Báo cáo khoa học: C Isotopologue editing of FMN bound to phototropin domains potx

13 C Isotopologue editing of FMN bound to phototropin domains Wolfgang Eisenreich 1 , Monika Joshi 1 , Boris Illarionov 1 , Gerald Richter 2 , Werner Ro ¨ misch-Margl 1 , Franz Mu ¨ ller 3 , Adelbert Bacher 1 and Markus Fischer 4 1 Lehrstuhl fu ¨ r Organische Chemie und Biochemie, Technische Universita ¨ tMu ¨ nchen, Garching, Germany 2 School of Chemistry, Cardiff University, UK 3 Wylstrasse 13, Hergiswil, Switzerland 4 Institut fu ¨ r Biochemie und Lebensmittelchemie, Abteilung Lebensmittelchemie, Universita ¨ t Hamburg, Germany 13 C-Labeled flavocoenzymes have played an important role for the spectroscopic analysis of flavoenzymes [1], but their use was limited by the costs and effort for the preparation of the 13 C-labeled cofactors. More spe- cifically, 13 C can be introduced with relative ease into the pyrimidine moiety of the isoalloxazine system [2], and the xylene moiety of flavin cofactors can be labeled by enzyme-assisted strategies [3], whereas ribi- tyl carbon atoms have been rarely included in labeling studies due to technical hurdles. We have shown earlier that mixtures of 13 C isotopologues of the riboflavin precursor, 6,7-dimethyl-8-ribityllumazine, can be pre- pared by biotransformation of 13 C-labeled glucose in vivo [4]. In the present study, we report the transfor- mation of these isotopologue libraries into random libraries of 13 C isotopologues of FMN and their utili- zation for NMR studies of the plant blue light recep- tor, phototropin [5,6]. Keywords blue light receptor; isotopologue libraries; LOV domain; NMR spectroscopy; phototropin Correspondence W. Eisenreich, Lehrstuhl fu ¨ r Organische Chemie und Biochemie, Technische Universita ¨ tMu ¨ nchen, Lichtenbergstrasse 4, D-85747 Garching, Germany Fax: +49 89 289 13363 Tel: +49 89 289 13336 E-mail: wolfgang.eisenreich@ch.tum.de M. Fischer, Institut fu ¨ r Biochemie und Lebensmittelchemie, Abteilung Lebensmittelchemie, Universita ¨ t Hamburg, Grindelallee 117, 20146 Hamburg, Germany Fax: +49 40 4283 84342 Tel: +49 40 4283 84357 E-mail: markus.fischer@chemie.uni- hamburg.de (Received 6 June 2007, revised 12 August 2007, accepted 19 September 2007) doi:10.1111/j.1742-4658.2007.06111.x The plant blue light receptor phototropin comprises a protein kinase domain and two FMN-binding LOV domains (LOV1 and LOV2). Blue light irradiation of recombinant LOV domains is conducive to the addition of a cysteinyl thiolate group to carbon 4a of the FMN chromophore, and spontaneous cleavage of that photoadduct completes the photocycle of the receptor. The present study is based on 13 C NMR signal modulation observed after reconstitution of LOV domains of different origins with ran- dom libraries of 13 C-labeled FMN isotopologues. Using this approach, all 13 C signals of FMN bound to LOV1 and LOV2 domains of Avena sativa and to the LOV2 domain of the fern, Adiantum capillus-veneris, could be unequivocally assigned under dark and under blue light irradiation condi- tions. 13 C Chemical shifts of FMN are shown to be differently modulated by complexation with the LOV domains under study, indicating slight differences in the binding interactions of FMN and the apoproteins. Abbreviations C(4a), carbon 4a; TARF, tetraacetylriboflavin. 5876 FEBS Journal 274 (2007) 5876–5890 ª 2007 The Authors Journal compilation ª 2007 FEBS The gene specifying phototropin, the first in the emerging family of blue light receptors in plants, was initially cloned from Arabidopsis thaliana and was shown to specify a cytoplasmic protein comprising a serine ⁄ threonine protein kinase domain and two FMN-binding LOV domains (designated LOV1 and LOV2), which are members of the PAS domain super- family [6–8] (Fig. 1). Blue light irradiation of recombi- nant LOV domains results in substantial modulation of the visible absorption spectrum [9], which was inter- preted to result from the formation of an adduct between the thiol group of a cystein residue and car- bon 4a [C(4a)] of the FMN chromophore by Vincent Massey (a contribution to the discussion at the 13th International Congress on Flavins and Flavoproteins; 29 August to 4 September 1999, Konstanz) (Fig. 2). This interpretation was confirmed by site-directed mutagenesis, NMR spectroscopy and X-ray crystallo- graphy [9–13]. The photocycle is best described as an addition ⁄ elimination sequence. The structure of recombinant LOV2 domain of the fern Adiantum capillus-veneris has been determined by X-ray crystallography in the dark as well as the light state [12,13] (Fig. 3). The protein is characterized by five antiparallel b-sheets and four a-helices that form a central pocket harboring the FMN chromophore. A light-induced change in the position of the side chain of cysteine 966 is well in line with the adduct forma- tion [12–14]. In addition to the cysteine 966 residue, 