Hexane extract of raphanus sativus l roots inhibits

Plant Foods Hum Nutr (2010) 65:200–209 DOI 10.1007/s11130-010-0178-0 ORIGINAL PAPER Hexane Extract of Raphanus sativus L Roots Inhibits Cell Proliferation and Induces Apoptosis in Human Cancer Cells by Modulating Genes Related to Apoptotic Pathway Syed Sultan Beevi & Lakshmi Narasu Mangamoori & Murugan Subathra & Jyotheeswara Reddy Edula Published online: 23 July 2010 # Springer Science+Business Media, LLC 2010 Abstract Raphanus sativus, a common cruciferous vegetable has been attributed to possess a number of pharmacolog- ical and therapeutic properties It has been used in indigenous system of medicine for the treatment of various human ailments in India This present study evaluated the chemo- preventive efficacy of different parts of R sativus such as root, stem and leaves, extracted with solvents of varying polarity and investigated the molecular mechanism leading to growth arrest and apoptotic cell death in human cancer cell lines Of the different parts, significant growth inhibitory effect was observed with hexane extract of R sativus root Analysis of hexane extract by GC-MS revealed the presence of several isothiocyanates (ITCs) such as 4-(methylthio)-3butenyl isothiocyanate (MTBITC), 4-(methylthio)-3-butyl isothiocyanate (erucin), 4-methylpentyl isothiocyanate, 4pentenyl isothiocyanate and sulforaphene R sativus root extract induced cell death both in p53 proficient and p53 deficient cell lines through induction of apoptotic signaling pathway regardless of the p53 status of cells The molecular mechanisms underlying R sativus-induced apoptosis may involve interactions among Bcl2 family genes, as evidenced by up-regulation of pro-apoptotic genes and down-regulation of anti-apoptotic genes along with activation of Caspase-3 Our findings present the first evidence that hexane extract of R sativus root exerts potential chemopreventive efficacy and induces apoptosis in cancer cell lines through modulation of genes involved in apoptotic signaling pathway Keywords Raphanus sativus Crucifers.4-(Methythio)-3butenyl isothiocyanate.Erucin.Cancer cells.Apoptosis S S Beevi : L N Mangamoori (*) : M Subathra : J R Edula Centre for Biotechnology, Institute of Science and Technology, Jawaharlal Nehru Technological University, Kukatpally, Hyderabad 500 085 Andhra Pradesh, India e-mail: mangamoori@jntuh.ac.in e-mail: mangamoori@rediffmail.com apoptosis through a variety of ways Hence, induction of apoptosis provides an important valuable strategy for the management of cancer [4] Further, this could be applied as a useful marker for screening active compounds for consequent development as potential chemopreventive agents Introduction Chemoprevention is an active cancer preventive strategy to inhibit, delay or reverse human carcinogenesis, using naturally occurring or synthetic chemical agents [1] The multi-factorial nature of the carcinogenic process provides numerous pathways that could be manipulated by these agents in order to inhibit or delay tumor development [2] It is estimated that more than two-thirds of human cancers could be averted by lifestyle modifications including dietary changes Epidemiological studies have shown that consumption of fruits and vegetables have been inversely associated with morbidity and mortality of several cancers [3] Despite substantial amount of research, an understanding of the identity of food components that prevent cancer is not comprehensive The best way to ascertain chemopreventive potential of dietary substances is to understand their additive or synergistic interactions as diets contain several components that may act on the same or different steps of carcinogenesis Apoptosis is a well-defined biological process responsible for the maintenance of homeostasis of cell growth and proliferation In cancer cells, this homeostasis is disturbed, which leads to an uncontrolled proliferation and reduced apoptosis Cancer cells have an acquired ability to elude Plant Foods Hum Nutr (2010) 65:200–209 201 Among vegetables with anti-neoplastic properties, members of cruciferae family appear to be the most potent in reducing risk of several cancers [5] In this family, Raphanus sativus, Linn, is a widely cultivated crop in India It has been used in indigenous system of medicine for the treatment of various human ailments [6, 7] R sativus has received much attention in recent years because of its nutritional and health- protective value Recently, Papi et al [8] and Barillari et al [9] reported a dose-dependent chemopreventive effect of Japanese R sativus sprouts against human colon cancer cells The ability of R sativus sprouts to protect against neoplastic disease has been credited especially to 4(methylthio)-3-butenyl isothiocyanate (MTBITC) Despite these reports, the exact mechanism by which R sativus acts as a chemopreventive agent in other cancers is not yet defined Besides, these studies were limited to R