an opportunity in search of a metaphor

Báo cáo y học: "Cyclophosphamide in systemic sclerosis: still in search of a ‘real life’ scenario" potx

Báo cáo y học: "Cyclophosphamide in systemic sclerosis: still in search of a ‘real life’ scenario" potx

... Scleroderma Trials And Research [EUSTAR] group), and the fact that new promising drugs (mycophenolate and kinase inhibitors) and treatment strategies (hematopoietic stem cell transplantation) are now ... 1.5 years) and 0.44 QALYs if started after years from the diagnosis [9] These data clearly demonstrate that an early diagnosis of ILD in SSc is fundamental for starting a treatment that may ameliorate ... withdrawals in the active group due to side effects (1 patient had intolerable nausea and patient had abnormal findings on liver function tests during treatment with AZA) and no withdrawals in the...

Ngày tải lên: 09/08/2014, 01:22

3 301 0
in search of memory  the emergence of a new  eric r  kandel

in search of memory the emergence of a new eric r kandel

... scholarships, Ron and I appreciated the true meaning of Harvards alma mater, Fair Harvard. Fair Harvard, indeed! 31 The winning team at the Pennsylvania Relays, 1948 The Pennsylvania Relays is an ... attractive and intellectually stimulating Frenchwoman I had recently started to date While I had been taking Hausmans anatomy course, Anna and I had started to drift apart A relationship that had ... from a long line of rabbis and scholars and had trained as a rabbi in Poland He left Poland when he was twenty-one years old and went to Caen in Normandy, France, where he studied mathematics and...

Ngày tải lên: 04/07/2014, 15:53

319 333 0
Báo cáo y học: " Detection of epithelial to mesenchymal transition in airways of a bleomycin induced pulmonary fibrosis model derived from an α-smooth muscle actin-Cre transgenic mouse" potx

Báo cáo y học: " Detection of epithelial to mesenchymal transition in airways of a bleomycin induced pulmonary fibrosis model derived from an α-smooth muscle actin-Cre transgenic mouse" potx

... NY, USA) using the following primers: forward 5'GAAGATCTATGCCCAAGAAGAAGAGGAAGGTGTCCAATTTACTGAC-3' and reverse 5'-CGGAATTCTGAACAAACGACCCAAC-3' The PCR product was then sub-cloned into the BamHI-EcoRI ... providing SM-MHC polyclonal antibody We also thank Professor Xiaoping Jian (Guangdong Teacher College of Foreign language and art, China) and Dr Elaina Collie-Dugui (Department of Medicine and ... collagen deposition around the walls of small veins and terminal respiratory bronchioles and in certain parenchymal areas (Fig 3A~ j arrowheads) In contrast, there is only minimal βgal staining...

Ngày tải lên: 12/08/2014, 16:20

11 433 0
A critical analysis of hsi mu rens poetry from a marginal perspective   journey embarked on the greenland in search of humanity

A critical analysis of hsi mu rens poetry from a marginal perspective journey embarked on the greenland in search of humanity

... borrowing system and materials sourcing Dr Lin & Zhixian for sending me to the National Taiwan University(国立台湾大学)on a heavy downpour evening to search for my materials Wanling, Xiufang, Huanghua, ... Peiguang, Yaorong, Yingxia and Junying for providing me with additional ideas and sources of materials Dezhao for providing all the relevant materials, information closely related to my research, ... simple humanity of mankind In addition to offering an in- depth analysis on the major themes, as well as Hsi’s literary styles, poetic images and use of language, this dissertation underlines Hsi...

Ngày tải lên: 16/09/2015, 12:34

319 763 0
In Search of Aimai Cristen

In Search of Aimai Cristen

... family also had another game called "Roll the Ball." We'd sit in a circle with Dad at the center, our legs separated so as to make a 'V', and he'd take turns rolling the ball to each of us Dana's ... dark hair, is rolling the ball to Dana, so I guess it must be true "And what about 'Sardines,' and 'Puss in the Corner'?" Dana would probably ask And we did go cross-country skiing in the winter ... talking about anything meaningful He shakes his head, takes off his reading glasses and looks at me I meet his gaze Though his cropped hair is shot through with gray, his eyes are still dark and...

