a visual monitoring tool with history

... of randomization) and daily through to study day A central laboratory (Covance Central Laboratory Services, Indianapolis, IN, USA) performed all assays The PC activity assay was performed on a ... STA® coagulation analyzer using the STA®- Staclot® Protein S kit (Diagnostica Stago) Antithrombin III activity was quantitated using a chromogenic activity assay (Stachrome ATIII; Diagnostica ... they had a baseline PC measure Day PC was classified as end of infusion If day measurement was not available, last observation carried forward values were used for classification These data were...

Ngày tải lên: 13/08/2014, 08:21

... validator can also choose whether to add a virtual annotator aSSI to the set of annotators A This virtual annotator tags each word w ∈ σ with the sense chosen by the application of the SSI algorithm ... 30(2) Acknowledgments Roberto Navigli and Paola Velardi 2005 Structural semantic interconnections: a knowledge-based approach to word sense disambiguation IEEE Transactions on Pattern Analysis and ... of a sense choice, marked in orange based on the validation policy, is just a proposal and can freely modified by the validator, as explained hereafter Before starting the interface, the validator...

Ngày tải lên: 31/03/2014, 01:20

... RNA extraction ELISA and Elispot assays Antibody response to HBs Ag was evaluated by ELISA assays (Architect System, Abbott, Sligo, Ireland) in sera from naïve or vaccinated donors Page of (page ... 163:6867-6875 Kammula US, Marincola FM, Rosenberg SA: Real-time quantitative polymerase chain reaction assessment of immune reactivity in melanoma patients after tumor peptide vaccination J Natl Cancer ... or absence of a commercial vaccine preparation (see "materials and methods") diluted to a final concentration of influenza hemagglutinin of 0.6 μg/ml Total cellular RNA was then extracted and...

Ngày tải lên: 18/06/2014, 15:20

... varenicline, without consulting his physician, and the hallucinations reduced, and resolved over a A 61-year-old Caucasian male army veteran had been treated as an outpatient for the last years ... W, Carnahan R: Hypomania with agitation associated with varenicline use in bipolar II disorder Ann Pharmacother 2008, 42:288 Jorenby DE, Taylor Hays J, Rigotti NA, Azoulay S, Watsky EJ, Williams ... dependence, and attempts should be made at smoking cessation Treatment should include behavioral and pharmacological strategies as necessary Although patients with psychiatric illness have used varenicline...

Ngày tải lên: 11/08/2014, 14:20

... 67-year-old diabetic and hypertensive Arab woman in February 2006, due to severe hematuria and fever In January 2005, the woman had already been treated in a hospital of Great Britain for repeated ... significant markers in this case, in accordance with the results of Desai and Banerjee et al [8,9] Patients in some cases already had metastases at the time of diagnosis and this suggested a poor ... urinary bladder (another site than described for the squamous cell carcinoma) As an initial attempt at transurethral resection (TUR) resulted in perforation, a partial bladder resection was performed...

Ngày tải lên: 11/08/2014, 17:21

... optimal detection of changes with an acceptable false alarm rate, and they can be difficult to explain to managers, clinicians and non-statisticians The purpose of this paper is to evaluate a simple ... chart and comment on how this local approach complements the central collation and reporting paradigm of outcome monitoring from a national, centralised database Materials and methods All patient ... study and for data acquisition and verification of the data All authors read and approved the final manuscript Additional files 11 12 13 14 15 16 17 18 19 20 The following Additional files are available...

Ngày tải lên: 12/08/2014, 23:21

... Yamaguchi H, Sasaki K, Satomi Y, Shimbara T, Kageyama H, Mondal MS, Toshinai K, Date Y, Gonzalez LJ, Shioda S, Takao T, Nakazato M, Minamino N Peptidomic identification and biological validation of ... Cruz Biotech, CA) The assay was developed using a stabilized HRP substrate All samples were analyzed in the linear range of the ELISA using over-expressed human Vgf as a standard Assessment of ... Lange DJ, Voustianiouk A, Macgrogan D, Ho L, Suh J, Humala N, Thiyagarajan M, Wang J, Pasinetti GM A ketogenic diet as a potential novel therapeutic intervention in amyotrophic lateral sclerosis...

Ngày tải lên: 03/11/2012, 10:52

... et al., 200 7a) , water was taken from a municipal water filtering plant (Miyoshi, Hiroshima, Japan) prior to being treated for use as tap water The coliform bacteria and total bacterial counts in ... SC-CO2 treatment, whereas phosphatase (alkaline and acid) or naphthol-AS-BI-phosphohydrolase was slightly or a little inactivated Ishikawa et al (1996) reported that enzyme inactivation by the ... method J Agric Food Chem., 44, 2646-2649 Japan Water Works Association (JWWA) (2001) The method of Japan Water Works Association p.573-613 (in Japanese) Kobayashi, F., Hayata, Y., Kohara, K., Muto,...