11 amino acid residues were shown to contact the FMN chromophore via hydrogen bonds or van der Waals contacts. Notably, these residues are highly con- served in all LOV domains, indicating a canonical FMN binding motif (Fig. 2). NMR studies with the LOV2 domain of Avena sati- va showed that the photoadduct formation involves a conformational change in the ribityl side chain of the flavin cofactor as indicated by 31 P and 13 C NMR data [10]. It was also shown that the adduct formation trig- gers the unfolding of the helical domain Ja, which AB Fig. 1. Organization of phototropins used in the preent study. A, A. sativa NPH1-1 (accession no. O49003); B, A. capillus-veneris phy3 (accession no Q9ZWQ6). Fig. 2. Amino acid sequence alignment of domains used in the present study. Amino acid residues derived from the vector are italicized. Asterisks indicate amino acid residues of protein from A. capillus-veneris in direct contact with the FMN chromophore [13]. Identical amino acid residues are shown in black, and similar amino acid residues are in grey shadow typeface. The formation of a cysteinyl-flavin-C(4a) cova- lent adduct after irradiation of the LOV–FMN complex with blue light is shown and the cystein residue involved in adduct formation is marked by an arrow. W. Eisenreich et al. 13 C NMR of phototropin domains FEBS Journal 274 (2007) 5876–5890 ª 2007 The Authors Journal compilation ª 2007 FEBS 5877 serves as a linker between the LOV2 domain and the kinase domain in the LOV2 domain of A. sativa [11]. That unfolding is believed to modulate the activity of the kinase domain, which is conducive to its autophos- phorylation. The exact role of the LOV1 domain in regulating phototropin activity is not fully understood, but the overall architecture of LOV1 from Chlamydomonas was found to be almost identical with that of LOV2 [15]. Recent studies indicate that LOV2 acts as the principal light sensing domain, which is coupled via the Ja helix with the kinase activity [11], whereas LOV1 may play a crucial role in receptor dimerization [16,17]. The present study was initiated in order to monitor more closely the light-induced chemical shift modula- tion of the FMN cofactors complexed to LOV domains of different origins. For the unequivocal assignment of the 13 C NMR signals of all carbon atoms in the FMN chromophore, the apoproteins were reconstituted with random and ordered 13 C isotopo- logue libraries of FMN. The signal intensity modula- tion reflecting the different isotopologue compositions in samples with random isotopologue libraries of FMN served as the basis for isotope abundance editing of the 13 C NMR signals. The method can be adapted for NMR signal assignment in a variety of other pro- tein ⁄ ligand systems. Results We have reported earlier on the preparation of isoto- pologue mixtures of 6,7-dimethyl-8-ribityllumazine (3; Fig. 4) by in vivo biotransformation of 13 C-labeled glu- cose using a recombinant Escherichia coli strain [4]. These isotopologue mixtures were used in the present study as a starting material for the preparation of iso- topologue mixtures of FMN by enzyme-assisted syn- thesis. The transformation of 3 into riboflavin catalyzed by the enzyme riboflavin synthase proceeds as a dismuta- tion whereby two equivalents of 3 are transformed into one equivalent each of riboflavin (5; Fig. 4) and 5-amino-6-ribitylamino-2,4(1H,3H)-pyrimidinedione (4; Fig. 4). In order to avoid the inherent loss of isotope- labeled precursor, the second product 4 resulting from the dismutation can be reconverted into 3 by treatment with lumazine synthase using 3,4-dihydroxy-2-buta- none 4-phosphate as cosubstrate. The cosubstrate can be prepared in appropriately 13 C-labeled form by enzymatic conversion of 13 C-labeled glucose. By that approach, the yield of riboflavin based on isotope- labeled 3 can be optimized (for details, see Experimen- tal procedures). The riboflavin arising by the in vitro biotransforma- tion can be converted into FMN by treatment with riboflavin kinase in situ; ATP required as kinase sub- strate can be conveniently recycled using phosphoenol pyruvate as phosphate donor. One-pot reaction mix- tures catalyzing the formation of FMN from randomly labeled 3 and specifically 13 C-labeled glucose comprise nine enzyme catalysts and afford the product at a yield of over 90% based on the 13 C-labeled 3 [3]. Synthetic genes specifying the LOV1 (Fig. 5) and LOV2 domains of phototropin NPH1-1 from A. sativa and the LOV2 domain of phototropin phy3 from the fern A. capillus-veneris were constructed as described A B Fig. 3. Adiantum phy3 LOV2 structures. (A) dark and (B) light state (protein databank ID code 1G28, respectively, 1JNU) [12,13]. Atoms in amino acid residues are colored by elements: carbon, white; oxy- gen, red; nitrogen, blue; sulfur, yellow. 