... StGWD and AtAMY3 and separated by a linker of approximately 200 and 50 amino acids, respectively (Fig 1A) The alignment of all identified CBM45s revealed that each contains five aromatic amino acids ... from apicomplexan parasites (Doc S1) A common characteristic of these organisms is the presence of starch or starchlike crystalline polysaccharides The starch synthesis ability of the apicomplexan ... phosphatase binds to starch diurnally and functions in its accumulation Proc Natl Acad Sci USA 103, 9732–9737 Wayllace NZ, Valdez HA, Ugalde RA, Busi MV & Gomez-Casati DF (2010) The starch-binding...
Ngày tải lên: 06/03/2014, 00:21
... C 466 are met 3.102.3 Cubicle switchgear and controlgear Metal-enclosed switchgear and controlgear, other than switchgear and controlgear COPYRIGHT 2002; International Electrotechnical Commission ... be taken into account for busbarsare those specified forcontacts, connections and' metal partsincontact with insulation, as the case may be The temperaturerise for accessible enclosures and covers ... controlgear (with - cubicle switchgear and controlgear one or more non-metal1ic.partition.s); 3.102.1 Metal-clad switchgear and controlgear Metal-enclosed switchgear and controlgear inwhich components...
Ngày tải lên: 25/12/2013, 10:57
Tài liệu Báo cáo khoa học: Verprolin function in endocytosis and actin organization Roles of the Las17p (yeast WASP)-binding domain and a novel C-terminal actin-binding domain doc
... 4118 Arp2 ⁄ complex De novo actin filament assembly is critical for actin-patch formation at polarized cortical sites [29] Because cortical actin patches are short-lived structures, continual actin-patch ... polyclonal GFP-speci c antiserum was a gift from J Kahana and P Silver (Dana Farber Cancer Center, Boston, MA) The anti-actin mAb was MAB1501 from Chemicon International (Temecula, CA) The anti-hexokinase ... C- Vrp1p364)817 charged-cluster residues K485R486 are essential for cortical actin-patch polarization Cortical actin-patch polarization in vrp1D (AMY88) cells carrying YCplac111 vector (vect), pAM236 expressing...
Ngày tải lên: 18/02/2014, 16:20
Tài liệu Báo cáo Y học: Enhancement by a-tocopheryl hemisuccinate of nitric oxide production induced by lypopolysaccharide and interferon-c through the upregulation of protein kinase C in rat vascular smooth muscle cells docx
... oxygens and free radicals did not participate in the TS effect, and that the inhibitory effect of a- T was mediated by a nonantioxidative reaction a- T was reported to decrease PKCa activity due to activation ... nitrite as a standard Western blotting of inducible NO synthase Fig Structures of a- tocopherol (a- T) and T derivatives a- tocopheryl hemisuccinate (TS), a- tocopheryl acetate (TA) and a- tocopheryl nicotinate ... (1999) a- Tocopheryl succinate-induced apoptosis in Jurkat T cells involves caspase-3 activation, and both lysosomal and mitochondrial destabilization FEBS Lett 445, 295–300 12 Yamamoto, S., Tamai,...
Ngày tải lên: 22/02/2014, 04:20
Ground Water Pollution and Emerging Environmental Challenges of Industrial Effluent Irrigation: A Case Study of Mettupalayam Taluk, Tamilnadu pptx
... the problem Characteristics of rainfall, and groundwater recharge capacity play crucial role for pollutant transport and concentration in the groundwater Awareness and Public Participation There ... groundwater quality data from Tamilnadu Water Supply and Drainage (TWAD) Board, Central Ground Water Board and State Ground and Surface Water Resources Data Centre, Public Works Department for analysis ... 90 percent of total cultivated area) and crops are mostly salt tolerant and plantation crops Traditional crops like paddy and cereals are virtually absent and mostly cash crops are cultivated...
Ngày tải lên: 06/03/2014, 15:21
Business water footprint accounting: A tool to assess how production of goods and services impacts on freshwater resources worldwide pdf
... Morocco and the Netherlands A. Y Hoekstra and A. K Chapagain – July 2006 22 Water s vulnerable value in Africa P van der Zaag – July 2006 23 Human appropriation of natural capital: Comparing ecological ... 186-203 CEO Water Mandate (2007) The CEO Water Mandate: An initiative by business leaders in partnership with the international community, UN Global Compact www.unglobalcompact.org Coca-Cola Company ... in water scarce areas now? And (vi) How many will be in 2025? The Global Water Tool calculates water withdrawal from fresh and non-freshwater sources (m3/year), fresh and non-freshwater discharge...