Ngày tải lên: 05/09/2013, 09:38

... supplement in animal feed, if the toxins are removed [23] Since India has a large waste land area suitable for Jatropha cultivation, it can supply large volume of biodiesel, in fact, nearly half a dozen ... plant shows articulated growth, with a morphological discontinuity at each increment [20] Figure shows Jatropha plant in Energy park of Rajiv Gandhi Proudyogiki Vishwavidyalaya (R.G.P.V.) Jatropha ... Cape Verde was used for soap production and for lamps Jatropha is a small tree or large shrub, which can reach a height of three to five meters, but under favorable conditions it can attain a...

Ngày tải lên: 05/09/2013, 16:11

... Name Material Make sure you hit Enter twice to finish entering text in particular cell The table should appear as shown below Create the Repeat Region Repeat Regions automatically add text and ... rpt.qty asm.mbr.name asm.mbr.User Defined, then type in material at Enter symbol text prompt Note that the parameter material is created in each part in Part mode 18 Create the BOM From the TABLE ... text, and move it to desired location Save the drawing 10 CREATE A DRAWING FOR ROLLER LINK WITH BOM The Sheets command in the DRAWING menu can be used to create multiple sheets drawings To Add a...

Ngày tải lên: 22/12/2013, 11:17

... Was Pressed Sub SetData(ByVal strFilterLetter As String) Dim odaSearch As OleDb.OleDbDataAdapter Dim dtSearch As DataTable = New DataTable() odaSearch = New _ OleDb.OleDbDataAdapter("Select " & ... on a Letter Name btnA Caption A Name btnB Caption B Name btnC Button Button Button Caption C Name btnZ Caption Z Name btnAll Caption All DataGrid Name dgSearch Button Name btnAccept Caption &Accept ... Caption Company Name Label Caption Contact Label Caption Contact Title Label Caption Address Label Caption City Label Caption Region Label Caption Country Label Caption Phone Label Caption Fax...

Ngày tải lên: 26/01/2014, 11:20

... of a three-stranded antiparallel b-sheet and an a- helix, packed approximately parallel to the b-sheet, with the seven thoroughly conserved amino acids (Arg6, Arg8, Trp10, Glu16, Arg18, Arg26 and ... performed as described previously [9] Selection of the DNA-binding site A 60 bp single-stranded DNA RDM10, with 10 randomized oligonucleotides in the center, i.e CTGTCAGTGAT GCATATGAACGAATN10AATCAACGACATTAGGATC ... China (grant no 2007AA10Z110) References Okamuro JK, Caster B, Villarroel R, Van Montagu M & Jofuku KD (1997) The AP2 domain of APETALA2 defines a large new family of DNA binding proteins in Arabidopsis...

Ngày tải lên: 18/02/2014, 13:20

... GATGCCTTCCAATGAATTAC GAACCAATGAAATAAGGGCG GGGGATCCGTCGACCTGCAGCGTACGAGGAAAGGAAATAGGC GTTTAAACGAGCTCGAATTCATCGATCCGTCAACGACAGTTG GCATCAGAAAGCATAGGC TGGGAATACGATAGAGTAG GTTTAAACGAGCTCGAATTC Gene ... CCGTCGACCAAGCTTATGTTTCCTTATTTTTACAGACG CCCCCGGGGCCACTTTCTGGTG GTACAAGCTTGTAAATTTTCGATGG CATAGAATTCTTGGTAATC AAAGTCGACATGTTGTCACGTAGACAG CAAGCAGGTGAATTAGGC GGGGATCCGTCGACCTGCAGCGTACGAAAATCGTTTACACATC GTTTAAACGAGCTCGAATTCATCGATGCTAGTCCTTTATG ... GTTTAAACGAGCTCGAATTCATCGATGCTAGTCCTTTATG CAGGCAAGTCTGTTTATTG CTTGGATGAGCTTTCCAC CGTATAAATTACAATACCG GGGGATCCGTCGACCTGCAGCGTACGACATACTACTTCATTTG GTTTAAACGAGCTCGAATTCATCGATCCTAGCGTTACCGTTG GTATGCGATGTGGAATTTG GATGCCTTCCAATGAATTAC...

Ngày tải lên: 18/02/2014, 14:20

... TCATCAT-3¢; rOMM-64-IV, 5¢-CGCGGATCCGCCCCT GTTAATGATGGAACC-3¢ and 5¢-CGCCTCGAGCTAA GAAGACTGGGCTGCCAG-3¢; rOMM-64-V, 5¢-CGCGG ATCCAGGCAAGATTTTAAGCATCCA-3¢ and 5¢-CGCC TCCACCTAAGAGGCATCCTTGTCCAC-3¢; ... 5¢-CGCCTCCA CCTAAGAGGCATCCTTGTCCAC-3¢; rOMM-64-II, 5¢CGCGGATCCACCGTAGACACTTATGATATA-3¢ and 5¢-CGCCTCGAGCTAAGAGTCAGCTTGCACGTC-3¢; rOMM-64-III, 5¢-CGCGGATCCGCTGATGTGACCAGT GATGAC-3¢ and 5¢-CGCCTCGAGCTATTTGGGCTCTT ... DNA contamination in the total RNA was confirmed by lack of amplification of a b-actin mRNA fragment by PCR using a pair of primers (5¢-ATCACCATCGGCAACGAGAG-3¢ and 5¢-TGGAGTTGTAGGTGGTCTCGTG-3¢) without...

