a pragmaticbased approach to understanding

... Journal of Circadian Rhythms BioMed Central Open Access Research A new approach to understanding the impact of circadian disruption on human health Mark S Rea*, Andrew Bierman, Mariana G Figueiro ... nocturnal species are used almost exclusively as animal models in this research, a method needs to be established to relate actual circadian light and dark exposures in humans to parametrically ... circadian disruption is to be studied with any degree of accuracy, it is important to quantitatively characterize light and dark as it affects the human circadian system because the light-dark pattern

Ngày tải lên: 10/08/2014, 09:20

... Coughlan, P and P Duff (1994) Same task, different activity: analysis of a SLA task from an activity theory perspective In Vygotskyian Approaches to Second Language Research J.P Lantolf and G Appel ... Metagocnitive Instruction: An Approach to Teaching German as a Foreign Language to At-risk Students Frankfurt am Main, Germany: Peter Lang Schneider, E and L Ganschow (2000) Dynamic assessment and ... concept-based approach to teaching Spanish grammar In Spanish Second Language Acquisition: State of the Art R Salaberry and R Lafford (Eds.) Washington, DC: Georgetown University Press Newman, D.,

Ngày tải lên: 09/02/2018, 11:05

... the foam pad applied to the impactor For the validation model used in this research, the impactor, nor the pad were utilized A load applied to a premeasured area on the skull that equated to the ... Dissertations by an authorized administrator of ODU Digital Commons For more information, please contact digitalcommons@odu.edu A SCIENTIFIC APPROACH TO UNDERSTANDING THE HEAD TRAUMA ENDURED BY A ... experimental data provided by the National Geographic on impact loads of various MMA striking techniques applied to the already validated geometry and FEA model to obtain the resulting pressure that

Ngày tải lên: 23/10/2022, 09:38

... reading level 9th grade reading level (RL); 10th grade reading level (TC) Data and statistics No data/statistics About brand awareness of VERB national campaign (RL) Branding & contact information ... agencies played any role in the design, data collection, analysis, interpretation, or reporting of data from this study Availability of data and materials All data generated or analyzed during ...  Societal Policies, facilities, and interventions of larger political and geographic locations that affect the health and behavior of the at-risk population Legislation that limits tobacco sales to

Ngày tải lên: 29/11/2022, 11:14

... blockchain-based identity management systems are an emerging area that should be watched and carefully evaluated as a potential but not guaranteed breakthrough for digital identity and data ownership ... additions, and supported this work This includes NIST staff and associates Dylan Yaga, Frederic De Vaulx, Angela Robinson, and Katya Delak Additional thanks to all the people and organizations who ... systems allow one to provision identities to users while managing authentication, authorization, and data sharing within organizations and on the web With traditional identity management, organizations

Ngày tải lên: 13/03/2024, 00:22

... attitudinal measures have an advantage over behavioral measures (e.g repeat patronage) in that they can provide greater understanding of the factors associated with the development and modification ... to another is relatively easy to Service quality has a strong impact on customer loyalty in both banks and travel agents Reliability and responsiveness are particularly important to bank customers, ... 83-95 Parasuraman, A. , Berry, L.L and Zeithaml, V .A (1991), ``Refinement and reassessment of the SERVQUAL scale'', Journal of Retailing, Vol 67 No 4, pp 420-50 Parasuraman, A. , Zeithaml, V .A and

Ngày tải lên: 24/09/2016, 18:03

... variables) and assessed their loadings on a latent factor of generalized prejudice Negative affect toward Americans was assessed with two items Participants were asked to indicate how favorable ... from Americans and 54% of the variance in anger toward Americans In addition, 69% of the variance in perceptions of value threat from Americans and 46% of the variance in disgust toward Americans ... translated into Arabic by Zogby International and back-translated into English by a different group at Zogby to ensure equivalence of meaning across the original and back-translated surveys All measures