13 C NMR of phototropin domains W. Eisenreich et al. 5878 FEBS Journal 274 (2007) 5876–5890 ª 2007 The Authors Journal compilation ª 2007 FEBS in the Experimental procedures. All genes were opti- mized for hyperexpression in E. coli host strains. Gen- erally, the assembled DNA fragments were cloned into an expression vector specifying fusion proteins com- prising hisactophilin from Dictyostelium discoideum and a thrombin cleavage site. All sequences have been deposited in GenBank. The cognate fusion proteins were expressed efficiently in recombinant E. coli strains and could be bound to nickel-chelating Sepharose due to the large number of histidine residues present in the hisactophilin domain. The column was washed with buffer containing 8 m urea to release the protein- bound FMN, and the resulting apoprotein was recon- stituted on the column with isotope-labeled FMN. The protein was then eluted with imidazole. The solution was treated with thrombin and passed again through a nickel-chelating column in order to remove the cleaved hisactophilin domain that was bound, whereas the LOV2 domains were not retained. Figure 6 shows 13 C NMR signals of the recombi- nant LOV2 domain from A. capillus-veneris (LOV2 fern ) reconstituted with [U- 13 C 17 ]FMN and with two isoto- pologue mixtures of FMN obtained by biotransforma- tion of [2- 13 C 1 ]- or [3- 13 C 1 ]glucose, respectively. The left panel shows spectra that were acquired under dark conditions. In the spectrum of protein reconstituted with universally 13 C-labeled FMN (Fig. 6A), all signals with the exception of C(2) appear as broadened multi- plets due to 13 C 13 C coupling of directly adjacent carbon atoms. In the samples reconstituted with the isotopologue mixtures, the carbon signals of the bound FMN appear as singlets, and their apparent intensities vary over a wide range (Fig. 6B,C). This intensity vari- ation is due to the presence of the singly 13 C-labeled isotopologues at different abundances in the FMN iso- topologue mixtures. The relative intensities of the indi- vidual carbon signals observed in the protein sample reflect the relative abundances of the different FMN isotopologues (cf. 13 C enrichments of the FMN speci- mens from the different 13 C-labeled glucoses indicated by filled circles in Fig. 6) and constitute the basis for unequivocal signal assignment. Fig. 4. Synthesis of isotopologue libraries of FMN from [2- 13 C 1 ]glucose. 1, Ribulose 5-phosphate; 2, 3,4-dihydroxy-2-butanone 4-phosphate; 3, 6,7-dimethyl-8-ribityllumazine; 4, 5-amino-6-ribitylamino-2,4(1H,3H)-pyrimdinedione; 5, riboflavin. W. Eisenreich et al. 13 C NMR of phototropin domains FEBS Journal 274 (2007) 5876–5890 ª 2007 The Authors Journal compilation ª 2007 FEBS 5879 For example, the position 8a methyl group, but not the position 7a methyl group, is significantly labeled in the sample of 3 obtained by biotransformation of [2- 13 C 1 ]glucose, and the signal detected at 23.2 p.p.m. in the spectrum with the isotopologue library from [2- 13 C 1 ]glucose can be clearly assigned to C(8a) (Fig. 6B). The C(7a) atom is not 13 C-enriched from either [2- 13 C 1 ]- or [3- 13 C 1 ]glucose; therefore, no signal Fig. 5. Construction of a synthetic gene for A. sativa LOV1 domain. Alignment of the wild-type DNA sequence (ASNPH1), and the synthetic DNA sequence (ASLOV1-syn) with 5¢ and 3¢ overhangs including the synthetic BglII and HindIII sites. Changed codons are shaded in black. New single restriction sites are shaded in grey. Oligonucleotides used as forward primers are drawn above, and reverse primers below, the aligned DNA sequences. Fig. 6. 13 C NMR signals of 13 C-labeled FMN complexed to LOV2 domain from A. capillus-veneris under dark conditions or under blue light irradiation. A, [U- 13 C 17 ]FMN; B, FMN obtained from [2- 13 C 1 ]glucose; C, FMN obtained from [3- 13 C 1 ]glucose. Asterisks indicate impurities. 13 C NMR of phototropin domains W. Eisenreich et al. 5880 FEBS Journal 274 (2007) 5876–5890 ª 2007 The Authors Journal compilation ª 2007 FEBS can be detected in the 13 C NMR spectra of the corre- sponding protein samples. On the other hand, a second methyl signal (doublet with a coupling constant of 43 Hz) is observed at 21.9 p.p.m. in the spectrum with [U- 13 C 17 ]FMN as a cofactor. It is immediately obvious that this signal has to be assigned to C(7a). Due to the specific 13 C enrichments in the ribityl moiety of the FMN samples, the signals for C(1¢), C(2¢) and C(4¢) are observed in the isotopologue mix- ture from [2- 13 C 1 ]glucose, whereas only the signals for C(2¢) and C(3¢) are detected in the spectrum of the iso- topologue mixture from [3- 13 C 1 ]glucose with higher intensity of the C(2¢) signal. On this basis, all ribityl signals can be unequivocally assigned (Table 1 and Fig. 6). Using the same isotopologue editing approach, unequivocal signal assignments can be obtained for the carbon atoms of the isoalloxazine ring. Thus, label from [2- 13 C 1 ]glucose is diverted to the ring carbon atoms 4a, 5a, 6 and 8 with 13 C enrichments of 6 > 4a > 5a  8 (cf. filled circles in Fig. 6). The car- bon atoms 4, 5a, 7, 8, 9a and 10a acquire 13 C label from [3- 13 C 1 ]glucose with enrichments in the order of 5a  8 > 10a > 4 > 9a  7. Indeed, in the signal region for aromatic carbon atoms (115–165 p.p.m), four signals were observed in the protein samples with FMN from [2- 13 C 1 ]glucose (Fig. 6B), and six signals were detected with FMN from [3- 13 C 1 ]glucose (Fig. 6C). The signal intensities were found to vary in the same pattern as determined for the free FMN iso- topologue mixture, and thus provided the basis for the assignments. Additional validation is provided by the simultaneous detection of the signals for C(8), and C(5a) in both samples because both molecular posi- tions acquire 13 C enrichment from [2- 13 C 1 ]glucose, as well as from [3- 13 C 1 ]glucose. Due to low 13 C enrich- ments of C(9) in the used FMN libraries, no signal should be detectable for that atom. However, a signal for C(9) has to be present in the sample with [U- 13 C 17 ]FMN and was indeed observed at 118.9 p.p.m. (Fig. 6A). In summary, the observed sig- nal intensities in the spectra with universally 13 C- labeled FMN and two isotopologue libraries of FMN (i.e. obtained from biotransformation of [2- 13 C 1 ]- and [3- 13 C 1 ]glucose) allowed the assignments of all 17 car- bon atoms of FMN. The results are summarized in Table 2. The validity of the experimental approach was confirmed by signal assignments using an ordered library of 13 C-labeled FMN isotopologues. More spe- cifically, we measured the 13 C NMR chemical shifts of seven selectively 13 C-labeled FMN isotopologues Table 1. 13 C abundance of FMN obtained from [2- 13 C 1 ]glucose and FMN obtained from [3- 13 C 1 ]glucose bound to the LOV2 domain from A. capillus-veneris under dark and light conditions. The corre- sponding values with the isotopologue mixtures of free FMN are given for comparison. On the basis of the low signal-to-noise ratios of the NMR spectra, the errors can be estimated as ± 30% of a given 13 C abundance value. Carbon position 13 C abundance (%) [2- 13 C 1 ]glucose [3- 13 C 1 ]glucose Free FMN LOV2-bound FMN Free FMN LOV2-bound FMN Dark Light Dark Light 43131 c + b 4a 49 + b ND a 5a 16 26 ND a 87 70 + b 687++ b ++ b 71626+ b 816+ b + b 87 ++ b ++ b 8a 87 ++ b ++ b 9a 16 + b + b 10a 43 ++ b + b 1¢ 72 90 + b 2¢ 30 27 ND a 62 81 ++ b 3¢ 25 28 + b 4¢ 34 34 c + b a Not determined due to signal overlapping. b Signal observed at high (+) and very high intensity (+ +). c Reference value. Table 2. NMR chemical shifts of TARF, free FMN and FMN bound to LOV2 domain from A. capillus-veneris in dark and light condi- tions. FMN atom NMR chemical shifts (p.p.m.) TARF Free FMN LOV-2 bound FMN Dark Light 2 154.4 159.8 159.4 159.2 4 159.2 63.7 161.3 165.9 4a 135.1 136.2 134.2 65.7 5a 134.5 136.4 136.2 130.1 6 132.5 131.8 133.1 119.1 7 137.2 140.4 138.9 136.0 7a 19.5 19.9 21.9 21.8 8 148.7 151.7 150.2 130.1 8a 21.6 22.2 23.2 22.2 9 115.8 118.3 118.9 119.6 9a 131.4 133.5 134.4 127.7 10a 150.8 152.1 150.8 156.7 1¢ 45.0 48.8 44.8 46.8 2¢ 70.2 70.7 68.1 66.7 3¢ 70.0 74.0 75.1 75.5 4¢ 69.5 73.1 72.9 73.0 5¢ 62.1 66.4 65.8 66.7 P 5.1 4.8 4.1 W. Eisenreich et al. 13 C NMR of phototropin domains FEBS Journal 274 (2007) 5876–5890 ª 2007 The Authors Journal compilation ª 2007 FEBS 5881 bound to the LOV2 domain of A. capillus-veneris (Fig. 7). The chemical shifts observed with these sam- ples were in agreement with the signal assignments made on the basis of the random isotopologue libraries (Fig. 6). The interpretation of the NMR chemical shifts of protein-bound flavins is usually based on the compari- son with the chemical shifts of free flavins [1]. There- fore, the published assignments for free FMN [10] were checked by the isotopologue abundance editing method using labeled FMN obtained from [1- 13 C 1 ]- [2- 13 C 1 ]- and [3- 13 C 1 ]glucose. The previous assignments [10] of the isoalloxazine ring carbons could be com- pletely confirmed (Table 2 and Fig. 6). The previous, tentative assignments of C(3¢) and C(4¢) [10] had to be interchanged. All 13 C NMR assignments of tetra- acetylriboflavin (TARF) were assigned by 2D 13 C inadequate experiments using [U- 13 C 17 ]TARF. In this case, the previous assignment for C(2¢ ) and C(4¢) [18,19] had to be interchanged (Table 2). The isotopologue editing method was then used to assign the 13 C NMR signals of FMN bound to the LOV domains under study under blue light irradiation conditions. In order to keep photodamage of the pro- tein as low as possible, the acquisition times were somewhat reduced under blue light as compared to dark conditions. As a consequence, the signal-to-noise ratios of the NMR spectra of the irradiated samples were lower than those of the corresponding spectra in the