Ngày tải lên: 06/11/2012, 17:33

11 309 0
IN SEARCH OF SOLUTIONS TO IMPROVING THE ENGLISH LANGUAGE PROFICIENCY FOR UNDER GRADUATE STUDENTS AT THE COLLEGE OF TECHNOLOGY (COT)   VIETNAM NATIONAL UNIVERSITY, HANOI

IN SEARCH OF SOLUTIONS TO IMPROVING THE ENGLISH LANGUAGE PROFICIENCY FOR UNDER GRADUATE STUDENTS AT THE COLLEGE OF TECHNOLOGY (COT) VIETNAM NATIONAL UNIVERSITY, HANOI

... systematic training program The lack of an overall foreign language policy can give way to spontaneous and inconsistent application of the teaching and learning of the language Moreover, administrators ... functions; a focus on meaningful tasks rather than on language; efforts to make tasks and language relevant to a target group of learners through an analysis of genuine, realistic situations; the use of ... Communicative Language Teaching (CLT), an appropriate approach in Teaching and Learning English in VNU 1.2.2.1 The Nature of CLT 1.2.2.2 Advantages of CLT 1.2.2.3 CLT - An Appropriate Approach at...

Ngày tải lên: 05/02/2014, 21:52

88 677 1
Tài liệu In Search of the Unknown docx

Tài liệu In Search of the Unknown docx

... a man—that's the harbor-master Ask any quarryman at Port -of- Waves what it is that comes purring around their boats at the wharf and unties painters and changes the mooring of every cat-boat in ... with a smooth-shaven, deeply lined face, and a pair of angry, blue eyes; and the woman stepped back quietly, acknowledging my lifted hat with a silent inclination The man, who was reclining in an ... at night! Ask Francis Lee what it was he saw running and leaping up and down the shoal at sunset last Friday! Ask anybody along the coast what sort of a thing moves about the cliffs like a man...

Ngày tải lên: 17/02/2014, 09:20

200 532 0
Tài liệu In Search of Burningbush docx

Tài liệu In Search of Burningbush docx

... to have a friend 29 30 IN SEARCH OF BURNINGBUSH Human beings are social animals, and, therefore, like dogs and sea bass, inclined to gather in groups Yet how many of us have at one time or another ... have ended up in national politics He was what campaign consultants might call enormously “electable.” Tall and blue-eyed, David was handsome in a nonthreatening all-American WASP way, kind and ... gun wars and cops-and-robbers (on bikes) and foot races and jumping contests and kick-the-can marathons And there was golf Well, sort of Mr Vreeland, the Hanson family’s neighbor, a gray and foreboding...

Ngày tải lên: 22/02/2014, 08:20

289 295 0
To Cut or Not to Cut? That is the (Central Bank’s) Question In Search of the Neutral Interest Rate in Latin America pdf

To Cut or Not to Cut? That is the (Central Bank’s) Question In Search of the Neutral Interest Rate in Latin America pdf

... data was interpolated Data was seasonally adjusted using an X-12 ARIMA seasonal adjustment Public Debt 2012 April WEO Yearly actual and projected data was interpolated Data was seasonally adjusted ... PRY: National Authorities COL, MEX for M0: International Financial Statis tics International res erves International Financial Statis tics Exchange rate International Financial Statis tics Real ... Rica, Dominican Republic, Guatemala, and Paraguay, still have a See Marques and Manrique (2004) for Germany and the United States, Andres et al (2009) for the United States and the Euro area, Basdevant...

Ngày tải lên: 15/03/2014, 14:20

48 505 0
In Search of Best Practice in South African Desegregated Schools ppt

In Search of Best Practice in South African Desegregated Schools ppt

... change to happen in this regard This also relates to change in the mindsets of people about the culture of learning and teaching in former African schools and the training of African teachers at ... encouraged to study an African language A substantial number of parents (approximately 40 per cent) identified language, and especially African languages, as an issue that schools should examine ... Nita Annelize was a white, Afrikaans-speaking female in her thirties, a qualified teacher who had completed a Masters degree in education Nita was an Indian, English-speaking female in her late...