Ngày tải lên: 13/10/2022, 14:50

... National Laboratory, Aiken, South Carolina 29808, USA Email: Tanya Soule - tanya.soule@srnl.doe.gov; Kendra Palmer - kendra.harris@asu.edu; Qunjie Gao - gao.qunjie@asu.edu; Ruth M Potrafka - ruth.potrafka@asu.edu; ... others had been preliminarily annotated For example, NpR1276 is annotated in GenBank as an acetolactate synthase, which is a thiamine pyrophosphate (TPP)-requiring enzyme Functionally, acetolactate ... Central Open Access Research article A comparative genomics approach to understanding the biosynthesis of the sunscreen scytonemin in cyanobacteria Tanya Soule†1,2, Kendra Palmer†1, Qunjie Gao1,

Ngày tải lên: 01/11/2022, 08:29

... Cataloging-in-Publication Data Fulwiler, Toby, 1942– College writing : a personal approach to academic writing / Toby Fulwiler.—3rd ed. p. cm. Includes index. ISBN 0-86709-523-7 (acid-free paper) 1. English language—Rhetoric. ... include, what to omit, and the list goes on. There are, however, some things you can do to simplify this choice- making process and make it less daunting, more approachable. Whenever you sit down to ... One A WRITER’S CHOICES The reason, I think, I wait until the night before the paper is due, is that then I don’t have any choice and the prob- lem goes away. I mean, I stop thinking about all

Ngày tải lên: 18/12/2013, 17:33

... including marital rape and sexual abuse, and against violence towards women and girls as a human rights violation; and for programmes to encourage and enable men to adopt safe and ... sexual health is difficult to arrive at because human sexuality is varied, diverse and dynamic ICPD addressed sexual health as a notion that “implies a positive approach to ... and Prevention Project APHA American Public Health Association APPROPOP/PF Appui au Programme de Population/Planification Familiale ARH/SH Adolescent Reproductive Health and Sexual

Ngày tải lên: 05/03/2014, 16:20

... principal investigators are Harry ie and Margaret Harrell. Com- ments are welcome and may be addressed to Harry ie at harry_thie @rand.org and to Margaret Harrell at margaret_harrell@rand.org. For ... the Factor Analysis Procedure 42 3.7 Rotated Factors and Variable Loadings 43 3.8 Means and Standard Deviations of Rotated Factor Scores, by JDAL Category 46 xv xvi A Strategic Approach ... Monica, Calif.: RAND Corporation, MG-306-OSD, 2005. 2 Harry J. ie, Margaret C. Harrell, Sheila Nataraj Kirby, Al Crego, Roland J. Yardley, and Sonia Nagda, Framing a Strategic Approach for

Ngày tải lên: 06/03/2014, 21:20

... ATGATGAAACGGTTCAAT TTAGTTACCGTGTGCTTC CTGCTGCTCGCAGCAAGT GTGTGATCTGCAACTGTT CACCGAGGAATAATAAATGATG AAACGGTTCAATTTC TTAGTTACCGTGTGCTTC CACCGAGGAATAATAAATGATG AACGCACAAAAATCA TTACATTTTCACTTTAGT OMCA-PBAD-R ... name Sequence (5¢- to 3¢) OMCA-KO-F OMCA-KO-R OMCB-KO-F OMCB-KO-R OMCA-F OMCA-R OMCB-F OMCB-R OMCA-PBAD-F CACACTGCAACCTCTGGT ACTGTCAATAGTGAAGGT CCCCATGTCGCCTTTAGT TCGCTAGAACACATTGAC ATGATGAAACGGTTCAAT ... omcA– mutant, and omcA (lane 7), omcB (lane 8), mtrA (lane 9) and mtrB (lane 10) in the omcB– mutant MR-1R was used as a positive control to display omcA (lane 1) and omcB (lane 6) DNA standards

Ngày tải lên: 07/03/2014, 09:20

... Ex- tractor tool. 3 Or ˘ asan et al. (2000) enhanced the preference-based anaphora resolution algorithms by using a GA to find an optimal set of values for the outcomes of 14 indicators and apply ... language- independent as long as it does not perform any morphological analysis. with on a daily basis (Filippova et al., 2009), as- sist in the automated classification and filtering of documents, and increase search ... methods in automatic extracting. ACM, 16(2). G. Erkan and D. R. Radev. 2004. Lexrank: Graph- based lexical centrality as salience in text summa- rization. Journal of Artificial Intelligence Research, 22:457–479. K.

