... (crabp1a; 3¢-RACE: 5¢-CCC AACTTCGCCGGCACCTGG-3¢, 5¢-TGAAAGCTCTCG GCGTAAAC-3¢; 5¢-RLM-RACE: 5¢-GAGCTTTCAGA AGTTCGTCG-3¢, 5¢-GAATCTCCACATGCGGTTTG-3¢) and a zebrafish genomic DNA sequence assembly (BX663612) ... LN54 panel are: crabp1a: 5¢-TGGTTTGCACGCGGATTTAC-3¢, 5¢-GAAC GATGACTACAGCAATGG-3¢; crabp1b: 5¢-GCAAATGT GAGCACTAAGTG-3¢, 5¢-CGGCCATCGACGGTCTC-3¢ The PCR conditions have been described previously ... which harbors the coding sequence of another gene similar to the mammalian CRABPI (crabp1b; 3¢-RACE: 5¢-GCTAACAGATCAATAGGCTTC-3¢, 5¢-GATTTGAA AGCAAGAGGGTC-3¢; 5¢-RLM-RACE: 5¢-TTAGACGC AGCCGCACAAG-3¢,...
... percentage of circulating CD45RA+ CD45RO- naïve and CD45RA- CD45RO+ memory CD4+ T cells, and among the latter, the percentage of CD62L+ CD45RO+ central and CD62L- CD45RO+ effector memory T cells ... CD3-PerCP (SP34-2; BD Biosciences, San Jose, CA, USA ), CD4-PC7 (SFCI12T4D11; Beckman Coulter, Brea, CA, USA), CD45RA-Pacific Blue (HI100; eBioscience, San Diego, CA, USA), CD45RO-F (UCHL1; BD Biosciences), ... cells, CD45RO+ (RO+) CD62L+ central memory T cells and CD45RO+ (RO+) CD62L- effector memory T cells in the peripheral blood mononuclear cells (PBMCs) of SLE patients and HCs (b) (c) CD4+ T cells activated...
... tricarboxylic acid cycle in the presence of benzoic acid reflect the much higher tricarboxylic acid cycle flux Overall, intracellular metabolite profiles show that in the presence of benzoic acid cells ... that the concentrations of the weak acids in the tricarboxylic acid cycle (pyruvate, citrate, a-ketoglutarate, succinate, fumarate and malate) in the presence of benzoic acid are all significantly ... adaptation of S cerevisiae to benzoic acid An aerobic glucose-limited steady-state chemostat culture of S cerevisiae was suddenly exposed to a certain extracellular benzoic acid concentration (a step change...
... Inhibition of activation-induced apoptosis of thymocytes by all-trans- and 9-cis -retinoic acid is mediated via retinoicacid receptor b Biochem J 331, 767– 774 Yang, Y., Minucci, S., Ozato, K., ... (1995) Efficient inhibition of activation-induced fas ligand up-regulation and T cell apoptosis by retinoids requires occupancy of both retinoid X receptors and retinoicacid receptors J Biol Chem ... J.M., Michel, S., Toth, R., Karaszi, E & Fesus, L (1998) Inhibition of activation-induced apoptosis of thymocytes by all-trans- and 9-cis -retinoic acid is mediated via retinoicacid receptor alpha...
... for 13cIMH cloning and gene speci c primers of zebrafish RPE65 (zRPE65-Fwd; 5¢-GC GGCCGCCACCATGGTCAGCCGTTTTGAACAC-3¢ and zRPE65-Rev; 5¢-GATATCTTATGGTTTGTACATCC CATGGAAAG-3¢) The sizes of the PCR ... sequence [64], 13cIMH-Fwd; 5¢-GCGGCCGCCACCATGGTCAGTCGTCTTGAACAC-3¢ and a reverse primer containing a HindIII site, 13cIMH-Rev; 5¢-AAGCTTCTAAGGTTTGTAG ATGCCGTGGAG-3¢) were used for PCR PCR was performed ... 13-cis -retinoic acidto all-trans -retinoic acid in vitro Biochem J 327, 721–726 Tsukada M, Schroder M, Roos TC, Chandraratna RA, Reichert U, Merk HF, Orfanos CE & Zouboulis CC (2000) 13-cis retinoic acid...
... Curve BD Biodistribution CL Clearance CLSM Confocal Laser Scanning Miroscopy CMC Critical Micelle Concentration CyA Cyclosporine A DCC N,Nʹ-dicyclohexylcarbodiimide DCM Dichloromethane DMAP Dimethylaminopyridine ... cancer, colorectal cancer, bladder cancer, cutaneous melanoma, pancreatic cancer, leukemia, breast cancer, endometrial cancer, ovarian cancer, brain cancer, nonHodgkin lymphoma etc General classification ... conditions These factors are said to be the most common risk factors for cancer Many of these risk factors can be avoided and several of these factors may act together to cause normal cells to...
... glycolic acid and % of formic acid were detected in The amount of malic acid decreased, and was converted into more simple organic acids as reaction time increased Glycolic acid increased up to ... Glycolic acid Malic acid H2O O C CO2 + H2O H HCl H C O C OH O Hydrolysis, Dehydration HO C Cl C OH O TCAA H2O HCl H Hydrolysis, Thermal decomposition Thermal decomposition CC OH H Citric acid* * ... decomposed to glycolic acid by thermal decomposition After the production of glycolic acid, reaction pathway was not different from that of MCAA TCAA was rapidly converted to glycolic and formic acid...
