... 1.5 years) and 0.44 QALYs if started after years from the diagnosis [9] These data clearly demonstrate that an early diagnosis of ILD in SSc is fundamental for starting a treatment that may ameliorate ... associated with a greater preservation of lung function and that it allowed a gain of 0.20 qualityadjusted life years (QALYs) versus a loss of 0.21 QALYs of the case base (disease duration of 1.5 ... withdrawals in the active group due to side effects (1 patient had intolerable nausea and patient had abnormal findings on liver function tests during treatment with AZA) and no withdrawals in the...
Ngày tải lên: 09/08/2014, 01:22
... scholarships, Ron and I appreciated the true meaning of Harvards alma mater, Fair Harvard. Fair Harvard, indeed! 31 The winning team at the Pennsylvania Relays, 1948 The Pennsylvania Relays is an ... structure of the human brain have not changed since Homo sapiens first appeared in East Africa some 150,000 years ago, the learning capability of individual human beings and their historical memory have ... Kolomyya, a town of about 43,000 inhabitants on the Prut River in Galicia This region of the Austro-Hungarian Empire near Romania was then part of Poland and is now part of Ukraine Almost half the...
Ngày tải lên: 04/07/2014, 15:53
báo cáo khoa học:" Disability in activities of daily living, depression, and quality of life among older medical ICU survivors: a prospective cohort study" potx
... Explanatory Variables Any Impairment in Activities of Daily Living (ADL) * Abbreviations: CI, Confidence Interval; ICU, Intensive Care Unit; APACHE, Acute Physiology and Chronic Health Evaluation ... to examine the association between ADLs and depression SAS statistical software, version 9.2 (SAS Institute Inc., Cary, North Carolina), was used for all analysis [20] Results Of the 309 patients ... answer, hearing, other) 55 Hospital or Nursing Home Missing data elements (including missing ADL data but having SF12 data)* 110 ONE MONTH ANALYSIS SAMPLE 65 Excluded from One Y O Year Analysis A l...
Ngày tải lên: 12/08/2014, 01:22
A critical analysis of hsi mu rens poetry from a marginal perspective journey embarked on the greenland in search of humanity
... intriguing ideas he introduced, which infinitely broadened my way of thinking and reshaped my theoretical framework, as well as the inadequacies in the beginning of my research Great appreciation to ... Peiguang, Yaorong, Yingxia and Junying for providing me with additional ideas and sources of materials Dezhao for providing all the relevant materials, information closely related to my research, ... borrowing system and materials sourcing Dr Lin & Zhixian for sending me to the National Taiwan University(国立台湾大学)on a heavy downpour evening to search for my materials Wanling, Xiufang, Huanghua,...
Ngày tải lên: 16/09/2015, 12:34
In Search of Aimai Cristen
... family also had another game called "Roll the Ball." We'd sit in a circle with Dad at the center, our legs separated so as to make a 'V', and he'd take turns rolling the ball to each of us Dana's ... each of us Dana's got a photograph of the four of us sitting in a circle on the floor of our family room—the house back in Michigan; my back and Dad's back are to the camera, and Dad, still with ... it at the table I'll fix a salad or sometimes he'll have one already made Dad also fixes roasts He's very particular about how they are cooked; he steams the vegetables separately and only adds...
Ngày tải lên: 06/11/2012, 17:33
IN SEARCH OF SOLUTIONS TO IMPROVING THE ENGLISH LANGUAGE PROFICIENCY FOR UNDER GRADUATE STUDENTS AT THE COLLEGE OF TECHNOLOGY (COT) VIETNAM NATIONAL UNIVERSITY, HANOI
... Communicative Language Teaching (CLT), an appropriate approach in Teaching and Learning English in VNU 1.2.2.1 The Nature of CLT 1.2.2.2 Advantages of CLT 1.2.2.3 CLT - An Appropriate Approach at ... systematic training program The lack of an overall foreign language policy can give way to spontaneous and inconsistent application of the teaching and learning of the language Moreover, administrators ... native teachers are normally appreciated According to the international language centre called Language Link based in Russia, if a good teacher should understand the intricacies of the language...
Ngày tải lên: 05/02/2014, 21:52
Tài liệu In Search of the Unknown docx
... a man—that's the harbor-master Ask any quarryman at Port -of- Waves what it is that comes purring around their boats at the wharf and unties painters and changes the mooring of every cat-boat in ... who had doubted; that my chief, Professor Farrago, had sent me against my will, and that I was 19 ready and glad to admit that he, Mr Halyard, was a benefactor of the human race "Bosh!" he said ... at night! Ask Francis Lee what it was he saw running and leaping up and down the shoal at sunset last Friday! Ask anybody along the coast what sort of a thing moves about the cliffs like a man...