sativus sprouts and scarcely any research has done on chemopreventive effect of R sativus root, stem and leaves Hence, a well documented and comprehensive study on chemopreventive activity of R sativus L., root and aerial part (stem and leaves), would substantiate their value in human nutrition as well as food and pharmaceutical supplements In this study, phytochemicals from root and aerial part of R sativus were extracted with solvents of varying polarity Chemopreventive efficacy of R sativus was determined by its ability to inhibit the growth of cancer cells Compositional analysis of hexane extract of R sativus root, which showed exceptional growth inhibitory activity, was performed by gas chromatography-mass spectrometry (GC-MS) to evaluate constituents that may contribute to its bioactivity Molecular mechanism leading to growth arrest and apoptotic cell death was studied by determining the expression of genes involved in apoptotic pathway The dried samples were ground to powder and stored air tight at −20 °C The powdered plant material was extracted three times with solvents of varying polarity such as methanol, acetone, ethyl acetate, chloroform and hexane at room temperature for 24 h with a mass to volume ratio of 1:40 (g/ml) and was evaporated to dryness under vacuum on a rotary evaporator (Heidolph-Rotacool, Germany) at 40 °C and reconstituted in DMSO Aqueous extract of R sativus was prepared as above by soaking dried powder in distilled water and stirred using a stirrer at low speed for 24 h The extract was filtered using Whatman No paper and was subsequently lyophilized in a lyophilizer at μm Hg pressure at −50 °C (ScanVac-Coolsafe™, Denmark) All extracts were stored at −80 °C until use Extracts were diluted appropriately with culture media prior to treatment of cell lines The final concentration of DMSO used in the culture medium was less than 0.2% Materials and Methods Cell Viability Assay Chemicals and Reagents The viability of cells was assessed by MTT (3, 4, 5dimethylthiazol-2-yl-2-5-diphenyltetrazolium bromide) assay, which is based on the reduction of MTT by mitochondrial dehydrogenase of intact cells to a purple formazan product [10] The data are presented as percent post treatment recovery (% live cells), whereas the absorbance from non-treated control cells was defined as 100% live cells The % recovery (% live cells) was plotted (Y-axis) against concentration (X-axis) of R sativus extract, where IC 50 values could be interpolated from the graph Anticancer drug—etoposide was used as positive reference to determine sensitivity of cancer cell lines Cells grown in media containing equivalent concentration of DMSO served as negative control Dulbecco’s modified eagle medium (DMEM), RPMI-1640, Trypsin-Versene, L-glutamine, streptomycin and penicillin were obtained from Sigma-Aldrich, USA Fetal bovine serum (FBS) was procured from PAA Biotech, Germany All other fine chemicals/reagents used in this study were of cell culture grade and obtained from Sigma-Aldrich and/or Merck Plant Materials and Preparation of Extracts Raphanus sativus L was purchased fresh from local cultivator in Hyderabad, India, and processed on the same day itself It was separated into root, stem, and leaves, washed thoroughly with distilled water and freeze dried Cell Lines and Culture Conditions HeLa (human cervical epithelial carcinoma cell line), A549 (human alveolar basal epithelial carcinoma cell line), MCF-7 (human mammary epithelial carcinoma cell line) and PC-3 (human prostate epithelial carcinoma cell line) were obtained from American Type Culture Collection (ATCC) (Rockville, MD, USA) All the cell lines except MCF-7 were grown in DMEM culture medium supplemented with mM Lglutamine, 10% FBS, penicillin (50 IU/ml) and streptomycin (50 μg/ml) at a temperature of 37 °C in a humidified incubator with a 5% CO2 atmosphere and passaged twice weekly to maintain a sub-confluent state MCF-7 was grown in RPMI 1640 culture medium supplemented with mM L- glutamine, 10% FBS, penicillin (50 IU/ml) and streptomycin (50 μg/ml) at a temperature of 37 °C in a humidified incubator with a 5% CO2 atmosphere and passaged thrice weekly to maintain a sub-confluent state 202 Plant Foods Hum Nutr (2010) 65:200–209 Microscopic Study Phase contrast microscopy was used to observe morphological changes in cells treated with R sativus root extract Briefly, cells were cultured in 6-wells plate and treated with different concentrations (0–25 μg/ml) of hexane extract of R sativus root for 24 h at 37 °C After the incubation period, photomicrographs were taken under phase contrast microscope Fluorescence Imaging Propidium iodide (PI) staining method was used to observe apoptotic morphological changes in treated cells Briefly, cells were cultured in 6-wells plate and treated with hexane extract of R sativus root (0–25 μg/ml) and incubated for 24 h at 37 °C After the incubation period, cells were washed with PBS, fixed in absolute