Ngày tải lên: 16/03/2014, 10:20

96 357 0
LOW INTEREST RATES AND HIGH ASSET PRICES: AN INTERPRETATION IN TERMS OF CHANGING POPULAR MODELS doc

LOW INTEREST RATES AND HIGH ASSET PRICES: AN INTERPRETATION IN TERMS OF CHANGING POPULAR MODELS doc

... History of Financial Crises, Fifth Edition, Palgrave-MacMillan, 2005 Modigliani, Franco, and Richard Cohn, “Inflation, Rational Valuation, and the Market,” Financial Analysts Journal, pp 22-44, March-April ... clearly ring, in sound if not fully in substance, as an acceptance of the Friedman formula, and willingness to accept the consequences of following it Friedman left behind an important change in ... example of the kind of thinking appears in a recent Wall Street Journal article: “Lenders have been doling out increasingly large sums of money and accepting increasingly crummy conditions and...

Ngày tải lên: 17/03/2014, 08:20

33 332 0
2013 Private Equity Fund Outlook In search of firm footing pptx

2013 Private Equity Fund Outlook In search of firm footing pptx

... compliance and optimization strategies are also attracting attention in the industry as private equity managers prepare for potential tax changes, including the expiration of Bush-era tax cuts, an ... Managing regulatory, compliance, and tax uncertainties Private equity funds are facing intense scrutiny over regulatory, compliance, and tax issues as LPs and regulators take a closer look at ... such as separate account mandates and co-investment strategies In short, GPs will have to rethink their business and operating models in 2013 in the following ways: • Managing regulatory, compliance,...

Ngày tải lên: 23/03/2014, 08:21

8 381 0
Báo cáo khoa học: Expression in yeast of a novel phospholipase A1 cDNA from Arabidopsis thaliana docx

Báo cáo khoa học: Expression in yeast of a novel phospholipase A1 cDNA from Arabidopsis thaliana docx

... TATATAGGTACCTTATGCATCAACAGAGACACTTAC ATATATGGATCCATGGGCTGGATTCCGTGTCCGTGCTGGGGAACC AACGACGATGAAAACGCCGGCGAGGTGGCGGATCGTGATCCGGTG CTTCTAGTATCTGGAATTGGAGGCTCTATTCTGCATTCTAAGAAGA AGAATTCAAAGTCTGAAATTCGGGTTTG ... AGAATTCAAAGTCTGAAATTCGGGTTTG TATATAGGTACCTTAACCAGAATCAACTACTTTGTG ATATATGGATCCATGGGCTGGATTCCGTGTC TATATAGGTACCTTACTTGTCATCGTCGTCCTTGTAGTCACCAGA ATCAACTACTTTGTGAG TCCATGATATGATTGATATGC GTGGCAATGGTAATCCAC Site-directed ... mutagenesis GCGTAGGAGTTTCGGGTAGCCTCCGCGGGCTTCTCCGTGATGAAAG GGAGTGTCCTTCTATAACATATTTGGAGTGTCACTTAATACACC GTCACTATCATCTCCCATGCAATGGGAGGACTTATGGTTTC CATATGTAGATGGAGCTGGAACTGTCCCTG GGAGTGTCACTTAATGCACCCTTTGATGTTTG...

Ngày tải lên: 30/03/2014, 15:20

13 448 0
The Causes of Inner-City Poverty: Eight Hypotheses in Search of Reality pptx

The Causes of Inner-City Poverty: Eight Hypotheses in Search of Reality pptx

... such as affirmative action, that create a backlash against minorities Although discrimination appears in many different forums, from the labor market to the housing and financial markets and the ... such as skills testing, may increase the representation of African Americans in a firm and is associated with hiring in large downtown companies and government agencies (Neckerman and Kirschenman, ... the changing structure of African-American families, outmigration of middle-income African Americans, and neighborhood effects that enhanced the intergenerational transmission of poverty Of these,...