Ngày tải lên: 17/02/2014, 09:20
Tài liệu In Search of Burningbush docx
... have ended up in national politics He was what campaign consultants might call enormously “electable.” Tall and blue-eyed, David was handsome in a nonthreatening all-American WASP way, kind and ... to have a friend 29 30 IN SEARCH OF BURNINGBUSH Human beings are social animals, and, therefore, like dogs and sea bass, inclined to gather in groups Yet how many of us have at one time or another ... birdbathlike indentations off the green “fairways,” usually containing an inch or two of brownish rainwater But we always thought guys like Kevin had an unfair advantage: they had their own putters! Kevin,...
Ngày tải lên: 22/02/2014, 08:20
To Cut or Not to Cut? That is the (Central Bank’s) Question In Search of the Neutral Interest Rate in Latin America pdf
... data was interpolated Data was seasonally adjusted using an X-12 ARIMA seasonal adjustment Public Debt 2012 April WEO Yearly actual and projected data was interpolated Data was seasonally adjusted ... torical data 12-m onth ahead inflation expectations 2012 April WEO Data was interpolated by obtaining the 12-month ahead inflation projection of the corres ponding year Inflation target National Authorities ... PRY: National Authorities COL, MEX for M0: International Financial Statis tics International res erves International Financial Statis tics Exchange rate International Financial Statis tics Real...
Ngày tải lên: 15/03/2014, 14:20
In Search of Best Practice in South African Desegregated Schools ppt
... Nita Annelize was a white, Afrikaans-speaking female in her thirties, a qualified teacher who had completed a Masters degree in education Nita was an Indian, English-speaking female in her late ... change to happen in this regard This also relates to change in the mindsets of people about the culture of learning and teaching in former African schools and the training of African teachers at ... the national flag and the coat of arms Exhibiting the national anthem in several languages also indicated to the class that different languages were acceptable in this classroom Annelize adopted...
Ngày tải lên: 16/03/2014, 10:20
2013 Private Equity Fund Outlook In search of firm footing pptx
... compliance and optimization strategies are also attracting attention in the industry as private equity managers prepare for potential tax changes, including the expiration of Bush-era tax cuts, an ... Managing regulatory, compliance, and tax uncertainties Private equity funds are facing intense scrutiny over regulatory, compliance, and tax issues as LPs and regulators take a closer look at ... such as separate account mandates and co-investment strategies In short, GPs will have to rethink their business and operating models in 2013 in the following ways: • Managing regulatory, compliance,...
Ngày tải lên: 23/03/2014, 08:21
Báo cáo khoa học: Expression in yeast of a novel phospholipase A1 cDNA from Arabidopsis thaliana docx
... TATATAGGTACCTTATGCATCAACAGAGACACTTAC ATATATGGATCCATGGGCTGGATTCCGTGTCCGTGCTGGGGAACC AACGACGATGAAAACGCCGGCGAGGTGGCGGATCGTGATCCGGTG CTTCTAGTATCTGGAATTGGAGGCTCTATTCTGCATTCTAAGAAGA AGAATTCAAAGTCTGAAATTCGGGTTTG ... AGAATTCAAAGTCTGAAATTCGGGTTTG TATATAGGTACCTTAACCAGAATCAACTACTTTGTG ATATATGGATCCATGGGCTGGATTCCGTGTC TATATAGGTACCTTACTTGTCATCGTCGTCCTTGTAGTCACCAGA ATCAACTACTTTGTGAG TCCATGATATGATTGATATGC GTGGCAATGGTAATCCAC Site-directed ... mutagenesis GCGTAGGAGTTTCGGGTAGCCTCCGCGGGCTTCTCCGTGATGAAAG GGAGTGTCCTTCTATAACATATTTGGAGTGTCACTTAATACACC GTCACTATCATCTCCCATGCAATGGGAGGACTTATGGTTTC CATATGTAGATGGAGCTGGAACTGTCCCTG GGAGTGTCACTTAATGCACCCTTTGATGTTTG...