alcohol for 30 at °C, rehydrated with PBS and incubated with 100 μl of PI (25 μM) at 37 °C for Photomicrographs were taken under fluorescent microscope RT-PCR Analysis for Expression of Genes Related to Apoptotic Pathway Expression of genes related to apoptotic pathway such as p53, Bax, Bcl 2, Bcl-XL and Caspase-3 was studied using reverse transcriptase-PCR (RT-PCR) Total RNA was extracted from cancer cells (5×10 ) treated with hexane extract of R sativus root (0–25 μg/ml) for 12 h at 37 °C using Trizol reagent according to manufacturer’s specifications cDNAwas generated by reverse transcription of μg of total denatured RNA using RevertAid™ first strand cDNA synthesis kit according to manufacturer’s instructions Reverse transcription was carried out at 42 °C for 60 in a total volume of 20 μl PCR was performed with 1.0 μl of cDNA in a total volume of 25 μl using geneTable Primer sequences used for the amplification of gene related to apoptotic pathway and internal control β-actin gene Gene Product size (bp) TGCAAGCT – 3′ Bcl-XL Gas Chromatography—Mass Spectrometry Analysis of Hexane Extract of R sativus Root The bioactive compounds in hexane extract of R sativus were analyzed by GC–MS using an Agilent 6890 N gas chromatograph coupled to an Agilent 5975 N mass spectrometer An HP-5MS capillary column (30 m× 0.25 mm I.D, 0.25 μm film thickness) was used for gas chromatographic separation The GC oven temperature was programmed from 60 °C to 280 °C at a rate of 10 °C/min and held at 280 °C for The injection volume was μl with a split ratio of 1:5; injector temperature was held constant at 220 °C Helium was used as carrier gas at a flow rate of 1.1 ml/min The mass spectrometer was operated in electron impact (EI) mode with ionization energy of 70 eV and source temperature was held at 280 °C MS spectra were obtained in the mass range of m/z 43–350 Identification of components was based on comparison with mass spectra of Wiley mass spectral database and available literature data 310 5′ – GTGGAAGAGAACAGGACTGAGG – 3′ 5′ – CCCGGAAGAGTTCATTCACTAC– 3′ Bax 246 5′ – TTTGCTTCAGGGTTTCATCC – 3′ 5′ – CAGTTGAAGTTGCCGTCAGA – 3′ Primer sequence Bcl2 367 5′ – AGATGTCCAGCCAGCTGCACCTGAC – 3′ ′– AGATAGGCACCCAGGGTGA specific upstream and downstream primers (Table 1) Initial denaturation at 94 °C for was followed by a PCR cycle of denaturation at 94 °C for 45 s, annealing at 55 °C for Bcl-XL, Bax and Caspase-3, 64 °C for Bcl2, 60 °C for p53 and 52 °C for β-actin, respectively, for 45 s, and strand extension at 72 °C for β-actin was amplified separately as a control to avoid any competitive PCR Numbers of cycles were 30 for p53, Bcl2, Bcl-XL, Bax and Caspase-3 and 26 for β-actin RT-PCR products were separated by electrophoresis on ethidium bromide stained 1.8% agarose gel and visualized in Bio-Rad gel documentation system The relative expression of studied genes was then determined using Image Pro Plus (Media Cybernetics, Inc., Silver Spring, MD) software and normalized with the bands of constitutively expressed β-actin The results were expressed in relation to the control values p53 368 5′ – TGGCCCCTCCTCAGCATCTTAT – 3′ 5′ – GTTGGGCAGTGCTCGCTTAGTG – 3′ Caspase-3 419 5′ – CGGTCTGGTACAGATGTCGAT – 3′ 5′ – TAACCAGGTGCTGTGGAGTATG – 3′ β-actin 253 5′ – CTGTCTGGCGGCACCACCAT – 3′ 5′ – GCAACTAAGTCATAGTCCGC – 3′ Plant Foods Hum Nutr (2010) 65:200–209 203 Statistical Analysis Results calculated from triplicate data were expressed as means ± standard deviations The data were compared by least significant difference test using Statistical Analysis System (SAS, ver.9.1) Graphing, curve fitting and IC50 were performed using GraphPad Prism (ver.5.0a) Results and Discussion Effects of R sativus Extracts on Growth of HeLa Cells HeLa cells were used as a model system to examine chemopreventive effect of different parts of R sativus Cells were treated with aqueous, methanol, acetone, ethyl acetate, chloroform and hexane extract at a concentration of 100 μg/ml for 48 h Root extracts exhibited substantial growth inhibition and their percent inhibition was in the range of 40–95% However, stem and leaves extracts were ineffective in reducing the viability of HeLa cells and their percent inhibition was in the range of 10–40% DMSO alone at the concentration used showed no adverse effect on cellular proliferation Further, when cells were treated with different extracts of R sativus root (0–100 μg/ml) for 48 h, it was observed that hexane extract of root showed the most potent growth inhibitory activity against HeLa cells (data not shown) Consequently, hexane extract of root was used in all further experiments for understanding molecular mechanism leading to growth arrest and cell death Effect of Hexane Extract of R sativus Root on Viability of HeLa, A549, MCF-7 and PC-3 Cells A set of four cancer cell lines of epithelial origins was used to evaluate growthinhibitory potential of R sativus root extract These cells were selected as