amp 8211 in search of a european perspective
Báo cáo y học: "Cyclophosphamide in systemic sclerosis: still in search of a ‘real life’ scenario" potx
... 1.5 years) and 0.44 QALYs if started after years from the diagnosis [9] These data clearly demonstrate that an early diagnosis of ILD in SSc is fundamental for starting a treatment that may ameliorate ... associated with a greater preservation of lung function and that it allowed a gain of 0.20 qualityadjusted life years (QALYs) versus a loss of 0.21 QALYs of the case base (disease duration of 1.5 ... withdrawals in the active group due to side effects (1 patient had intolerable nausea and patient had abnormal findings on liver function tests during treatment with AZA) and no withdrawals in the...
- 3
- 301
- 0
A critical analysis of hsi mu rens poetry from a marginal perspective journey embarked on the greenland in search of humanity
... intriguing ideas he introduced, which infinitely broadened my way of thinking and reshaped my theoretical framework, as well as the inadequacies in the beginning of my research Great appreciation to ... Peiguang, Yaorong, Yingxia and Junying for providing me with additional ideas and sources of materials Dezhao for providing all the relevant materials, information closely related to my research, ... borrowing system and materials sourcing Dr Lin & Zhixian for sending me to the National Taiwan University（国立台湾大学）on a heavy downpour evening to search for my materials Wanling, Xiufang, Huanghua,...
- 319
- 762
- 0
Use of Dreams in Couple Counseling: A Jungian Perspective pot
... leads to doubts and uncertainty A short dream of a man at the very beginning of his therapy is a good example: I was on a dark street A sinister character was following me I became frightened and ... language with something of a lofty, even sublime nature and are distinguished from the everyday language of the dreamer The dream of a young woman at a turning point of her life can serve as an ... tennis club was explaining an extraordinary invention to me: a complicated apparatus, an artificial arm and hand that made it possible for each tennis player to play fourhanded tennis I was very impressed...
- 156
- 565
- 1
ON THE TRANSFORMATION PROCESSES OF THE GLOBAL PULP AND PAPER INDUSTRY AND THEIR IMPLICATIONS FOR CORPORATE STRATEGIES – A European perspective pot
... välttämätöntä kannattavuuden paranemiseksi Muutosprosessin ajureina toimivat korkea pääomatarve, kypsä elinkaaren vaihe, kasvun maantieteellinen jakaantuminen, kuidun saatavuus ja hinta, korvaavat tuotteet, ... of an annual report in Finland, publishing of a women’s magazine in France, distribution of office papers in Great Britain and sale of cigarettes in Germany The added-value of each phase in the ... korvaavat tuotteet, alhainen arvonmuodostus koko arvoketjussa sekä globaalilla tasolla alhainen konsolidaatioaste, jotka johtavat kysynnän ja tarjonnan epätasapainoon ja heikkoon kannattavuuteen Teollisuuden...
- 219
- 483
- 0
Towards a safer use of the Internet for children in the EU – a parents’ perspective ppt
... vs 50% in metropolitan areas and 44% in rural areas) Finally, parents in the metropolitan and rural areas were both less likely than those in urban areas to have rules against using chat rooms ... and using chat rooms were almost the same Table 7: Which online activities are not allowed? Disclosing Making Talking to Spending a Creating a Using Accessing Downloading Using personal purchases ... Creating a profile in an online community 61 Using chat rooms 49 Accessing certain websites Downloading/playing music, films, games 38 Using email/instant messaging tools 37 Q 7A Some parents are...
- 154
- 399
- 0
báo cáo hóa học: " Impact of gastroesophageal reflux disease on work absenteeism, presenteeism and productivity in daily life: a European observational study" doc
... Cooper A, Karagiannis D, Hatlebakk J, Agréus L, Jablonowski H, Tafalla M: Consultation rates and characteristics of gastroesophageal reflux disease in primary care: a European observational study ... has received speaker fees from AstraZeneca; JN is an employee of AstraZeneca Authors' contributions All authors were involved in data interpretation and manuscript preparation Data analysis was ... design and patients RANGE (AstraZeneca study code: D9612L00114) was a multinational, observational programme that was conducted as a series of parallel, locally managed studies at 134 primary care...