dark (Fig. 6, right column). The signal assignments obtained from the random isotopologue libraries matched those from the selectively labeled FMN sam- ples (Fig. 7 and supplementary Fig. S1). The results are presented in Table 2 and confirm previous assign- ments for LOV2 from A. sativa (LOV2 oat ) [10], except that the chemical shifts due to C(7) and C(8), C(6) and C(9), as well as those due to C(3¢) and C(4¢), have to be interchanged. In analogy to the above procedure, the chemical shifts of the LOV1 domain from A. sativa (LOV1 oat ) were also investigated. The results are given in supple- mentary Tables S1 and S2 and supplementary Figs S4 and S5. In summary, the FMN signals of (LOV2 oat ) and (LOV1 oat ) were detected at similar chemical shifts (± 0.2 p.p.m), with the exception of the signals for C(5¢) and C(7a), which were upfield shifted by 0.5 p.p.m and 0.7 p.p.m., respectively, and the signals for C(2) and C(4), which were downfield shifted by 1.6 p.p.m and 0.7 p.p.m., respectively, in the LOV1 domain. A correlation diagram of the chemical shifts for all proteins investigated in this study is shown in Fig. 8. Fig. 7. 13 C NMR signals of of 13 C-labeled FMN with LOV2 domain from A. capillus- veneris under dark conditions. A, [U- 13 C 17 ]FMN; B, [xylene- 13 C 8 ]FMN; C, [7a,9- 13 C 2 ]FMN; D, [6,8a- 13 C 2 ]FMN; E, [4,10a- 13 C 2 ]FMN; F, [7,9a- 13 C 2 ]FMN; G, [5a,8- 13 C 2 ]FMN; H, [4a- 13 C 1 ]FMN. Asterisks indicate impurities. 13 C NMR of phototropin domains W. Eisenreich et al. 5882 FEBS Journal 274 (2007) 5876–5890 ª 2007 The Authors Journal compilation ª 2007 FEBS Discussion The approach described in the present study opens a new way to unambiguously assign all carbon atoms in the 13 C NMR spectra of protein-bound flavin cofac- tors using no more than three FMN samples (i.e. a uniformly labeled and two partially labeled flavin samples that can be biosynthetically obtained by in vivo biotransformation of [2- 13 C 1 ]- and [3- 13 C 1 ]glucose). Since, in the latter two cases, the degree of 13 C enrich- ment of a given carbon atom in the flavin samples dif- fers, the 13 C NMR signal strength (amplitude) of a given carbon atom provides an additional constraint in the signal assignment procedure. By contrast to previ- ous NMR work on flavoproteins [18], where various iosotopologues, selectively enriched in the xylene moiety of flavin, also were used [20], the isotopologues obtained by the new biosynthetic approach allow assignment of the carbon atoms of the ribityl side chain in the NMR spectra of flavin. The 13 C chemical shifts of these atoms can provide important informa- tion about the binding interaction between the hydro- xyl groups of the side chain of flavin and the apoprotein, and could also report possible conforma- tional changes of the side chain (e.g. due to reduction of a flavoprotein). In supplementary Table S2, the 13 C chemical shifts of LOV1 domain of A. sativa in the two states are listed. In the dark state, the chemical shifts of the iso- alloxazine moiety of flavin are very similar to those observed with LOV2 of the same species and of dif- ferent organisms (Fig. 8). Most of the differences (± 0.3 p.p.m) between the two sets are within the accuracy limits of chemical shift determination, except for C(8) of LOV2 fern , which is upfield shifted by 0.6 p.p.m., and C(8a) of LOV2 fern , which is downfield shifted by 0.7 p.p.m., respectively, compared to LOV1 oat and LOV2 oat . The chemical shifts of the side chain carbon atoms 1¢ and 3¢ of LOV2 fern show signifi- cant differences, which may be ascribed to variation in the strength of the hydrogen bond of the correspond- ing hydroxyl groups with the proteins and ⁄ or to con- formational changes in the side chain (Fig. 8). A similar effect is shown by the proteins in the blue light irradiated state. The greatest difference in chemical shifts is observed for C(2) of LOV1 oat , which is down- field shifted by 1.6 p.p.m. compared to the LOV2 molecules. Similarly, the C(4) and C(7a) of LOV1 oat are downfield shifted by 0.7 p.p.m and upfield shifted by 0.5 p.p.m., respectively, compared to LOV2 oat and LOV2 fern . A significant difference is also observed for C(9) and C(1¢) of LOV2 fern, which are upfield shifted by 0.9 and 0.6 p.p.m., respectively, and C(2¢), which is downfield shifted by 0.7 p.p.m., compared to LOV1 oat and LOV2 oat . Based on extensive 13 C and 15 N NMR studies on free flavins in aprotic and protic media [21], which have shown that a direct correlation exists between the p-electron density and the 13 C chemical shift of a particular atom of the flavin molecule, the observed Fig. 8. 