Ngày tải lên: 06/03/2014, 21:20
The Project Gutenberg EBook of The Car of Destiny by C. N. Williamson and A. M. Williamson pot
... without making myself ridiculous by a foreign accent As for my brown face and black eyes, many a Cornishman has a face as brown and eyes as black; therefore, I edited the name of Triana into Cornish ... sits always in the tonneau, had already heard all about the King's automobile, and was primed with particulars He leaned across to describe its appearance, as well as mention the make; and when ... and went alone, rather than drag Dick into an affair which might end disagreeably I did not put myself forward, but stood for a while and watched the dancers, waiting for my chance Carmona had...
Ngày tải lên: 07/03/2014, 11:20
Báo cáo khoa học: Relation between domain evolution, specificity, and taxonomy of the a-amylase family members containing a C-terminal starch-binding domain pot
... Psesa Psest Psesp Bacst Actsp Bac11 Bac17 Bac38 Bac663 Bac1011 BacA2 Bac1018 BacE1 BacKC Bacbr Bacci8 Bacci251 BacciA Baccl Bacli BacmaIB7 BacIFO Bacoh Bacst1 Bacst2 Klepn Nossp Thbsp Thbth Thcsp ... Reference withdrawn Takada, M., Nakagawa, Y & Yamamoto, M (2003) Biochemical and genetic analyses of a novel c- cyclodextrin glucanotransferase from an alkalophilic Bacillus clarkii 7364 J Biochem ... pneumoniae CGT Nostoc sp PCC 9229 CGT Thermococcus sp B1001 CGT Actinoplanes sp SE50 ACT Bacillus stearothermophilus MAA Aspergillus kawachii AAM Bacillus sp TS-23 AAM Streptomyces griseus AAM Pseudomonas...
Ngày tải lên: 08/03/2014, 08:20
Báo cáo Y học: A novel DNA repair enzyme containing RNA recognition, G-patch and specific splicing factor 45-like motifs in the protozoan parasite Toxoplasma gondii potx
... 5¢-ATGAGAG AGGTTATCAGCATC-3¢ and 5¢-TTAGTACTCGTCAC CATAGCC-3¢; for TgDRE, 34S13 sens: 5¢-ATGCTGGA CTCTCTCTACGGGGAT-3¢ and 34AS15 antisens: 5¢-TT AGTCGAGGGGTTTGTCTGC-3¢ PCR products were electrophoresed ... 5¢-CTTCACCTGGAGGAGATTTCC AAA-3¢ for 5¢ RACE and N34S 5¢-GGGAGGGTC TCGGCGTCAACAAAC-3¢ for 3¢ RACE Nested PCR was performed using internal oligonucleotides S10 5¢-GT CGAGATGTTGGTTGTCGGAGACC-3¢ for 5¢ RACE and ... sequencing To obtain full-length cDNAs, a RACE-PCR technique was performed using a Marathon cDNA Amplification Kit (Clontech) with the adaptor primer and speci c oligonucleotides N34AS 5¢-CTTCACCTGGAGGAGATTTCC...
Ngày tải lên: 08/03/2014, 22:20
Báo cáo " Community based coastal resources management behind changes in surface water environment and land policy: A case study in the Tam Giang Lagoon, Central Vietnam " ppt
... manage natural resources, because the relevant terms and concepts originate from geographical contexts, historical circumstances, and the specific culture of each country In the case of coastal ... international standards [6, p.20] According to American standard, total nitrogen (TN) applied to coastal water (TN < 0.9 mg/l), Chinese standard to fish culture (TN < 0.5 – 1.0 mg/l) and Japanese standard ... standards applied for coastal ecosystem conservation and aquaculture Moreover, average concentration of total coliform in the lagoon water exceeded the permitted level of Vietnam standard of water...
Ngày tải lên: 14/03/2014, 15:20
Báo cáo khoa học: Biochemical properties of the human guanylate binding protein 5 and a tumor-specific truncated splice variant Mark Wehner and Christian Herrmann doc
... hGBP1 and other large GTPases, we analysed the enzymatic activity of hGBP 5a ⁄ b and hGBP5ta in a concentration-dependent manner Various concentrations of purified hGBP 5a ⁄ b and hGBP5ta were incubated ... reflecting larger structural changes accompanying nucleotide binding The rate constants for nucleotide association and dissociation are both much smaller for hGBP5 compared to hGBP1, reflecting a ... showed an antiviral effect against speci c viruses [10,11], and an anti-Chlamydia effect [12], inhibition of endothelial cell proliferation [13] and their subcellular localization [14] have also...
Ngày tải lên: 15/03/2014, 10:20
How do China and Brazil deal with water pollution challenges? A comparative perspective of two emerging countries’ approach to water pollution problems docx
... 2006) Water availability is crucial for economic growth and human wellbeing; however, mismanaged economic activities have a profound negative impact on water availability and quality When water ... articles and reports available online Data from books, journals, articles, and reports are accordingly cited and quoted All the material has been selected according to content and relevance to ... policy enforcement is harder to control since bureaucratic agencies have greater power Fragmented coordination and bureaucratic competition in China and Brazil is to a great extent a common cause for...
Ngày tải lên: 15/03/2014, 16:20
Báo cáo khoa học: The proximity between C-termini of dimeric vacuolar H+-pyrophosphatase determined using atomic force microscopy and a gold nanoparticle technique ppt
... was cloned into the yeast expression vector pYES2 (Invitrogen, Carlsbad, CA, USA), 4390 and the two synthesized oligonucleotides Phis (5Â-CCTCG AGCCATCATCATCATCATCATTAGGGCCGCATCAT GTAATTAGTTATGT-3Â) ... (Digital Instruments, Santa Barbara, CA, USA) and a Picoplus instrument (Molecular Imaging, MI, USA) Muscovite mica (Electron Microscopy Sciences, Hateld, PA, USA) was freshly cleaved and immediately ... electrotransblotting apparatus (Nova Blot, Amersham Pharmacia Biotech, Piscataway, NJ, USA) The blots were incubated with the rabbit polyclonal antibody raised against the MAP (Mitogen-activated...
Ngày tải lên: 16/03/2014, 02:20
Báo cáo khoa học: Ternary complex formation of pVHL, elongin B and elongin C visualized in living cells by a fluorescence resonance energy transfer–fluorescence lifetime imaging microscopy technique docx
... oligonucleotides 5¢-CTAGACCA CCATGGAGGAACAGAAGCTGATCAGTGAGGAAG ACCTGGATATCCCGGGTTAACT-3¢ and 5¢-CTAGAG TTAACCCGGGATATCCAGGTCTTCCTCACTGATCA GCTTCTGTTCCTCCATGGTGGT-3¢, and 5¢-CTAGAC CACCATGGACTACAAAGACGATGACGATAAAGAT ... CAATCTCCCATCCGTTGATGTG-3¢, and pcerulean-N1 pBOS-HA was constructed by insertion of the annealed fragment of the synthesized oligonucleotides, 5¢-CTAGAC CACCATGTACCCCTACGACGTGCCCGACTACGCCG ATATCCCGGGTTAACT-3¢ ... was changed to GGA by using primers 5¢-CCCAAGC TTATGGATGGAGGAGGAGAAAAC-3¢ and 5¢-ACGT ACCGGTCCACAATCTAGGAAGTTTGCAGC-3¢ After digestion of the PCR fragment by EcoRI and AgeI, the fragment was inserted...
Ngày tải lên: 16/03/2014, 05:20
Báo cáo khoa học: Structure and potential C-terminal dimerization of a recombinant mutant of surfactant-associated protein C in chloroform/methanol ppt
... Ha and side chain protons The spin systems of Lys10 and Arg11 are indicated by rectangles as both contain a second HN in the side chain The N-terminal Gly1 appears as a weak and very broad peak ... light-scattering and CD experiments reveal the existence of an a- helical dimer at acidic pH ([25]; A Seidl, G Maccarone, N Youhnovski, K P Schaefer and M Przybylski, unpublished data) CNBr cleavage ... broad peak All Ha chemical shifts of residues 5–31 show an upfield shift compared with random-coil data indicating an a- helical structure in an empirical pattern-recognition approach [13,16] (B)...
