Hexane extract of raphanus sativus l roots inhibits

... localization of phosphoenolpyruvate carboxylase in developing and germinating wheat grains Plant Physiol 1998, 116:1249-1258 52 Neuhoff V, Arold N, Taube D, Ehrhardt W: Improved staining of proteins in ... Figure reports the changes in the relative spot volumes of proteins that were increased in quantity under Fe deficiency For most of the proteins there was an increasing tr...

Ngày tải lên: 11/08/2014, 11:21

... cứu, đánh giá số tiêu chất lượng rau mầm cải củ trắng (Raphanus sativus L ) sản xuất giá thể sinh học 1.2 Mục tiêu đề tài Phân tích số tiêu chất lượng dinh dưỡng VSAT thực phẩm rau mầm cải củ trắng ... thời gian thu hoạch đến số tiêu chất lượng dinh dưỡng rau mầm cải củ trắng sản xuất giá thể SH - Đánh...

Ngày tải lên: 30/10/2012, 15:37

... tài: Sử dụng phân hữu bùn cống sinh hoạt trồng rau cải củ (Raphanus sativus L. ) thực với mục tiêu: Mục tiêu tổng quát: Đánh giá ảnh hưởng phân bón hữu bùn cống sinh hoạt đến suất rau cải củ nhằm ... Supe l n + 0,02 kg KCl) (12,95±2,10 - 14,28±2,1 8) Như thấy phân hữu bùn cống sinh hoạt giúp rau cải củ tăng trưởng tốt số...

Ngày tải lên: 20/06/2016, 19:34

... BSA as a standard [40] Purification of cathepsin B-like cysteine protease from daikon radish All purification procedures were performed at °C unless otherwise indicated Cotyledons of daikon radish ... specificity and sensitivity to protease inhibitors This article represents the first report detailing the enzymatic characterization of a plant CBCP Results Purificat...

Ngày tải lên: 16/03/2014, 04:20

... except of DNA polymerase b-like, are inhibited by PMLA contained in the extracts The inhibitory activity during the cell cycle The inhibitory activity during the cell cycle was measured in the presence ... mitosis Thus, the in vivo and in vitro activities of DNA synthesis corresponded with the minimum of the inhibitory activity in the cel...

Ngày tải lên: 31/03/2014, 21:21

... Figure analysis of methyl halides, methanethiol, and DMS from R sativus GC-MS GC-MS analysis of methyl halides, methanethiol, and DMS from R sativus (a) GC-MS spectrum of methyl halide standards ... the emission profiles of methyl halides from some plants and the characterization of the enzymatic properties of recombinant R sativus HTMT (RsHTMT) Resul...

Ngày tải lên: 12/08/2014, 03:21

... melo L. ); loài Citrullus có dưa h u (Citrullus lanatus Thunb); loài Lagenaria có b u (L siceraria M .), Sechium có su su dưa tr i (Trichosanthes anguina L. ) Theo Tatlioglu (199 3) [109], chi Cucumis ... 196 2) Trong ñó, loài quan tr ng nh t Cucurbita g m bí bí ngô (C maxima Duch, C moschata Duch Ex Lam .) Trong loài Cucumis bao g m dưa chu t (C sativus L. ),...

Ngày tải lên: 18/08/2013, 20:02

... 198 5) [12] Ssp Himalaicus Fil - Nhóm ph Hymalaia Ssp Hernaphroditus Fil - Nhóm l ng tính Nhà ch n gi ng dưa chu t n i ti ng Tkachenco N (196 7) [55] ñã chia C sativus thành th (varieties) Var Vulgaris ... 4. 2) Vi c nghiên c u bi n pháp k thu t thâm canh dưa Mèo t i Thu n Châu, Sơn La vi c l m c n thi t giúp ngư i dân chuy n ñ i phương th c canh tác truy n th n...