13 C Chemical shifts of 13 C-labeled FMN in complex with LOV domains: black lines, dark conditions; blue lines, irradiated with blue light. W. Eisenreich et al. 13 C NMR of phototropin domains FEBS Journal 274 (2007) 5876–5890 ª 2007 The Authors Journal compilation ª 2007 FEBS 5883 chemical shifts can be interpreted in terms of the elec- tronic structure of the protein-bound flavin and its perturbation by binding interaction and chemical reac- tions. Thus, the dark state interaction between FMN and the LOV domains under study is characterized by strong hydrogen bonding with the C(2)O group of flavin. The strength of the hydrogen bond corresponds approximately to that of free FMN in water, indi- cating polarization of the flavin along the axis C(8)-C(6)-C(9a)-N(5)-C(10a)-C(2). This is manifested by the observed downfield shifts of the corresponding C atoms (Table 2 and supplementary Table S2). Although there exists a hydrogen bond between the protein and the flavin at C(4)O group, its strength is considerably weaker than that observed in free FMN in water. These observations are in good agreement with recent X-ray data showing a distance of 0.31 nm between the N d group of N998 and the oxygen atom of the C(2)O group (Table 3). To the C(4)O group, two hydrogen bonds (N e group of Q1029, N d group of N1008) have been suggested by X-ray data, yet the distance between the bond-forming atoms is larger than that observed at C(2)O, supporting our inter- pretation. A strong hydrogen bond to C(4)O would have influenced the chemical shift of the C(4a) atom by a downfield shift compared to that of FMN [10]. The even slightly upfield shifted resonance of the C(4a) atom in comparison to TARF indicates extra p-electron density allocation to this position, released from the N(10) atom, which is downfield shifted compared to TARF, as shown previously [10]. The resonance position of C(4a) is thus in full agreement with the weak hydrogen bond observed at C(4)O. The partial positive charge created on N(10) [21] by the release of electron density onto C(4a) is distributed mainly onto the C(5a) and the C(9) atom, and, to a lesser extent, onto the C(7) atom, in agreement with the fact that the latter atom experiences a smaller downfield shift than the other two atoms. The data demonstrate that, with regard to the isoalloxazine moiety of flavin, there are only minor electronic differ- ences of the prosthetic group of the different proteins investigated in the present study. Taking also into account the previously published 15 N NMR data on LOV2 [10], it can be concluded that the chemical shift of the N(5) atom of flavin indicates no hydrogen bond formation with this atom and a rather hydrophobic environment at this site. This interpretation of the NMR data is fully supported by the X-ray data [22]. On the other hand, the chemical shift of the N(1) atom indicates the presence of a strong hydrogen bond at this site, although the X-ray data suggest the absence of a hydrogen bond. The opposite holds for the N(3) atom: the X-ray data propose a hydrogen bond with the protein whereas the 15 N NMR data suggest the absence of such a bond. The chemical shifts of the C(3¢) and C(4¢) atoms of the side chain of protein-bound flavin resemble Table 3. Distances between FMN atoms (Ligand) and amino acid residues of LOV2 from Adiantum phy3 (chimeric fern photopreceptor) [12,13]. For comparison, 13 C chemical shifts of bound FMN atoms are given. Atom Dark state Light state Ligand Protein Distance (A ˚ ) 13 C NMR chemical shifts (p.p.m.) Distance (A ˚ ) 13 C NMR chemical shifts (p.p.m.) C(4a) S c [C(966)] 4.2 134.2 1.8 65.7 O e [Q(1029)] 4.7 4.0 O(4) N e [Q(1029)] 3.5 161.3 [C(4)] 3.1 165.9 [C(4)] N d [N(1008)] 3.4 3.4 N(3) O d [N(998)] 2.8 3.0 O(2) N d [N(998)] 3.1 159.4 [C(2)] 3.3 159.2 [C(2)] N(5) C e [F(1010)] 3.2 136.2 [C(5a)] 3.8 130.1 [C(5a)] O d [N(965)] 2.7 2.9 O(2¢)N d [N(965)] 3.9 68.1 [C(2¢)] 3.9 66.7 [C(2¢)] O(H 2 O-2) 3.4 3.4 O(H 2 O-1) 3.6 3.6 O(3¢)O(H 2 O-1) 3.1 75.1 [C(3¢)] 3.1 75.5 [C(3¢)] O(4¢)O e (Q970) 3.3 72.9 [C(4¢)] 3.7 73.0 [C(4¢)] N e (Q970) 3.2 3.0 O(1) (on P) N e [R(967)] 2.6 2.5 O(2) (on P) N g [R(967)] 2.6 4.8 (P) 2.7 4.1 (P) O(3) (on P) N g [R(983)] 2.8 3.0 O(3) (on P) N e [R(983)] 2.6 2.7 13 C NMR of phototropin domains W. Eisenreich et al. 5884 FEBS Journal 274 (2007) 5876–5890 ª 2007 The Authors Journal compilation ª 2007 FEBS those of FMN in water, indicating stronger hydrogen bonding interactions with the hydroxyl group at C(3¢) and a somewhat weaker one with that at C(4¢) compared to those observed in FMN. This hydrogen bonding pattern agrees with that observed by X-ray crystallography [22]. The resonance position due to C(1¢) reflects the increased sp 2 hybridization of N(10) [21]. Both C(2¢) and C(5¢) are upfield shifted by more than 1 p.p.m. compared to those of FMN. Whereas the X-ray data indicate no hydrogen bond between the C(5¢)O group and the protein, but a strong one at C(2¢)O, the NMR data do not indicate hydrogen bonding at these atoms. It is suggested that the appar- ent absence of a hydrogen bond at C(2¢)O, as revealed by 13 C NMR, may be masked by a counteracting