... aromatic amino acids that affect the fluorescence characteristics, especially the position of the emission maxima [15,19] For these reasons, fluorescence spectroscopy is widely used for the analysis of ... diluted in NaCl ⁄ Pi to a final concentration of lm A wavelength of 295 nm, which excites tryptophans, was used for the fluorescence spectra measurements The fluorescence emission spectra were recorded ... septic shock Outbred ICR mice were purchased from the Breeding Farm of the Bulgarian Academy of Sciences The experimental protocols were approved by the Animal Care Commission of the Institute of...
... evaluate HCVcc infectivity few cell lines support infection technical difficulties of primary cell culture no secretion of particles independence of CD81 for entry no budding at the ER exogenous core ... development of HCV-like particles, another model was created to specifically investigate the entry process of HCV This system is called pseudo particles of HCV (HCVpp), as envelope glycoproteins of HCV ... treatment; secretion of neosynthesized virions able to infect naive cells; and selection of quasispecies during the culture of infected hepatocytes To succeed in obtaining HCV infection in primary...
... Mut10 ACTAAGCTTAAAAGGGGACTTCTCTGGCATGGTTCAGGTTTGGAGGCACCTGGGA ACTAAGCTTAAAAGGGGACTTCTCTGGCATGGTTCCTGGGTGGAGGCACCTG ACTAAGCTTAAAAGGGGACTTCTCTGGCATGGGGCAGGGGTGGAGGCAC ACTAAGCTTAAAAGGGGACTTCTCTGGCAGTGTTCAGGGGTGGAGG ... ACTAAGCTTAAAAGGGGACTTCTCTGGCAGTGTTCAGGGGTGGAGG ACTAAGCTTAAAAGGGGACTTCTCTGTAATGGTTCAGGGGTGG ACTAAGCTTAAAAGGGGACTTCTAGGGCATGGTTCAGGGG ACTAAGCTTAAAAGGGGACTGATCTGGCATGGTTCAGGGG ACTAAGCTTAAAAGGGGCATTCTCTGGCATGGTTCAGGGG ACTAAGCTTAAAAGTTGACTTCTCTGGCATGGTTCAGGGG ... corepressor Complex by the receptor, which then recruits a series of coactivator proteins, such as steroid receptor coactivator (SRC-1), glucocorticoid receptor interacting protein (GRIP1), activator of...
... fluorescence were completely separated from each other (Fig 1C) The fluorescent material scattered elsewhere in Fig is thought to belong to pieces of halos not focussed to the plane The occurrence together ... plane of optimal focus was mathematically reassigned to its proper places of origin (EXHAUSTIVE PHOTON REASSIGMENT software from Scanalytics, Billerica, Massachusetts) after accurate characterization ... fluorescence was arranged around the center of the nucleus, and matched only the peripheral area of the blue DAPI fluorescence of chromatin The patches were reminiscent of the patchwork-like structure...
... guanine stacking in various G4 structures Figure shows the CD spectra of c- MYC, PDGF-A, Tel-1 and Tel-2 oligonucleotides in 50 mm Tris–HCl containing 50 mm K+ cations According to the finding of multiple ... oligomer) causes an additional decrease of this characteristic peak, by approximately 38% A molar ratio of 16 platinum complexes to oligomer can occupy all guanines of Tel-2 oligonucleotide; this decreases ... CD spectroscopy CD spectra were recorded on a Jasco J-810 spectropolarimeter (Jasco Inc., Easton, MD, USA) equipped with a PTC-423L temperature controller using a quartz cell of mm optical path...
... primer (5¢-CGGGAATTCCTG CAGTTGCTTTCTCGCAGCAAC-3¢), and then cloned between the SalI and PstI sites of the DHFR fusion vector pJWL1030folA [4] to produce pJWL1030folA–pepP N-terminal deletions of AMPP ... likely to cause a conformational change that is likely to further reduce the capacity of the fragment to bind metals The conformational change could move E271 away from the active site, hence stabilizing ... (2004) Chemical and biochemical strategies for the randomization of protein encoding DNA sequences: library construction methods for directed evolution Nucleic Acids Res 32, 1448–1459 Schenk G,...
... Foster City, CA, USA) GAPDH_for 5¢-GAAGGGCTCATGACCACAGTCC AT-3¢, GAPDH_rev 5¢-TCATTGTCGTACCAGGAAAT GAGCTT-3¢; ADAM10_for 5¢-CTGGCCAACCTATTTG TGGAA-3¢, ADAM10_rev 5¢-GACCTTGACTTGGACTG CACTG-3¢; BACE_for ... BACE_for 5¢-GTTATCATGGAGGGCTTC TACGTT-3¢, BACE_rev 5¢-GCTGCCGTCCTGAACTCA TC-3¢; APLP2_for 5¢-CTCAGCGGATGATAATGAG CAC-3¢, APLP2_rev 5¢-GGTTCTTGGCTTGAAGTTCT GC-3¢ Real-time RT-PCR was performed ... PCR was induced by heating to 95 C, followed by 45 PCR cycles (one cycle contained the following steps: 15 s at 95 C; 30 s at 55 C; 30 s at 72 C) The specificity of each primer pair was confirmed...