Ngày tải lên: 18/02/2014, 17:20

... combined with a NotI and a SmaI site was ligated to both ends of the cDNA pool Using a combination of a primer complementary to the adapter (adapter primer: 5¢-CCATCCTAATACGACTCACTA TAGGGC-3¢) and a ... and precipitated using EtOH and sodium acetate After extensive washing the DNA was redissolved in Tris/EDTA, pH 8.0 and separated on a · Tris/borate/EDTA, 0.9% agarose gel After capillary transfer ... tissues After digestion of the reaction mixture with RNAse A/ H protected fragments were separated by PAGE and visualized by autoradiography RACE The cDNA for CYP11B2 of the guinea pig was amplified and...

Ngày tải lên: 22/02/2014, 07:20

... Conjeveram probably Chidambaram; the author’s sources seem to have had trouble with “l” in South Indian names Kanchipuram Futtehpore Sikhri Fatehpur Sikri Hullabid Halebid Jaunpore Janpur Jugganat ... guarantee Essential historical and biographical facts, together with brief critical estimates and characterizations of leading schools and painters, are given in a few well-chosen words; and for students ... the name of the deity is Jagannath; the English name-form led to the word “juggernaut” Kantonnuggur Kantanagar the author seems not to have realized that this is the same place as Oudeypore Udaipur,...

Ngày tải lên: 05/03/2014, 14:20

... GUINEA  THE NATIONAL AUSTRALASIAN CONVENTION 1891  THE COMMONWEALTH OF AUSTRALIA  THE BOER WAR  THE GREAT WAR  LANDING ON GALLIPOLI  WHAT ANZAC MEANS MAP OF AUSTRALIA A SOURCE BOOK OF AUSTRALIAN ... but I am certain that it joins neither to Asia, Africa nor America This part of it that we saw is all low even land, with sandy banks against the sea, only the points are rocky, and so are some ... Zeehaen, subcargo Abraham Cooman and our master carpenter Pieter Jacobz; we carried with us a pole with the Company's mark carved into it, and a Prince flag to be set up there that those who shall...

Ngày tải lên: 06/03/2014, 03:21

... TVP-VAR (General) TVP-VAR (Standard) TVP-VAR (Homoscedastic) TVP-FAVAR TVP-FAVAR (Homoscedastic) FAVAR UC TVAR (GDP) TVAR (Inflation) TVAR (Rate) ST-VAR (GDP) ST-VAR (Inflation) ST-VAR (Rate) VAR ... constant degree of parameter drift TVP-VAR (Homoscedastic) Time-varying VAR with constant variance-covariance matrix of the VAR residuals TVP-FAVAR Time-varying factor augmented VAR model TVP-FAVAR ... models that incorporate a gradual change in parameters and also include a large set of explanatory variables particularly well as far as the inflation forecast is concerned recording gains (over...

Ngày tải lên: 06/03/2014, 14:20

... Biosciences, Columbia, MD, USA) with sense primer SOE-3 (5¢-AAAAATCA ACGCTGAACAATGGTGAGCAAAGGGCGAG-3¢) and antisense primer SOE-4 (5¢-GAATGCGGCCGCTTACT TGTAACAGCTCGTCCATG-3¢), which introduced a NotI site ... (GenBank accession number X52869) was amplified from pZEOSV (Invitrogen, Carlsbad, CA, USA) by PCR using sense primer 5¢-ATCAAAACAACCAAAA TGGCCAAGTTGACCAGTGC-3¢ and antisense primer 5¢-GAATGCGGCCGCTCAGTCCTGCTCCTCGGCCAC-3¢, ... 165-bp fragment of the fcp 5¢-UTR was amplified by PCR from pUC18 ⁄ fcp1.9kb using the sense primer 5¢-GAT CTTTGCTACGTACGAACG-3¢ and the antisense primer 5¢-GCTCTAGAGATATCTAGTCTTTGTGATAAAGAAA ATTATG-3¢...

Ngày tải lên: 07/03/2014, 21:20

... chirata joins the growing list of secondary plant metabolites that are derived from an early shikimate derivative as opposed to a pathway via phenylalanine and cinnamate A hypothetical mechanism ... phosphoenolpyruvate unit by decarboxylation of Cambridge Isotope Laboratories (Andover, MA, USA) [U-13C9]Cinnamic acid was prepared by treatment of 13 L-[U- C9]phenylalanine with phenylalanine ammonia-lyase ... intermediary metabolites such as carbohydrate phosphates, pyruvate, and acetyl-CoA via the major glucose utilization pathways (glycolysis and pentose phosphate cycle) Simultaneously, intermediary metabolites...

Ngày tải lên: 08/03/2014, 02:21