factor, most probably a conformational change. Upon blue light irradiation of the proteins, rather drastic changes are observed in the NMR spectra [10]. The most obvious one is the large upfield shift ()68.5 p.p.m) of the C(4a) resonance. This proves the conversion of the C(4a) atom from sp 2 to sp 3 hybrid- ization, in line with the formation of a covalent bond between this atom of flavin, and the sulfur atom of C966 in LOV2 of A. capillus-veneris (Fig. 2). The reso- nance line of N(5) also undergoes a large upfield shift ()283 p.p.m) [10], indicating the change from an aro- matic to an aliphatic nitrogen atom. The other carbon atoms of flavin most affected by conversion of the pro- tein by light are: C(8) ()19.9 p.p.m), C(6) ()14.0 pm), C(9a) ()6.7 p.p.m) and C(10a) (+ 5.9 p.p.m). All these atoms are involved in the possible mesomeric struc- tures of oxidized flavin [21] that are disturbed by the C(4a) substitution. The upfield shifts of the resonances of these atoms, with the exception of C(10a), which shows a downfield shifted signal, demonstrates the allocation of the incoming electron density at these positions. The downfield shift of the resonance line due to C(10a) is caused by the higher electron density withdrawal from this atom by the further polarization of the C(2)O group compared to that of the molecule under dark conditions. Since the sp 2 hybridization of the N(10) atom increases considerably upon formation of the C(4a) adduct [10], the upfield shifts of the reso- nances of C(5a) ()6.1 p.p.m) and C(7) ()2.9 p.p.m) atoms can be ascribed to electron density release onto these atoms from N(10). Overall, with regard to the chemical shifts of the carbon atoms of the isoalloxa- zine ring, the electronic structure of the different pro- teins investigated in the present study is very similar, if not almost identical. Only the chemical shifts of the C(2), C(4) and C(4a) atoms of the adduct of LOV1 and LOV2 proteins differ considerably from each other. The chemical shifts of the former protein are downfield from those due to LOV2, indicating stronger hydrogen bonding in LOV1 than in LOV2 at these positions. The hydrogen bond pattern as observed by NMR of the oxidized proteins is also observed in the adduct forms. The hydrogen bond at N(3), as observed by X-ray, is now also evident in the NMR data. Whereas the chemical shifts of the C(4a) signals in LOV2 oat and LOV1 oat are very similar, the corre- sponding signal in LOV2 fern is upfield shifted with respect to the former. This observation suggests some structural difference(s) at the C(4a) position between the proteins from oat and that from fern. The hydrogen bonding pattern observed for the C(3¢) and the C(4¢) atoms of the ribityl side chain in the oxidized proteins is also observed in the corre- sponding adducts, but the strength of hydrogen bond- ing with the C(3¢)O group is considerably increased, especially that in LOV2 fern . With regard to C(5¢) atom, the LOV2 proteins exhibit similar chemical shifts for this atom, whereas that of LOV1 is upfield shifted by 0.5 p.p.m. The chemical shift for the C(2¢) atom increases in the order: LOV2 oat , LOV1 oat and LOV2- fern , possibly reflecting variations in the strength of hydrogen bonding interactions at this position. The 13 C NMR data show that there exist some subtle differences between the proteins investigated in the pres- ent study, as far as the isoalloxazine moiety of the flavin in the resting and photo-adduct state is concerned. The largest difference among the three proteins is observed for the resonance line of the C(2)O group (downfield shift) of LOV1 in the photo-adduct state. However, there are some resonances of ribityl side chain carbon atoms, which differ to a greater extent among the three proteins (Fig. 8), indicating variations in the interaction with the proteins and ⁄ or conformational differences. The LOV1 and LOV2 domains from A. sativa have also been investigated by optical (light absorption, fluo- rescence, CD) and chemical techniques (kinetics) [9,23]. The light absorption and 13 C NMR data indicate a hydrophobic environment at the isoalloxazine moiety of the protein-bound flavin, whereas the fluorescence quan- tum yield of flavin bound to the two proteins reflect probably the sequence difference between the two pro- teins in the neighborhood of the flavin (residue 1010 is phenylalanine in LOV2 of A. capillus-veneris and the positionally equivalent residue in LOV1 of A. sativa is leucine 117). From these data, it can be concluded that the microenvironment of flavin in LOV2 is more hydro- phobic than that in LOV1. This property of the proteins appears to be correlated with the kinetic data, where it has been determined that LOV2 is more reactive to form the photo-adduct than LOV1 and its photo-adduct is more stable than that of LOV1 [9]. Moreover, the W. Eisenreich et al. 13 C NMR of phototropin domains FEBS Journal 274 (2007) 5876–5890 ª 2007 The Authors Journal compilation ª 2007 FEBS 5885 [...]