Ngày tải lên: 22/11/2013, 10:36

... (parthenocarpy) Kubicki, 1964 [33] ñ nh hư ng vi c s d ng dòng l ng tính ñ trì dòng ñơn tính tham gia t h p lai ba D ng l ng tính ñ c (Andromonoecious): Trên có hoa ñ c hoa l ng tính D ng l ng tính ... Hermaphroditus Fil.- Dưa chu t l ng tính Nhà ch n gi ng dưa chu t n i ti ng Tkachenco N [50] ñã chia C sativus thành th (varieties): Var Vulgaris- dưa chu t thư n...

Ngày tải lên: 22/11/2013, 23:24

... cylindrica (L) .Roen, Da chuột (Cucumis sativus L .), Da hấu( Citrullus latanus Mats et Nakai), Da gang( Cucumis melo L .) II Mục tiêu đề tài - Tìm hiểu đặc điểm hình thái, cấu tạo giải phẫu giống khác loài ... hấu (Citrullus latanus Mats et Nakai) 3.1 Đặc điểm hình thái 30 3.2 Đặc điểm giải phẫu 30 31 II Cây da gang (Cucumi...

Ngày tải lên: 18/12/2013, 20:27

... KHOA NÔNG L M NGƯ  - KHẢO NGHIỆM MỘT SỐ GIỐNG DƯA CHUỘT (Cucumis sativus L. ) TRONG VỤ XUÂN 2012 TẠI HUYỆN TUY PHƯỚC-BÌNH ĐỊNH KHÓA LUẬN TỐT NGHIỆP KỸ SƯ NGÀNH NÔNG HỌC Người thực : L p : ... đề tài: ‘ Khảo nghiệm số giống dưa chuột (Cucumis sativus L. ) vụ Xuân năm 2012 Bình Định ’ Mục đích - yêu cầu 2.1 Mục đích Tuy n chọn giống dưa...

Ngày tải lên: 22/12/2013, 12:52

... report the crystal structure of the intact glutaminase under four different conditions: in the absence of the additives (referred to as N); in the presence of Tris (referred to as T); in the presence ... determined the F structure containing the truncated region of the C-terminal domain; however, we failed to determine the structure of th...

Ngày tải lên: 06/03/2014, 09:22

... (Paris, France): 5forGulox (forward), 5¢-GGGGACAAGTTT GTACAAAAAAGCAGGCTTCGATGACGACGACAAG ATGAGCCCGATATGGAGTAATTGGCCT-3¢; and 3revGulox (reverse), 5¢-GGGGACCACTTTGTACAAGAAA GCTGGGTCTCAGGGACCGAGAACGCGCCGGGTGT ... as a direct electron acceptor The animal and plant l-gulonolactone oxidoreductases are also active towards the l-galactono-1,4-lactone substrate Only scarce data are available on...

Ngày tải lên: 07/03/2014, 12:20

... CLAP_1:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTAAAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT CLAP_2:AGGACCTTTTATTAGACATTTCAAATATATAATAAACGTTATTTTAAAATTAGAAAAATTGAAAGACAAGCTAATGAAAGCTTATTGCCGATTGGAAAGT ... CLAP_2:ATTAGTGCTATAGTTTGGGAAATATTTAGTCCTTGTTTTGTGTGATCTTATAAGATAATATTTGTAGTTTGTGCTTTTATATAATTTAGCTCATTGGATT 1730 * 1888 CLAP_1:AAGATCTTCTGAATGTGATTATATGCGGCTGTGTTTTCTAATAGATTT...

Ngày tải lên: 07/03/2014, 16:20

... hearing from you now STATEMENT OF HILDA L SOLIS, MEMBER OF THE HOUSE OF REPRESENTATIVES FOR CALIFORNIA (32d CONGRESSIONAL DISTRICT), LOS ANGELES COUNTY, CA Mrs SOLIS Thank you, Mr Chairman I, ... welcome Representative Solis, with whom I served in the U.S House of Representatives on the Education and Labor Committee We had a great meeting, days ago in my office, and discussed...

Ngày tải lên: 14/03/2014, 20:20