Ngày tải lên: 30/03/2014, 15:20
The Causes of Inner-City Poverty: Eight Hypotheses in Search of Reality pptx
... such as affirmative action, that create a backlash against minorities Although discrimination appears in many different forums, from the labor market to the housing and financial markets and the ... inner-city populations are disadvantaged in the labor market because of a human capital deficit and (2) the role of that deficit (as opposed to other factors, such as discrimination) in maintaining poverty, ... centers that increasingly looked to a combination of electronics and information as their stock in trade But also taking place were profound changes in the nature of manufacturing; these changes...
Ngày tải lên: 02/04/2014, 08:20
travels with charley[ressource électronique] in search of america
... complex of an area I had to go alone and I had to be self-contained, a kind of casual turtle carrying his house on his back With all this in mind I wrote to the head of ce of a great corporation ... The Log from the Sea of Cortez Once There Was a War Travels with Charley in Search of America America and Americans Journal of a Novel: The East of Eden Letters Plays Of Mice and Men The Moon Is ... Joseph Addison I hear and I will obey within Reason, for it appears that the Curiosity you speak of has in no Way abated I have found many Readers more interested in what I wear than in what I think,...
Ngày tải lên: 31/05/2014, 01:35
in search of dark-matter
... further away it is For example, imagine three galaxies equally separated along a line and all moving away from each other at the same rate Now imagine us living in a galaxy at one end of the line ... In Search of Dark Matter Ken Freeman and Geoff McNamara In Search of Dark Matter Published in association with Praxis Publishing Chichester, UK Professor Ken Freeman Research School of Astronomy ... galaxies themselves At the Galactic scale, Jeans' equations relate the density of stars at a point in the Milky Way (that is, the amount of matter in a given volume of space) to the average and...
Ngày tải lên: 05/06/2014, 11:20
báo cáo hóa học:" Reinterpretation of evidence advanced for neo-oogenesis in mammals, in terms of a finite oocyte reserve" pdf
... revisiting underlying assumptions and providing alternative explanations (summarised in Table 1) for observations advanced - Page of 20 and maintained - as key by advocates of the hypothesis, adding ... mouse models that the paracrine c-kit/SCF signaling pathway is crucial for activation of primordial follicles, oocyte survival and growth, and maintenance of meiotic arrest in small antral follicles ... erythroid lineage, and endothelial and vascular smooth muscle progenitors; and the para-aortic splanchnopleura, for lymphoid Notarianni Journal of Ovarian Research 2011, 4:1 http://www.ovarianresearch.com/content/4/1/1...
Ngày tải lên: 20/06/2014, 07:20
Báo cáo hóa học: " Fano-Rashba effect in thermoelectricity of a double quantum dot molecular junction" pptx
... Breit-Wigner peak centered at the bonding molecular state and an asymmetrical Fano line shape centered at the antibonding molecular state The degree of the asymmetry of the Fano-Like peak can be attributed ... molecular junction can be realized by using a twodimensional electron gas below the surface of an AlGaAs/GaAs heterostructure [1] The RSOI in the QD can be introduced by using an asymmetrical-interface ... Spin-polarized current and spin accumulation in a three-terminal two quantum dots ring Appl Phys Lett 2008, 92:172104-172106 41 Uchida K, Takahashi S, Harii K, Ieda J, Koshibae W, Ando K, Maekawa...
Ngày tải lên: 20/06/2014, 23:20
Báo cáo hóa học: " The Influence of a Continuum Background on Carrier Relaxation in InAs/InGaAs Quantum Dot" ppt
... dependence of the decay time obtained by fitting the PL decay profile to a single exponential function With increasing temperature from 80 K to 170 K, a linear increase of the radiative decay time occurs ... the QD transition energies in our samples Conclusion In conclusion, we have measured the rise and decay dynamics of the ground and first excited state of InAs QDs capped with an InGaAs quantum well ... have found that the higher energy states of the QDs don’t act as intermediate stages in the carrier relaxation, while the carriers can cool down to any lower energy states following a relaxation...
Ngày tải lên: 22/06/2014, 18:20
.NET Framework Solutions—In Search of the Lost Win32 API doc
... safearray size, array and safearray subtype, cookies, and a custom marshaler Using a custom marshaler means that you can theoretically transform any managed type into an unmanaged equivalent in ... treatment within a managed application Even a data structure, which is essentially a collection of variables and pointers, requires special handling because of the way that managed applications ... write a conversion routine in the wrapper DLL Placement of certain variable types is also easier in Visual Basic Enumerations and data structures always appear at the same level as the class using...
Ngày tải lên: 27/06/2014, 12:20