they represent major organ sites including, cervix (HeLa), lung (A549), breast (MCF-7) and prostate gland (PC-3) The effect of hexane extract of R sativus root on proliferation of HeLa, A549, MCF-7 and PC- cells are shown in Table Cells were treated with hexane extract (0–25 μg/ml) and inhibition of cell proliferation was evaluated after 24, 48 and 72 h R sativus root extract displayed a dose and timedependent growth inhibitory effect on all human cancer cells examined In line with these findings, IC50 values clearly indicated anti-proliferative efficacy of R sativus root extract (Table 2) All cancer cell lines exhibited similar sensitivity to R sativus root extract Interestingly, significant growth inhibitory activity was seen within 24 h for HeLa, A549 and MCF-7, suggesting rapid inhibition of cell growth by R sativus root However, in case of PC-3 cells, effect was gradual and reached maximum at 72 h Our findings indicated that, the ability of R sativus root extracts to inhibit growth of cancer cells was related to cell types Furthermore, R sativus root extract at the concentration used for anti- proliferative activity showed no adverse effect on the viability of normal human lymphocytes (data not shown), signifying its selective activity towards cancer cells Etoposide was used as a positive control to determine sensitivity of cancer cell lines to conventional anti-cancer Table Effect of hexane extract of R sativus root on the viability of HeLa, A549, MCF-7 and PC-3 cells Cell lines HeLa A549 MCF-7 PC-3 Time (h) Concentration (μg/ml) IC50 10 25 24 91.25±6.22a 74.89±5.69 69.97±3.72 45.79±2.97 24.19±1.64 8.78±0.43 48 72 24 48 72 24 48 72 88.41±4.27 87.05±3.85 90.54±4.27 86.36±3.85 84.85±3.26 94.09±3.25 85.50±3.88 84.36±4.21 71.83±3.45 70.74±5.27 87.58±2.55 74.85±3.08 73.67±3.19 92.88±4.52 77.73±4.75 76.50±4.31 60.17±3.23 59.31±4.67 72.46±4.73 63.86±3.48 62.03±2.92 67.81±3.15 45.63±2.24 45.18±2.53 41.30±2.76 38.70±2.41 56.15±1.48 45.30±1.62 43.37±2.04 33.30±1.64 24.71±1.50 23.23±1.24 20.39±1.52 19.49±0.97 45.03±2.16 40.33±1.80 40.18±2.33 13.48±0.74 11.40±0.87 10.14±0.97 7.40±0.58 7.15±0.42 10.24±0.65 8.03±0.47 7.71±0.39 8.36±0.21 7.64±0.57 7.51±0.15 24 48 72 97.52±4.35 92.88±4.21 90.78±3.31 94.17±3.56 89.79±2.25 88.70±3.08 89.98±5.21 85.53±4.66 82.03±4.70 70.21±4.23 61.26±3.54 58.36±3.20 57.07±2.18 36.51±2.45 31.01±1.81 20.87±0.77 14.92±0.42 12.96±0.34 Cells were incubated with R sativus root extracts (0–25 μg/ml) for 24, 48 and 72 h The cell viability was then determined by MTT assay Experiments were performed in triplicate a Data represent mean±SD cell viability as a percentage of untreated control samples 204 Plant Foods Hum Nutr (2010) 65:200–209 drug as well as to compare the potency of R sativus root extract as a chemopreventive agent Cancer cells were exposed to etoposide (0–25 μg/ml) for 48 h All cancer cells were susceptible to etoposide treatment with IC 50 of 10.71 μg/ml for HeLa, 12.43 μg/ml for A549, 11.64 μg/ml for MCF-7 and 21.80 μg/ml for PC-3 cells, respectively Comparison of anti-proliferative activity of R sativus root extract with etoposide showed that R sativus root extract had growth arresting activity higher than etoposide, thus demonstrating its effectiveness as a chemopreventive agent Compositional Analysis of Hexane Extract of R sativus Root Analysis of hexane extract of R sativus root by GC-MS revealed the presence of 42 compounds, of which, 18 compounds were identified, as shown in Table 3, by comparing their retention indices (RI) and mass spectra (MS) with the Wiley library spectra database and literature data [11, 12] The major isothiocyanates (ITCs) found in hexane extract were 4-(methylthio)-3-butenyl isothiocyanate – MTBITC (Z isomer) (33.92%), 4-(methylthio)-3-butyl isothiocyanate – erucin (15.09%), 4-(methylthio)-3-butenyl isothiocyanate – MTBITC (E isomer) (5.82%), 4-methylpentyl isothiocyanate(1.61%),4-pentenylisothiocyanate(0.86%)and sulforaphene(0.49%).Othercomponentsdetectedwerealkanes and fatty, and their esters In addition, eugenol, a phenylpropanoid was detected in considerable amount (3.45%) in the hexaneextract A reduction in cell growth and an induction of cell death are considered to be primary means for inhibition of tumor Table Compounds identified in hexane extract of R sativus root, as analyzed by GC-MS a Retention time (min) area percentage (peak area relative to the total peak area percentage) b Relative growth Our findings demonstrate for the first time that lipophilic root extract of R sativus exerted significant growth inhibitory activity on human cancer cell lines at concentrations as low as 25 μg/ml However, stem and leaves exhibited negligible growth inhibitory activity, which could probably be due to their different phytochemical profile as compared to the root of this vegetable The main classes of compounds found in hexane extract of root were MTBITC and erucin, whose anti-proliferative activity was proven against leukemia and colon cancer cell lines [8, 9, 13] Findings from this present study extend anti- proliferative effects of these compounds to cervical, lung, breast and prostate cancer cells MTBITC was reported to be the main volatile component of R sativus root responsible for its pungency [14] However, previous studies demon- strated the presence of other ITCs such as 4-methylpentyl ITC, hexyl ITC, 5-hexenyl ITC, 4(methylthio)-3-butyl ITC (erucin) and 5-(methylthio)pentyl ITC in root of R sativus [15] Recently, Blazevic and Mastelic [12] reported that erucin was the most abundant ITC in root of R sativus Contrary to these findings, we found MTBITC to be the most predominant ITC in our study The observed differ- ences on type and relative percentage of ITC could be attributed to genetic variability that occurs among different varieties of R sativus, and also due to contribution of different environmental factors The marked chemopreven- tive efficacy of R sativus root could be attributable to synergism among major and minor ITCs present in it Stem and leaves of R sativus contained significant amount of polyphenolics [16], but low level of ITCs was detected as compared to root [17] This could be the probable reason Sl.No Compounds RTa Homology (%) RCb 10 11 12 13 14 15 16 17 4-pentenyl isothiocyanate 4-methylpentyl isothiocyanate 4-methylthio pentenenitrile Undecane Dodecane Eugenol 3-butenyl isothiocyanate Tridecane 4-(methylthio)-3-butenyl isothiocyanate (MTBITC) 4-(methylthio)-3-butyl isothiocyanate (erucin) 4-(methylthio)-3-butenyl isothiocyanate (MTBITC) Sulforaphene Hexadecanoic acid Octadecanoic acid 7-methyl linolenate 5-(methylthio) pentyl isothiocyanate Pentacosane 6.91 7.38 9.02 10.58 10.78 10.94 11.63 12.01 13.69 13.92 14.03 15.41 19.81 21.51 26.06 27.04 28.20 90 92 90 96 96 99 95 96 99 99 99 92 99 99 95 92 96 0.86 1.61 3.39 4.79 1.47 3.45 1.24 4.77 5.82 15.09 33.92 0.49 10.95 11.97 0.92 1.26 2.43 18 Tetracosane 29.50 96 2.18 Plant Foods Hum Nutr (2010) 65:200–209 205 for low growth inhibitory activity of stem and leaves extract Importantly, hexane extract was found to be capable of affecting cancer cells selectively Selective targeting and negligible toxicity to normal cells are basic prerequisites for probable chemopreventive agents The difference in R sativus effect towards cancer and normal cells could be due to a fact that it could be targeting a particular molecular event exclusively present in cancer cells, but absent in normal cells Morphological Changes Following Treatment with Hexane Extract of R sativus Root The phenotypic characteristics of cancer cells treated with R sativus root extract were evaluated by an inverted phase contrast microscope Significant morphological changes indicative of cell death and growth inhibition were observed in all cancer cell lines treated with R sativus root extract for 24 h, as compared to untreated cells Representative control and treated cells are shown in Fig 1.1 (HeLa), 1.2 (A549), 1.3 (MCF-7) and 1.4 (PC-3) Hexane extract of R sativus root severely affected spreading and elongation of cells leading to a rounded morphology and eventual detachment from culture plates Detachment of cells is a common feature of apoptosis in a tissue culture that is thought to be similar to separation of apoptotic cells occurring in cancer tissues To rule out possibility of cell death due to necrosis, cells were examined with trypan blue and greater than 90% of detached cells were found to exclude the dye Staining of cells with propidium iodide showed fragmentationandcondensationofchromatinandothermorphological features characteristic of apoptotic cells in HeLa cells treated with hexane extract for 24 h, as compared to untreated cells (Fig 2.1) Untreated control cells exhibited a normal nuclear morphology characterized by diffused chromatin structure Similar results were obtained with other cancer cells such as A549 (Fig 2.2), MCF-7 (Fig 2.3) and PC3 (Fig 2.4) The observation of apoptotic fragmentation of nuclei indicates that hexane extract of R sativus root induced apoptosis in different cancer cells In the present study, cancer cells treated with hexane extract showed morphological features indicative of apoptosis such as rounded morphology, detachment from substratum, cell shrinkage and DNA fragmentation The overall data demonstrate that hexane extract of R sativus root significantly inhibited cell growth and proliferation through induction of apoptosis as the main death pathway in cancer cells Further, induction of apoptosis correlated inversely with decreased cell viability, confirming that apoptosis was mostly accountable for cell death and growth 1.1a 1.2a 1.3a 1.4a 1.1b 1.2b 1.3b 1.4b Fig Morphological changes in cancer cells after treatment with hexane extract of R sativus root for 24 h a Control cells (treated with 0.1% DMSO); b Cells treated with 25 μg/ml of hexane extract; 1.1 – HeLa; 1.2 – A549; 1.3 – MCF-7; 1.4 – PC-3 cells Cells were