- 7
- 410
- 0
in search of memory the emergence of a new eric r kandel
... scholarships, Ron and I appreciated the true meaning of Harvards alma mater, Fair Harvard. Fair Harvard, indeed! 31 The winning team at the Pennsylvania Relays, 1948 The Pennsylvania Relays is an ... structure of the human brain have not changed since Homo sapiens first appeared in East Africa some 150,000 years ago, the learning capability of individual human beings and their historical memory have ... Kolomyya, a town of about 43,000 inhabitants on the Prut River in Galicia This region of the Austro-Hungarian Empire near Romania was then part of Poland and is now part of Ukraine Almost half the...
- 319
- 333
- 0
b.a thesis a comparative study on invitations in english and vietnamese in terms of cross cultural perspective
... misunderstandings Problems arise as language learners are not competent and fail to understand the cultural- social aspects of communication Take speech acts of invitation as an example Vietnamese saying ... Acquiring a second language demands more than learning new words and another system of grammar (Levine and Adelman, 1982) The goal of learning a language, these days, is to be able to carry out ... undoubtedly plays an important role in communication in all cultures Wall (1987) indicated that many of our daily social interactions involve making invitations and responding to them In daily social life,...
- 91
- 1,024
- 4
Báo cáo y học: " Study protocol for the development of a European measure of best practice for people with long term mental health problems in institutional care (DEMoBinc)" pptx
... Setting and inclusion criteria erlands, Poland, Spain, Portugal and UK) selected to provide a range of different stages of deinstitutionalisation and a broad geographical and cultural spread across ... residential settings Journal of Intellectual Disability Research Comparing patients' experience of mental health services in England: a five-Trust survey International Journal of Health Quality Assurance ... Organisation, the Departments of Health and care standard setting agencies in the participating countries including the practicalities of incorporating the toolkit into existing review systems for institutional...
- 8
- 427
- 0
Báo cáo khoa học: "Recommendations on the use of recombinant activated factor VII as an adjunctive treatment for massive bleeding – a European perspective" pot
... Aznar I, Carceller S, Sanz MA: Successful treatment of severe intra-abdominal bleeding associated with disseminated intravascular coagulation using recombinant activated factor VII Br J Haematol ... use of recombinant FVIIa (NovoSeven®) in the management of intractable post-surgical intraabdominal haemorrhage Br J Haematol 1999, 107:677-678 42 Laffan MA, Cummins M: Recombinant factor VIIa ... Recommendation The effects of rFVIIa in patients with penetrating trauma are uncertain, and no recommendations can be made for this indication Grade B Rationale Several case studies and case series have...
- 12
- 423
- 0
In Search of Aimai Cristen
... family also had another game called "Roll the Ball." We'd sit in a circle with Dad at the center, our legs separated so as to make a 'V', and he'd take turns rolling the ball to each of us Dana's ... each of us Dana's got a photograph of the four of us sitting in a circle on the floor of our family room—the house back in Michigan; my back and Dad's back are to the camera, and Dad, still with ... it at the table I'll fix a salad or sometimes he'll have one already made Dad also fixes roasts He's very particular about how they are cooked; he steams the vegetables separately and only adds...
- 11
- 309
- 0
IN SEARCH OF SOLUTIONS TO IMPROVING THE ENGLISH LANGUAGE PROFICIENCY FOR UNDER GRADUATE STUDENTS AT THE COLLEGE OF TECHNOLOGY (COT) VIETNAM NATIONAL UNIVERSITY, HANOI
... Communicative Language Teaching (CLT), an appropriate approach in Teaching and Learning English in VNU 1.2.2.1 The Nature of CLT 1.2.2.2 Advantages of CLT 1.2.2.3 CLT - An Appropriate Approach at ... systematic training program The lack of an overall foreign language policy can give way to spontaneous and inconsistent application of the teaching and learning of the language Moreover, administrators ... native teachers are normally appreciated According to the international language centre called Language Link based in Russia, if a good teacher should understand the intricacies of the language...
- 88
- 675
- 1
Tài liệu In Search of the Unknown docx
... a man—that's the harbor-master Ask any quarryman at Port -of- Waves what it is that comes purring around their boats at the wharf and unties painters and changes the mooring of every cat-boat in ... who had doubted; that my chief, Professor Farrago, had sent me against my will, and that I was 19 ready and glad to admit that he, Mr Halyard, was a benefactor of the human race "Bosh!" he said ... at night! Ask Francis Lee what it was he saw running and leaping up and down the shoal at sunset last Friday! Ask anybody along the coast what sort of a thing moves about the cliffs like a man...