Ngày tải lên: 02/04/2014, 08:20

38 415 0
travels with charley[ressource électronique] in search of america

travels with charley[ressource électronique] in search of america

... blankets and pillows, and many too many shoes and boots, padded nylon sub-zero underwear, plastic dishes and cups and a plastic dishpan, a spare tank of bottled gas The overloaded springs sighed and ... things at once that it knows about and probably several it doesn’t, a luxurious car drove in and a rather stout and bedizened woman released a rather stout and bedizened Pomeranian of the female ... that he couldn’t bite his way out of a cornet de papier He is a good friend and traveling companion, and would rather travel about than anything he can imagine If he occurs at length in this account,...

Ngày tải lên: 31/05/2014, 01:35

285 317 1
in search of dark-matter

in search of dark-matter

... further away it is For example, imagine three galaxies equally separated along a line and all moving away from each other at the same rate Now imagine us living in a galaxy at one end of the line ... including Albert Einstein ± who were developing a theoretical framework that involved such an expanding Universe An important implication of an expanding Universe was the beginning of all things ... In Search of Dark Matter Ken Freeman and Geoff McNamara In Search of Dark Matter Published in association with Praxis Publishing Chichester, UK Professor Ken Freeman Research School of Astronomy...

Ngày tải lên: 05/06/2014, 11:20

164 156 0
báo cáo hóa học:" Reinterpretation of evidence advanced for neo-oogenesis in mammals, in terms of a finite oocyte reserve" pdf

báo cáo hóa học:" Reinterpretation of evidence advanced for neo-oogenesis in mammals, in terms of a finite oocyte reserve" pdf

... revisiting underlying assumptions and providing alternative explanations (summarised in Table 1) for observations advanced - Page of 20 and maintained - as key by advocates of the hypothesis, adding ... erythroid lineage, and endothelial and vascular smooth muscle progenitors; and the para-aortic splanchnopleura, for lymphoid Notarianni Journal of Ovarian Research 2011, 4:1 http://www.ovarianresearch.com/content/4/1/1 ... of cells obtained in this way are ovarian epithelial cells [51], and contaminants include extraovarian mesothelial cells, endothelial cells, ovarian somatic and mesenchymal cells, and immune cells...

Ngày tải lên: 20/06/2014, 07:20

20 407 0
Báo cáo hóa học: " Fano-Rashba effect in thermoelectricity of a double quantum dot molecular junction" pptx

Báo cáo hóa học: " Fano-Rashba effect in thermoelectricity of a double quantum dot molecular junction" pptx

... Breit-Wigner peak centered at the bonding molecular state and an asymmetrical Fano line shape centered at the antibonding molecular state The degree of the asymmetry of the Fano-Like peak can be attributed ... molecular junction can be realized by using a twodimensional electron gas below the surface of an AlGaAs/GaAs heterostructure [1] The RSOI in the QD can be introduced by using an asymmetrical-interface ... interference and RSOI in the QDs, an asymmetrical transmission node can be observed in the transmission spectrum in the absence of the RSOI Using an inversion asymmetrical interface electric field, we can...

Ngày tải lên: 20/06/2014, 23:20

10 351 0
Báo cáo hóa học: " The Influence of a Continuum Background on Carrier Relaxation in InAs/InGaAs Quantum Dot" ppt

Báo cáo hóa học: " The Influence of a Continuum Background on Carrier Relaxation in InAs/InGaAs Quantum Dot" ppt

... the QD transition energies in our samples Conclusion In conclusion, we have measured the rise and decay dynamics of the ground and first excited state of InAs QDs capped with an InGaAs quantum well ... delocalized states as proposed by Vasanelli et al [15] Preliminary results from in- plane absorption measurements (not shown here) confirm the existence of a continuum of states in the spectral range of the ... have found that the higher energy states of the QDs don’t act as intermediate stages in the carrier relaxation, while the carriers can cool down to any lower energy states following a relaxation...

Ngày tải lên: 22/06/2014, 18:20

3 290 0

Bạn có muốn tìm thêm với từ khóa:

w