visualized under a phase contrast microscope (magnification×100) Detachment of cells from substratum, cell shrinkage, nuclear condensation and fragmentation were evident in cells treated with hexane extract of R sativus root 206 Plant Foods Hum Nutr (2010) 65:200–209 2.1a 2.2a 2.3a 2.4a 2.1b 2.2b 2.3b 2.4b Fig Morphological alterations, characteristics of apoptosis induced in cancer cells after treatment with hexane extract of R sativus root for 24 h a Control cells (treated with 0.1% DMSO); b Cells treated with 25 μg/ml of hexane extract; 2.1 – HeLa; 2.2 – A549; 2.3 – MCF-7; 2.4 – PC-3 cells Cells were visualized under a fluorescent microscope after staining with PI (magnification×200) Arrows showing chromatin condensation and nuclear fragmentation inhibition An interesting finding in this present study is that hexane extract of R sativus root initiated apoptotic cell death at a concentration range, which was well below the range reported for other plant extracts [18–20] Our findings for the first time, demonstrate that R sativus root extract induced apoptosis both in p53 proficient human cancer cell lines such as HeLa, A549 and MCF-7 cells and p53 deficient cell line such as PC-3 cells, suggesting that a p53 independent pathway may be operative in such a system and could act as a chemopreventive agent regardless of p53 status of cancer cells This induction of apoptosis occurred rapidly within 12 h, implying that R sativus root extract could have induced apoptosis by activating pre-existing apoptosis machinery Earlier report indicated that p53 was not necessary for the induction of apoptosis as p53 negative cells were equally sensitive to apoptotic pathways [21] Shao et al [22] reported that a novel retinoid induced apoptotic pathway in human breast cancer cells via regulation of p21, Bcl2 and Bax in a p53 independent manner Previous studies also reported that mutant p53 has a dominant negative effect on a wild type p53 and presence of mutated p53 could render cancer cells resistant to conventional chemotherapeutic agents or ionizing radiation [23] Moreover, most of the chemotherapeutic drugs induce apoptosis via modulation of p53 expression, which could be one of the reasons for non-responsive nature of cancer cells to anti-cancer drugs Induction of apoptosis by R sativus root in both p53 proficient and p53 deficient cells indicated that it has potential to be exploited as a novel Expression of Genes Related to Apoptotic Pathway Effect of hexane extract of R sativus root on mRNA expression of genes related to apoptotic pathway was analyzed by RT-PCR Variable changes in the expression of apoptotic genes were noted in cancer cells treated with hexane extract, as shown in Fig 3.1 (HeLa), 3.2 (A549), 3.3 (MCF-7) and 3.4 (PC-3) The expression of Bax and Caspase-3 was found to be augmented in all treated cells, in comparison to untreated controls Treatment with hexane extract increased the expression of p53 in HeLa and A549 cells, but produced no significant change in MCF-7 cells The expression of Bcl2 and Bcl-XL was down-regulated in HeLa, MCF-7 and PC-3 cells However, in case of A549 cells, effect of R sativus on Bcl2 and Bcl-XL gene appeared to be less pronounced and relative gene expression level of R sativus root treated cells was not significantly different from untreated control cells In the control RT-PCR assay, βactin expression level remained unaltered following treatment with hexane extract in all cell lines Plant Foods Hum Nutr (2010) 65:200–209 3.1 M 207 3.2 M 1.0 a 1.1 1.4 1.9 1.4 2.2 1.0 1.6 1.7 1.9 2.1 2.3 1.0 1.1 1.3 1.7 1.6 0.9 1.0 1.6 0.9 1.2 1.9 0.8 p53 1.0a 2.1 2.2 2.2 2.1 2.0 1.0 1.9 1.8 2.2 2.4 2.4 1.0 1.0 0.9 1.1 0.5 0.3 1.0 1.0 1.0 0.6 0.6 0.4 p53 Bax Bax Bcl2 Bcl2 Bcl-XL 1.0 1.0 3.3 M 2.5 1.3 2.4 1.5 2.4 2.6 2.6 2.4 2.7 2.4 1.0 a 1.0 0.9 1.0 1.0 1.0 1.0 1.6 1.8 2.6 2.6 2.5 1.0 1.0 0.9 0.7 0.7 0.4 1.0 0.8 0.8 0.5 0.2 0.3 Bcl-XL Cas-3 Cas-3 β-actin β-actin 3.4 p53 M 1.0a 1.1 1.3 2.1 2.0 2.0 1.0 0.9 1.3 1.3 0.6 0.5 1.0 0.9 0.9 0.6 0.7 0.7 1.0 2.5 2.3 2.0 2.7 2.5 Bax Bcl2 Bcl2 Bcl-XL Bcl-XL Cas-3 1.0 1.1 1.2 1.5 1.7 Bax Cas-3 β-actin 1.9 β-actin Fig Expression of genes related to apoptotic pathway in cancer cells following exposure to hexaneextract of R sativus root for 12 h Column M, DNA ladder; Column 1, control cells (treated with 0.1% DMSO); Column 2, cells treated with 1.0 μg/ml of hexane extract; Column 3, chemopreventive agent for cancer cells, which are resistant to conventional chemotherapeutic agents Bcl2 family of homologous proteins signifies a crucial check point in most apoptotic signaling pathways They function either as pro-apoptotic (Bax, Bak, Bad) or anti- apoptotic (Bcl2, Bcl-XL) regulators In this study, we found that R sativus root extract induced up-regulation of Bax mRNA expression in all cell lines studied Bax plays a significant role in promoting the activation of apoptotic signaling pathways Bax acts as an apoptotic inducer by interacting