- 200
- 532
- 0
Tài liệu In Search of Burningbush docx
... have ended up in national politics He was what campaign consultants might call enormously “electable.” Tall and blue-eyed, David was handsome in a nonthreatening all-American WASP way, kind and ... to have a friend 29 30 IN SEARCH OF BURNINGBUSH Human beings are social animals, and, therefore, like dogs and sea bass, inclined to gather in groups Yet how many of us have at one time or another ... birdbathlike indentations off the green “fairways,” usually containing an inch or two of brownish rainwater But we always thought guys like Kevin had an unfair advantage: they had their own putters! Kevin,...
- 289
- 295
- 0
The Making of a European Constitution Judges and Law Beyond Constitutive Power docx
... European law ‘Seeing into the mind of law and lawyers’ is not an easy task In particular, and as a part of its integral vocation to remain ‘apart’ from the society that it serves, law is created ... understood, not as an introspective European act of examination, explanation and analysis of particular postnational assaults on the leading paradigms of modernity, but, rather, as an effort to ... most appropriately be safeguarded by a professionally irreproachable and apolitical cadre of European lawyers The independence and, above all, the professionalism of Europe’s lawyers is also a factor...
- 257
- 364
- 0
To Cut or Not to Cut? That is the (Central Bank’s) Question In Search of the Neutral Interest Rate in Latin America pdf
... data was interpolated Data was seasonally adjusted using an X-12 ARIMA seasonal adjustment Public Debt 2012 April WEO Yearly actual and projected data was interpolated Data was seasonally adjusted ... interest rate (World Bank, 2006) While this indexation has maintained financial intermediation in Reais, it has created a system of unusually short duration financial contracts The legacy of indexation ... torical data 12-m onth ahead inflation expectations 2012 April WEO Data was interpolated by obtaining the 12-month ahead inflation projection of the corres ponding year Inflation target National Authorities...
- 48
- 504
- 0
In Search of Best Practice in South African Desegregated Schools ppt
... Nita Annelize was a white, Afrikaans-speaking female in her thirties, a qualified teacher who had completed a Masters degree in education Nita was an Indian, English-speaking female in her late ... change to happen in this regard This also relates to change in the mindsets of people about the culture of learning and teaching in former African schools and the training of African teachers at ... phases In Phase 1, using a combination of purposive and representative sampling, a survey instrument was administered in nine schools in three provinces (Western Cape, Gauteng and KwaZulu-Natal)...
- 96
- 357
- 0
2013 Private Equity Fund Outlook In search of firm footing pptx
... compliance and optimization strategies are also attracting attention in the industry as private equity managers prepare for potential tax changes, including the expiration of Bush-era tax cuts, an ... Managing regulatory, compliance, and tax uncertainties Private equity funds are facing intense scrutiny over regulatory, compliance, and tax issues as LPs and regulators take a closer look at ... such as separate account mandates and co-investment strategies In short, GPs will have to rethink their business and operating models in 2013 in the following ways: • Managing regulatory, compliance,...
- 8
- 381
- 0
Báo cáo khoa học: Expression in yeast of a novel phospholipase A1 cDNA from Arabidopsis thaliana docx
... TATATAGGTACCTTATGCATCAACAGAGACACTTAC ATATATGGATCCATGGGCTGGATTCCGTGTCCGTGCTGGGGAACC AACGACGATGAAAACGCCGGCGAGGTGGCGGATCGTGATCCGGTG CTTCTAGTATCTGGAATTGGAGGCTCTATTCTGCATTCTAAGAAGA AGAATTCAAAGTCTGAAATTCGGGTTTG ... AGAATTCAAAGTCTGAAATTCGGGTTTG TATATAGGTACCTTAACCAGAATCAACTACTTTGTG ATATATGGATCCATGGGCTGGATTCCGTGTC TATATAGGTACCTTACTTGTCATCGTCGTCCTTGTAGTCACCAGA ATCAACTACTTTGTGAG TCCATGATATGATTGATATGC GTGGCAATGGTAATCCAC Site-directed ... mutagenesis GCGTAGGAGTTTCGGGTAGCCTCCGCGGGCTTCTCCGTGATGAAAG GGAGTGTCCTTCTATAACATATTTGGAGTGTCACTTAATACACC GTCACTATCATCTCCCATGCAATGGGAGGACTTATGGTTTC CATATGTAGATGGAGCTGGAACTGTCCCTG GGAGTGTCACTTAATGCACCCTTTGATGTTTG...
- 13
- 448
- 0
Tìm thêm: khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose