, l- tryptophan, l- isoleucine, l- tyrosine, l- histidine, l- leucine, l- valine, l- methionine, l- glutamate and glycine could ... C After removal of EDTA, full enzyme activity could be recovered by the addition of mm ZnCl2 or CoCl2 Activity could be partially restored by the addition of MgCl2 (69%) and NiCl2 (27%) Metal ... BG1279 (5¢-GCGCG CCATGGCATCCGAGAAGATGGTTGCTATCA, sense) and BG1297 (5¢-GCGCGGGATCCTCATTTAAGCAT GAAAACAACTTTGCC, antisense), containing NcoI and BamHI sites (underlined in the sequences) In order...
- 8
- 415
- 0
Báo cáo khoa học: Injection of poly(b-L-malate) into the plasmodium of Physarum polycephalum shortens the cell cycle and increases the growth rate pot
Ngày tải lên :
16/03/2014, 18:20
... nuclei We found that increased cytoplasmic and nuclear levels of PMLA induced a strain speci c enhancement of cell growth and an equal (between strains) shortening of the cell cycle Materials and ... fairly well predicted by calculation, taking into account the time elapsed after the fusion and the known length of the cell cycle The injection solution of 1–4 lL contained 15–200 mgÆmL)1 PMLA, ... levels of PMLA in cytoplasm and nuclei, we injected 400 lg of the polymer into M3CVII and LU887 plasmodia (weights of 150 mg) and measured the PMLA contents of nuclear and cytoplasmic extracts...
- 7
- 325
- 0
Báo cáo khoa học: Endogenous mono-ADP-ribosylation mediates smooth muscle cell proliferation and migration via protein kinase N-dependent induction of c-fos expression potx
Ngày tải lên :
17/03/2014, 09:20
... transduction, the functional significance of these modifications in normal cell physiology, including cell proliferation and differentiation, remains poorly understood Vascular smooth muscle cells ... lCi), 0.1 mM phenylmethanesulfonyl fluoride), 10 lL polyarginine (2 mgÆmL)1) and 20 lL cell extract (microsomal or cytosolic fraction) and incubating this mixture for 30 at 30 C [27] The reaction ... from Cell Signaling Technology Smooth muscle cell culture Primary cultures of porcine coronary artery SMC were generated from the left anterior descending coronary artery by an explant organ culture...
- 10
- 389
- 0
Role of C-Reactive Protein and Procalcitonin in Differentiation of Tuberculosis from Bacterial Community Acquired Pneumonia potx
Ngày tải lên :
22/03/2014, 18:20
... secretions and 13 patients Kang YA, et al C- reactive protein and procalcitonin for the diagnosis of tuberculosis 339 Table Clinical and laboratory characteristics of the participants Bacterial pneumonia ... produce lower PCT levels than classical bacterial pneumonia such as pneumococcal pneumonia [11,28] Second, because the hospital in which this study was conducted is a secondary referral hospital, ... bacterial CAP and the small number of study subjects should be considered when generalizing the results using CRP and PCT to determine pulmonary TB and bacterial CAP In conclusion, serum CRP and...
- 6
- 515
- 2
Chemistry of C-C π-bonds Lectures 1-4: Alkenes, Alkynes and Conjugation doc
Ngày tải lên :
22/03/2014, 20:20
... Interactions between molecules: HOMO and LUMO – a recap HOMO = highest occupied molecular orbital LUMO = lowest unoccupied molecular orbital vacant orbital on molecule filled orbital of molecule ... Acid catalysed conjugate addition Overall 1,4 addition O O HCl Cl O H O Cl H O H Cl H Cl- Thermodynamically controlled reaction Cl OH Final product is the most stable Charged nucleophiles usually ... Nucleophilic reactions Electrophilic reactions Pericyclic reactions Recap of methods for alkene generation Recap of frontier molecular orbitals for simple reactions Reactions of alkenes: (i) electrophilic...