... CATCAATATTTTCTGCAGTTTTCTTAATCAGCATGACACCCTCACGCTCGGCCGCATCACGGACATG ATAATAGGATCCGAATTTCTTGCTACTACACTTGAACGTATTGAGAAGAACTTTGTCATTACTGACCCACGTTTGCCAG CCTCTGGACGCAGATTAGCATCTGGAAGTTCTTTTGCCGCCTCATCAATATTTTCTGCAGTTTTCTTAATC TATTATTATAAGCTTAGTTAGCCCACAAATCCTCTGGACGCAGATTAGCATCTGG GAGGAAGTCCTAGGTAACAACTGCCGTTTCCTGCAGGGCCGCGGTACTGATCGTAAAGCAGTGCAG GACATCGCGCTGCTCCTTGACTGCATCACGGATCAGCTGCACTGCTTTACGATCAGTACCGCGGCC CATCTTCGCGAGTGACCGGTTTCTGGAGCTCACGGAGTATACACGTGAGGAAGTCCTAGGTAACAACTGC... AGGCTGCAAGTGAAAGAGGTTCCAGAACTTTTTACCACTCTTTGTATAATTAATCAGCTGTACAGTGAC AACTGCCGTTTTCTTCAAGGTCCTGAAACCGATCGCGCGACAGTGCGCAAAATTCGTGATGCCATCGATAAC GGACACCAATAAAGTACTGGACATCACCCTTCTGATCACGCATAGGCTGCAAGTGAAAGAGGTTCCAG AGTTTCTTGCAGTTGACAGAATATTCGCGAGAAGAAATTCTGGGTCGTAACTGCCGTTTTCTTCAAGGTCC CACGCTCGGCCGCATCACGGACATGTTCGGTACCATCCAACTGGACACCAATAAAGTACTGGACATC GTCATTACTGACCCACGTTTGCCAGATAATCCCATTATCTTCGCGTCCGATAGTTTCTTGCAGTTGACAGAATATTC CATCAATATTTTCTGCAGTTTTCTTAATCAGCATGACACCCTCACGCTCGGCCGCATCACGGACATG... CATCTTCGCGAGTGACCGGTTTCTGGAGCTCACGGAGTATACACGTGAGGAAGTCCTAGGTAACAACTGC CCAAAAGGCGCGCCCACCTTTTGTATAGTTTAAAACCTGTACAGTGACATCGCGCTGCTCCTTGACTGC AAGTCTTTCGTGATCACAGATCCTCGTTTACCAGACAACCCTATCATCTTCGCGAGTGACCGGTTTCTG GGACGTCGCCATTTTCATCACGCATGACTTGAAGATGGAAGAGATTCCAAAAGGCGCGCCCACCTTTTG ATAATAGGATCCGGTCTGGTACCACGCGGTGAGCGTATCGGTAAGTCTTTCGTGATCACAGATCCTC TATTATTATAAGCTTACATCTCCTGCTGAACTCCGATGAAATATTGGACGTCGCCATTTTCATCACGCATG (2.6... CCAGGTCACCCAATCATGTACGCAAGCGCTGGTTTCTTCAACATGACCGGTTACACATCCAAG ACTTACTTCCACTTGCATGCCGATGAACTTGAGGACACGACCTTCTTCATCCTTGATTGGTGCAATGG GCACTGTCCGCATTCCAACAGACCTTCGTAGTTTCGGACGCCAGCCGTCCAGGTCACCCAATCATGTACGCAAG ATTATTATAAGCTTATTCAGTGTATTTACTTACTTCCACTTGCATGCCGATGAA ATAATAATAAGATCTGCACTGTCCGCATTCCAACAGACCTTC GCGCAAAATTCGTGATGCCATCGATAACCAAACAGAGGTCACTGTACAGCTGATTAATTATACAAAG AGGCTGCAAGTGAAAGAGGTTCCAGAACTTTTTACCACTCTTTGTATAATTAATCAGCTGTACAGTGAC... ASLOV2-12 ACVLOV2-1 ACVLOV2-2 ACVLOV2-3 ACVLOV2-4 ACVLOV2-5 ACVLOV2-6 ACVLOV2-7 ACVLOV2-8 TTCCTCCAAGGTTCCGGCACGGATCCAGCTGAGATTGCCAAGATCCGTCAGGCTCTGGCAAATGGTTCGAAC GCGGTACCGTCTTTCTTGTAGTTGAGGACACGGCCGCAGTAGTTCGAACCATTTGCCAGAGCCTGACGGATC CAACATGACCGGTTACACATCCAAGGAAGTGGTAGGTCGTAACTGTCGTTTCCTCCAAGGTTCCGGCACGGATC CTTCATCCTTGATTGGTGCAATGGTCAGGAGATTCCAGAATGCGGTACCGTCTTTCTTGTAGTTG CCAGGTCACCCAATCATGTACGCAAGCGCTGGTTTCTTCAACATGACCGGTTACACATCCAAG... hisactophilin of D discoideum and a thrombin cleavage site with 3¢-BamHI and HindIII cloning sites pNCO-HISACT- (C4 9S)-BH vector with the LOV1 domain (amino acids 130–244) of phototropin NPH1-1 of A sativa pNCO-HISACT- (C4 9S)-BH vector with the LOV2 domain (amino acids 404–559) of phototropin NPH1-1 of A sativa pNCO-HISACT-BH vector with the LOV2 domain (amino acids 925–1032) of phototropin PHY3 of A capillus-veneris... pNCO-HISACT-ACVLOV2-syn pRFN4 Accession numbers Relevant characteristics recA1, endA1, gyrA96, thi-1, hsdR17, supE44, relA1, lac[F¢, proAB, lacIqZDM15, Tn10(tetr)] lac, ara, gal, mtl, recA+, uvr+, StrR (pREP4: KanR, lacI) pNCO113 vector with the gene coding for hisactophilin of D discoideum with 3¢-BamHI and HindIII cloning sites pNCO113 vector with a gene coding for a cystein-free mutant of hisactophilin... plant photoreceptor domain reveals a light-driven molecular switch Plant Cell 14, 1067–1075 Crosson S & Moffat K (2001) Structure of a flavinbinding plant photoreceptor domain: insights into lightmediated signal transduction Proc Natl Acad Sci USA 98, 2995–3000 Schleicher E, Kowalczyk RM, Kay CW, Hegemann P, Bacher A, Fischer M, Bittl R, Richter G & Weber S (2004) On the reaction mechanism of adduct formation... 13 C NMR spectra of LOV proteins in complex with FMN obtained by biotransformation of selectively 1 3C- labeled glucose and universally 1 3C- labeled glucose, respectively, were measured under the same experimental conditions The ratios of the signal integrals were then calculated for each respective carbon atom Relative 1 3C abundances were normalized to the known abundance for particular carbon atoms of. .. beta-galactosidase selection Biotechniques 5, 376–378 31 Zamenhof PJ & Villarejo M (1972) Construction and properties of Escherichia coli strains exhibiting a-complementation of b-galactosidase fragments in vivo J Bacteriol 110, 171–178 32 Kay CW, Schleicher E, Kuppig A, Hofner H, Rudiger ¨ W, Schleicher M, Fischer M, Bacher A, Weber S & Richter G (2003) Blue light perception in plants 5890 Detection and characterization . ACTTACTTCCACTTGCATGCCGATGAACTTGAGGACACGACCTTCTTCATCCTTGATTGGTGCAATGG ASLOV1-7 GCACTGTCCGCATTCCAACAGACCTTCGTAGTTTCGGACGCCAGCCGTCCAGGTCACCCAATCATGTACGCAAG ASLOV1-8. AGTTTCTTGCAGTTGACAGAATATTCGCGAGAAGAAATTCTGGGTCGTAACTGCCGTTTTCTTCAAGGTCC ASLOV2-6 CACGCTCGGCCGCATCACGGACATGTTCGGTACCATCCAACTGGACACCAATAAAGTACTGGACATC ASLOV2-7 GTCATTACTGACCCACGTTTGCCAGATAATCCCATTATCTTCGCGTCCGATAGTTTCTTGCAGTTGACAGAATATTC ASLOV2-8