with itself or with Bcl2 or Bcl-XL, in a homo- and/ or hetero-dimeric state, in which relative amounts of each protein predetermine life or death response of a cell to an apoptotic stimulus [24] Previous report indicated that Bax gene is a direct transcriptional target of p53 [25] We found that Bax expression was upregulated irrespective of p53 status of the cell In HeLa and A549 cells, upregulation of Bax expression was associated with increased p53 expression, suggesting a p53dependent apoptotic pathway However, in MCF-7 and PC-3 cells, R sativus root-induced cell death was not accompanied by a change in p53 expression, but rather associated with an increased expression of Bax Expression levels of anti-apoptotic genes such as Bcl and Bcl-XL were found to be variable The expression of 2.0 μg/ml; Column 4, 5.0 μg/ml; Column 5, 10.0 μg/ml; Column 6, 25.0 μg/ml of the hexane extract of R sativus root a Change in gene expression of the bands normalized to β-actin Similar patterns of gene expression were obtained from three independent experiments 3.1, HeLa cells; 3.2, A549 cells; 3.3, MCF-7 cells; 3.4, PC-3 cells Bcl2 and Bcl-XL was found to be down-regulated in HeLa, MCF-7 and PC-3 cells This could probably be associated with increased apoptotic activity However, in A549 cells, there was no significant change in the expression level of Bcl and Bcl-X L as compared to untreated cells, and the apoptotic pathway seemed to be independent of Bcl2 expression Excess of Bax might counter death repressor activity of Bcl2/Bcl-XL through Bax: Bcl2/Bcl-XL heterodimerization [26] However, several studies demonstrated that Bcl2 family of proteins might function independently without the formation of hetero-dimers [27] A high level of apoptosis even in the presence of Bcl and Bcl-X L may imply the possibility of a treatment-associated phosphory- lation, which was reported to cause significant loss of their anti-apoptotic function [28, 29] The regulation of life and death of a cell could probably be a multifaceted process and may be cell-type specific Our results suggest that the sensitivity of cancer cells to R sativus root could be related to interactions among Bcl2 family proteins intrinsically modulated by R sativus Caspase cascade is considered as a vital pathway in apoptotic signal transduction Activation and cleavage of Caspase-3 serve as a convergence point for apoptotic pathways [30] Results from this study suggest that the 208 mechanism of R sativus root induced apoptosis in cancer cells, could entail Caspase-3 activation and resultant cascade of reactions, since all cancer cells overexpress Caspase-3 It has been suggested that Caspase-3 cleaves Caspase-activated DNase inhibitor and releases Caspaseactivated DNase (CAD) from the complex Once CAD is released, it enters into the nucleus and degrades chromatin into smaller nucleosomal fragments, which consecutively promotes apoptosis Findings from this study indicate that R sativus root activated Caspase-3 and initiated release of apoptotic factors, which in turn led to apoptosis Conclusions Plant products have become increasingly popular in various traditional, complementary and alternative systems as they are pharmacologically potent and have low or no side effects R sativus root significantly inhibited the proliferation of several human cancer cells through induction of apoptosis Hexane extract contains different ITCs such as MTBITC, erucin, 4-methylpentyl isothiocyanate, 4pentenyl isothio- cyanate and sulforaphene, which could act on different pathways of cancer cell growth and survival Induction of apoptosis by the hexane extract appears to involve up- regulation of pro-apoptotic genes and down regulation of anti-apoptotic genes along with the activation of Caspase-3 Our findings suggest the use of R sativus root extracts in functional foods and food supplements designed for the prevention of various chronic diseases including cancer However, further studies are needed to prove that the protectiveeffectsobserved in vitro indeed translate in vivo Acknowledgement This study was supported by a funding under the Technology Education Quality Improvement Program (TEQIP) by World Bank to Centre for Biotechnology, Institute of Science and Technology, Jawaharlal Nehru Technological University, Hyderabad, India The first author acknowledges the financial support from CSIR in the form of a Senior Research Fellowship References Morse MA, Stoner GD (1993) Cancer chemoprevention: principles and prospects Carcinogenesis 14:1737–1746 Surh YJ (2003) Cancer chemoprevention with dietary phytochemicals Nat Rev Cancer 3:768–780 Potter JD, Steinmetz K (1996) Vegetables, fruit and phytoestrogens as preventive agents In: Stewart BW et al (eds) Principles of Chemoprevention International Agency for Research on Cancer IARC Scientific, Lyon, pp 61–90 Sun SY, Hail N, Lotan R (2004) Apoptosis as a novel target for cancer chemoprevention J Natl Cancer Inst 