- 39
- 374
- 0
Báo cáo khoa học: Characterization of testis-specific serine–threonine kinase 3 and its activation by phosphoinositide-dependent kinase-1-dependent signalling doc
Ngày tải lên :
23/03/2014, 11:20
... interstitial compartment with Leydig cells and seminiferous tubules containing Sertoli cells, spermatogenic cells and peritubular myoid cells Despite this apparently simple structure, the development of ... full-length TSSK3 coding sequence was PCR amplified from a human or mouse testis cDNA, respectively, using oligonucleotide primers GGTGGTCATATGGAGG ACTTTCTRCTCT ⁄ CACTTGCCATTGCTTTTATCA and ligated ... Additionally, oligonucleotides contained KpnI restriction site to select for correct clones The pGEX)6P-1 constructs encoding GST-peptides were transformed into BL21 E coli cells and 0.5 L culture...
- 14
- 374
- 0
Báo cáo khoa học: The )148 to )124 region of c-jun interacts with a positive regulatory factor in rat liver and enhances transcription Dipali Sharma*, Sujata Ohri and Aparna Dixit ppt
Ngày tải lên :
23/03/2014, 20:22
... Buja, L. M & McMillin, J.B (1998) Activation of the cytochrome c gene by electrical stimulation in neonatal rat cardiac myocytes Role of NRF-1 and c- jun J Biol Chem 273, 12593–12598 Steinmuller, L. , ... TFIIB could bind to its speci c sequence only at low salt concentration, following which it can withstand increases in NaCl concentration However, TFIIB cannot bind at high salt concentration RLjunRP, ... 100-fold excess of unlabelled nonspeci c DNA [fragmented calf thymus DNA (lane 7), pBR322 (lane 8)], and in the presence of various concentrations of unlabeled Jun)25 oligonucleotide encompassing...
- 9
- 449
- 0
Regeneration and Transformation via Agrobacterium tumefaciens of Echinacea purpurea L. ppt
Ngày tải lên :
23/03/2014, 22:20
... Gómez‐Galéra S, Pelacho AM and Gene A (2007) The genetic manipulation of medicinal and aromatic plants. Plant Cell Reports 26: 1689‐1715. Grimm W and Muller H (1999) A randomized controlled trial of the effect of fluid extract of Echinacea ... picA‐1,5ʹ‐ ATGCGCATGAGGCTCGTCTTCGAG‐3ʹ and picA‐2, 5ʹ‐ GACGCAACGCATCCTCGATCAGCT‐3ʹ (Rong et al 1991), with a prediction product size of 550 bp. Denaturation at 94 C for 4 min followed by 30 amplification cycles (94 C/ 60s, ... Koroch A, Kapetyn J, Juliana HR and Simon JE (2003) In vitro regeneration of Echinacea pallida from leaf explants. In Vitro Cell. Dev Biol. Plant. 39: 415‐418. Lakshmanan P, Danesh M and Taji A (2002) Production of four commercially cultivated Echinacea species ...
- 11
- 168
- 0
Báo cáo khoa học: Characterization and expression analysis of the aspartic protease gene family of Cynara cardunculus L. docx
Ngày tải lên :
30/03/2014, 09:20
... AGAACAGAACTTCCGGTATCG Int10aF R#2 5¢PextA misAF1 GTGTGACACCGGTAATAAGCAG TCAAGCTGCTTCTGCAAATCC CACACCCTCCTTCATTGCTTCCATCAAATAACAC ATGGGACATTTGGCGCTATCCAa misR1117 GGTGCACATCTCATCATGTCTGa misCF1 CCCCTGGTTGTCAAGCATATCTAa ... AGAAAGCTGGGTCGATGTTTCATCACGTGTTATTTGATGGAAGCAATGb ,c, d AAAAAGCAGGCTTTAATAAGTTGTGCTTACACACAGTTb AGAAAGCTGGGTCGATGTTTCACTGCAACCATGACb ,c AAAAAGCAGGCTAACCACTATGATACCACTCACACCAb AGAAAGCTGGGTCGATGTTTCACTGCAACCATGACb ,c ... CCCCTGGTTGTCAAGCATATCTAa misCR1 AGACTTGTCGTTATTCTTGTGCa misDF1 GGGTGCCTTCTTCAAAGTGGTAa misDR1 TGTATGCCACCAGAAGACTTCAa CardBS GATCTCGGCTGGGAAAGCG CardBR ATACCATTGCAGTCTACTATC FLCBR ActF TTTATTGGACCATTTTATTCCGG...
- 17
- 359
- 0