a statement of the second law of thermodynamics is that

... an isolated thermodynamic system ΔS ≥0 , This is a quantitative statement of the second law. We have expressed the second law of thermodynamics by an equation for entropy. and the equality sign ... build a heat engine that converts heat completely to work, that is, an engine with 100% thermal efficiency. This impossibility is the basis of the following statement of The second law of thermodynamics. 2.1 ... The equivalency of two statements of the second law: Two statements my seem to have no relation each to other. But, in fact, they are completely equivalent.  Suppose that we have a refrigerator...

Ngày tải lên: 17/01/2014, 04:20

... formulations there are also many folksy aphorisms that capture aspects of the law. Many are catchphrases for more formal statements. Although loathe to admit it, most of these are used as primary ... a particu- lar physical process (adiabatic expansion), the door is opened to use any natural (irreversible) process as the basis of a second law statement. It also serves as a reminder that the ... degree, all creatures have an innate ‘understanding’ of thermodynamics — as well they should since they are bound by it. Organisms that display thermotaxis, for example, have a somatic familiarity with...

Ngày tải lên: 24/04/2014, 17:14

... (2.2) The comparison hypothesis referred to above is the statement that any two states in the same state space are comparable. In the examples of systems (a) —(f) above, all satisfy the comparison hypothesis. ... that are not adiabatic. He suggested basing thermodynamics on the fact that ‘rubbing’ is an adiabatic process that is not reversible, an idea he already had in his 1879 dissertation. From this ... of equilibrium states and deduce from them the second law as the principle of the increase of entropy. ‘Classical’ means that there is no mention of statistical mechanics here and ‘equilibrium’ means that we...

Ngày tải lên: 24/04/2014, 17:14

... convenience, we adopt the latter viewpoint. Estimating a model of rational scrappage is beyond the scope of the present analysis. Given the available time and data, we therefore assume that the incentives ... the taxi substitution program is enforced. In the Secretariat of Transport and Roadways (SETRAVI, 200 2a) , the program is viewed as voluntary. This means that the decision to scrap an old taxi ... quality issues. A simulation model is a mathematical specification of a system that depicts quantitatively how the system behaves. It is a set of equations, with estimated coefficients and parameters,...

Ngày tải lên: 29/03/2014, 14:20

... constant  PV )( 1 1 )()( 2211221121 VPVPVPVP R C TTnCW V V              1 2 0 ln V V nRTWQ 4/29/2008 2 Chapter XV The First Law of Thermodynamics §1. Heat, work and paths of a thermodynamic process §2. The first law of thermodynamics §3. Kinds of thermodynamic processes §4. Thermodynamic processes ... of heat, work transfer we must define exactly what are the objects under consideration: A thermodynamic system is any collection of objects that is regarded as a unit and that may have the potential ... Calculation of work done during volume changes:  A typical example of a thermodynamic system is an amount of gas enclosed in a cylinder with a movable piston. (Such a system is the central part...

Ngày tải lên: 17/01/2014, 04:20

... TCCGGGACCACTTTTGAATACTTTCAAGTGCATATATTTATT P74G Forward CAAAAGTCTTGGCGGACAAAATGAGGACTTGGTAC Reverse CATTTTGTCCGCCAAGACTTTTGAATACTT TCAAGTGC Q76G Forward CTTCCCGGAGGAAATGAGGACTTGGTACTTACTG Reverse CCTCATTTCCTCCGGGAAGACTTTTGAATA ... Mutation Direction Sequence Standard All Forward GCTCAGGCGACCATGGGCCATCATCATC Reverse CTTGCATGCCCTGCAGGTCG Mutagenic L73G Forward GTATTCAAAAGTGGTCCCGGACAAAATGAG GACTTG Reverse TCCGGGACCACTTTTGAATACTTTCAAGTGCATATATTTATT P74G ... CCTCATTTCCTCCGGGAAGACTTTTGAATA C N77G Forward CGGACAAGGTGAGGACTTGGTACTTACTGGATAC Reverse CAAGTCCTCACCTTGTCCGGGAAGACTTTTG Ó FEBS 2002 Second protease-binding loop of cystatin A (Eur. J. Biochem....

Ngày tải lên: 17/03/2014, 10:20

... 27. [Greek: Ta adunata para anthropois dunata para to Theo estin.] Mark x. 27. [Greek: Para anthropois adunaton, all' ou para Theo; punta gar dunata para to Theo]. Matt. xix. 26. [Greek: Para anthropois ... apokathistanei panta, kai pos gegraptai epi ton uion tou anthropou, hina polla pathae kai exoudenaethae. Alla lego humin hoti kai Aelias elaeluthen kai epoiaesan auto hosa aethelon, kathos gegraptai ep' ... Aelias aedae aelthen kai ouk epegnosan auton, alla epoiaesan auto hosa aethelaesan, [outos kai ho uios tou anthropou mellei paschein hup' auton.] Tote sunaekan oi mathaetai hoti peri Ioannou...

Ngày tải lên: 17/03/2014, 15:20

... C-terminal residues of the GluR- A are visible, and align as an antiparallel b-strand in the binding groove of SAP97 PDZ2 . The free carboxylate group and the aliphatic side chain of the C-terminal ... six b-strands (bAtobF) and two a- helices (aA and aB) (Fig. 4). The structure of the C378G variant of SAP97 PDZ2 was practically identical to that of C378S variant, except for the mutated residue, and ... present study, the use of microplate assay with immobilized PDZ domains to analyze the interaction revealed that the PDZ1 domain is also active, albeit less so than PDZ2. The ability of SAP97 PDZ1 to...

Ngày tải lên: 30/03/2014, 10:20

Ngày tải lên: 20/06/2014, 21:20

Ngày tải lên: 22/07/2014, 14:00

Ngày tải lên: 11/08/2012, 21:54

... the reporter can arrange his material in the descending order of importance details for the second paragraph and save less important details for succeeding paragraph. The least important part ... include the capacity to be a journalist. 3.2.1 Language skills Language is certainly the main components of the core skills of a translator. When doing news story translation, the translator is required ... reasons and aims to write the thesis. This part includes the aims, scopes, methods and design of the study. Part B is the main part of the study that consists of three chapters below • Chapter...

Ngày tải lên: 02/09/2012, 11:12

... to the teaching of second and foreign languages that emphasizes interaction as both the means and the ultimate goal of learning a language. It is also referred to as “Communicative approach ... children are better than adults at acquiring a second language. It is also often claimed that there is a critical period for second language acquisition ends around puberty or even earlier. g. ... tenses. Vocabulary: the student has a range of vocabulary that corresponds to the syllabus year list and uses words you have taught the student uses a wide range of vocabulary. Pronunciation: When the...

Ngày tải lên: 07/11/2012, 15:01

Ngày tải lên: 07/09/2013, 13:06

Ngày tải lên: 27/09/2013, 21:58

Ngày tải lên: 26/11/2013, 13:17

Ngày tải lên: 26/11/2013, 13:19