96:662–672 Jeffery EH, Jarrell V (2001) Cruciferous vegetables and cancer prevention In: Handbook of Nutraceuticals and Functional Foods CRC Press, Boca Raton, FL, pp 169–192 Plant Foods Hum Nutr (2010) 65:200–209 Kapoor LD (1990) Hand Book of Ayurvedic Medicinal Plants CRC Press, Boca Raton, FL Nadkarni KM (1976) Indian Materia Medica Popular Prakashan, Bombay Papi A, Orlandi M, Bartolini G, Barillari J, Iori R, Paolini M, Ferroni F, Fumo MG, Pedulli GF, Valgimigli L (2008) Cytotoxic and antioxidant activity of 4-methylthio-3-butenyl isothiocyanate from Raphanus sativus L (Kaiware Daikon) sprouts J Agric Food Chem 56:8750–8883 Barillari J, Iori R, Papi A, Orlandi M, Bartolini G, Gabbanini S, Pedulli GF, Valgimigli L (2008) Kaiware Daikon (Raphanus sativus L.) extract: a naturally multipotent chemopreventive agent J Agric Food Chem 56:7823–7830 10 Mosmann T (1983) Rapid colorimetric assay for cellular growth and survival: application to proliferation and cytotoxicity assays J Immunol Methods 65:55–63 11 Vaughn SF, Berhow MA (2005) Glucosinolate hydrolysis products from various plant sources: pH effects, isolation, and purification Ind Crop Prod 21:193–202 12 Blazevic I, Mastelic J (2009) Glucosinolate degradation products and other bound and free volatiles in the leaves and roots of radish (Raphanus sativus L.) Food Chem 113:96–102 13 Fimognari C, Nusse M, Iori R, Cantelli-Forti G, Hrelia P (2004) The new isothiocyanate 4-(methylthio) butyl isothiocyanate selectively affects cell-cycle progression and apoptosis induction of human leukemia cells Invest New Drugs 22:119–129 14 Coogen RC, Wills RBH, Nguyen VQ (2001) Pungency levels of white radish (Raphanus sativus L.) grown in different seasons in Australia Food Chem 72:1–3 15 Visentin M, Tava A, Iori R, Palmieri S (1992) Isolation and identification of trans-4-(methylthio)-3-butenyl glucosinolate from radishroots(Raphanus sativus L.) J Agric Food Chem 40:1687–1691 16 Beevi SS, Mangamoori LN, Gowda BB (2010) Polyphenolics profile, antioxidant and radical scavenging activity of leaves and stem of Raphanus sativus L Plant Foods Hum Nutr 65:8–17 17 Beevi SS, Mangamoori LN, Reddy LV (2010) Protective effect of Raphanus sativus on H 2O induced oxidative damage in human lymphocytes World J Microbiol Biotechnol doi:10.1007/ s11274.010.0328.4 18 Lee BB, Cha MR, Kim SY, Park E, Park HR, Lee SC (2007) Antioxidative and anticancer activity of extracts of cherry (Prunus serrulata var spontanea) blossoms Plant Foods Hum Nutr 62:79–84 19 Tansuwanwong S, Yamamoto H, Imai K, Vinitketkumnuen U (2009) Antiproliferative and apoptosis of RKO colon cancer by Millingtonia hortensis Plant Foods Hum Nutr 64:11–17 20 Kilani S, Sghaier MB, Limem I, Bouhlel I, Boubaker J, Bhouri W, Skandrani I, Neffatti A, Ammar RB, Dijoux-Franca MG, Ghedira K, Chekir-Ghedira L (2008) In vitro evaluation of antibacterial, antioxidant, cytotoxic and apoptotic activities of the tubers infusion and extracts of Cyperus rotundus Bioresource Technol 99:9004–9008 21 Hipp ML, Bauer G (1997) Intercellular induction of apoptosis in transformed cells does not depend on p53 Oncogene 15:791–797 22 Shao ZM, Dawson MI, Li XS, Rishi AK, Sheikh MS, Han QX, Ordonez JV, Shroot B, Fontana JA (1995) p53 independent G0/G1 arrest and apoptosis induced by a novel retinoid in human breast cancer cells Oncogene 11:493–504 23 Scott RJ, Krummenacher F, Mary JL, Weber W, Spycher M, Muller H (1993) Hereditary p53 mutation in a patient with multiple tumors: significance for genetic counseling Schweiz Med Wschr 123:1287–1292 (In German) 24 Sedlak TW, Oltvai ZN, Yang E, Wang K, Boise LH, Thompson CB, Korsmeyer SJ (1995) Multiple Bcl-2 family members demonstrate selective dimerization with Bax Proc Natl Acad Sci USA 92:7834–7838 Plant Foods Hum Nutr (2010) 65:200–209 25 Miyashita T, Reed JC (1995) Tumor suppressor p53 is a direct transcriptional activator of the human bax gene Cell 80:293– 299 26 Basu A, Haldar S (1998) The relationship between Bcl2, Bax and p53: consequences for cell cycle progression and cell death Mol Hum Reprod 4:1099–1109 27 Cheng EH, Levine B, Boise LH, Thompson CB, Hardwick JM (1996) Bax-independent inhibition of apoptosis by Bcl-xL Nature 379:554–556 209 28 Pratesi G, Polizzi D, Perego P, Dal Bo L, Zunino F (2000) Bcl-2 phosphorylation in a human breast carcinoma xenograft: a common event in response to effective DNA-damaging drugs Biochem Pharmacol 60:77–82 29 Poruchynsky MS, Wang EE, Rudin CM, Blagosklonny MV, Fojo T (1998) Bcl-xL is phosphorylated in malignant cells following microtubule disruption Cancer Res 58:3331–3338 30 Porter AG, Janicke RU (1999) Emerging roles of caspase-3 in apoptosis Cell Death Differ 6:99–104 All in-text references underlined in blue are linked to publications on ResearchGate, letting you access and read them immediately [...]...All in-text references underlined in blue are linked to publications on ResearchGate, letting you access and read them immediately