Ngày tải lên: 16/03/2014, 16:20
Báo cáo khoa học: Cleavage site analysis of a serralysin-like protease, PrtA, from an insect pathogen Photorhabdus luminescens and development of a highly sensitive and specific substrate pdf
... Pa1 Pa2 Pa3 Pa4 Pa5 Pa6 Pa7 Pa8 Pa9 Pa10 Pa11 Pa12 Ac-EVYLVE-NH2 Ac-EVYLLE-NH2 Ac-EVYLAE-NH2 Ac-EVYAVE-NH2 Ac-EVYALE-NH2 Ac-EVYAAE-NH2 Ac-ELYLVE-NH2 Ac-ELYAVE-NH2 Ac-ELYLLE-NH2 Ac-ELYLAE-NH2 Ac-ELYALE-NH2 ... of cleavage sites (vertical arrows, a1 a3 ) and cleavage fragments (horizontal double arrows, A1 A5 ) in the sequence of insulin chain A (B) Change over time in the chromatographic peak area of cleavage ... selectively measure activity in biological samples Here we describe the development of such a substrate based on analysis of PrtA cleavage site specificity, and kinetic characterization of PrtA activity...
Ngày tải lên: 23/03/2014, 09:20
Báo cáo khoa học: HIP/PAP, a C-type lectin overexpressed in hepatocellular carcinoma, binds the RIIa regulatory subunit of cAMP-dependent protein kinase and alters the cAMP-dependent protein kinase signalling ppt
... heart PKA The sense primer (5¢-GTCGAATTCCAAGGTG AAGAACCCCAG-3¢) was located at nucleotides 63–90 of the coding sequence, and the antisense primer (5¢-TG CTGAATTCCCTCCCTCCTGCACTAGTCAG-3¢) overlapped ... fractionated between soluble and particulate fractions as described [21] Sarco/endoplasmic reticulum Ca2+ATPase (SERCA 2), an integral protein of the endoplasmic reticulum [22], calreticulin, a ... Demaugre et al (Eur J Biochem 271) anti-HIP/PAP, anti-RIIa and anti-Ca (Transduction Laboratories, Lexington, KY, USA), anti-(SERCA 2) (clone IID8; Tebu, Paris, France) and anti-calreticulin (ABR...
Ngày tải lên: 23/03/2014, 13:20
Báo cáo Y học: Structural and functional characterization of a C-type lectin-like antifreeze protein from rainbow smelt (Osmerus mordax) potx
... the AFP has a separate undiscovered activity in smelt plasma, in which the N-linked oligosaccharide and dimeric character play more central roles Smelt AFP has been characterized in terms of Ca2+ ... function as an AFP as well as its relationship to other CTLDs MATERIALS AND METHODS Materials N-Glycosidase F and endoproteinase Glu -C were obtained from Roche Molecular Biochemicals (Laval, Canada) ... presence of CaCl2 (C) Intact AFP in the presence of EDTA Positions of dimers (D) and monomers (M) and the molecular-mass marker sizes (kDa) are indicated 1224 J C Achenbach and K V Ewart (Eur...
Ngày tải lên: 24/03/2014, 03:21
Báo cáo khoa học: MicroRNA-23b mediates urokinase and c-met downmodulation and a decreased migration of human hepatocellular carcinoma cells doc
... cell extracts from control cells (lanes 1, 2, 4, and 5) and transfected cells (lanes and 6) at 48 and 72 h after transfection results showed a greater decrease in luciferase activity as compared ... hours and 72 h after transfection, total RNA isolations from control cells (lanes 1, 2, 4, and 5) and transfected cells (lanes and 6) were examined by RT-PCR to detect uPA mRNA (A) and c- met mRNA ... using RNU66 as an internal control RT-PCR analysis (Agilent) and real-time PCR Total RNA of transfected and nontransfected cells was extracted with Trizol reagent according to the manufacturer’s...
Ngày tải lên: 29/03/2014, 23:20
Báo cáo khoa học: Disorder–order transition of k CII promoted by low concentrations of guanidine hydrochloride suggests a stable core and a flexible C-terminus doc
... http://www.nov agen.com/SharedImages/TechnicalLiterature/7_tb055.pdf Datta, A. B., Chakrabarti, P., Subramanya, H.S & Parrack, P (2001) Purification and crystallization of CII: an unstable transcription activator ... that is characteristic of aromatic residues Therefore it is apparent that below M, GdnHCl caused a conformational change in the CII protein with little change in tertiary interactions of the aromatic ... (1998) The Escherichia coli RNA polymerase alpha subunit and transcriptional activation by bacteriophage lambda CII protein Acta Biochim Pol 45, 271–280 Kobiler, O., Koby, S., Teff, D., Court, D &...
Ngày tải lên: 30/03/2014, 20:20