Ngày tải lên: 07/03/2014, 22:20

... similar.) The approach has been applied in an illustrative way to calculate an overall index for Costa Rica over a period of years Other approaches to measuring sustainability based ... the last word on this new field. On the contrary, it deliber- ately proposes bold ideas to spark dialogue on which data to compile and how to massage a mass of facts into a handful of meaningful ... in statistical or graphical form, they are distinct from statistics or primary data. Indeed, indicators and highly aggregated indices top an information pyra- mid whose base is primary data derived

Ngày tải lên: 15/03/2014, 16:20

... the Rubaiyat is re- garded in the nature of a miracle. For the general case, it would seem that characterizing a sample of the translator’s art as a good translation is akin to charac- terizing ... considering a word- to- word conversion as a translation. A true translation is unattainable, even by the human agent, let alone by mechanical means. However, a crude practical translation is probably ... [ Mechanical Translation , Vol.6, November 1961] A New Approach to the Mechanical Syntactic Analysis of Russian by Ida Rhodes*, National Bureau of Standards This paper categorically rejects

Ngày tải lên: 16/03/2014, 19:20

... In FOCS, pages 154–165. R. Fagin, B. Kimelfeld, Y. Li, S. Raghavan, and S. Vaithyanathan. 2010. Understanding queries in a search database system. In PODS, pages 273–284. Google. 2010. A Java API for ... that domain. In future work, we plan to explore how to utilize additional domain knowledge to better estimate the correlation between words. Particularly, from avail- able auxiliary data (Fagin ... information (Kernighan et al., 1990; Schierle et al., 2007; Mitton, 2010). As a sim- ple example, if we want to avoid maintaining a manually-crafted dictionary to accommodate the wealth of new terms

Ngày tải lên: 17/03/2014, 00:20

... statistical verb lexicon In EMNLP Jan Hajiˇ , Massimiliano Ciaramita, Richard Johansc son, Daisuke Kawahara, Maria Ant` nia Mart´, Llu´s o ı ı M` rquez, Adam Meyers, Joakim Nivre, Sebastian a ˇe a Pad´ ... cross-lingual semantic role annotation In ACL Dekai Wu and Pascale Fung 2009 Semantic roles for SMT: A hybrid two-pass model In NAACL Dekai Wu, Marianna Apidianaki, Marine Carpuat, and Lucia Specia, ... parameter T is chosen empirically Empirical Evaluation 7.1 Data and Evaluation We keep the general setup of (Lang and Lapata, 201 1a) , to evaluate our models and compare them to the current state

Ngày tải lên: 17/03/2014, 22:20

... elektrostaattisen attraktion vaikutusta. Märän paperin lujuuden parantuminen korkeassa pH:ssa adsorboidun kitosaanin ansiosta yhdistettiin selluloosapintojen välisen adheesion kasvuun kitosaanin ... experimental data had indicated that plasticization by water was essential in regard to tensile properties of polysaccharide materials Paper. .. there is a crucial process stage in regard to ... Yhdistelmäväitöskirja (yhteenveto + erillisartikkelit) Tiedekunta Kemian ja materiaalitieteiden tiedekunta Laitos Puunjalostustekniikan laitos Tutkimusala Puunjalostuksen kemia Vastaväittäjä(t)

Ngày tải lên: 18/03/2014, 02:20

... in IS's fragment for the terms with which they are associated in IS's plan. 191 A PRAGMATIC~BASED APPROACH TO UNDERSTANDING INTERS~NTENTIAL ~LIPSI~ Sandra Car berry Department ... Obtaln-Informatlon on the discourse stack activates the rule DG-Obtaln-In/'o. Pl an- analy sl s is activated to associate the elliptical fragment with an aspect of I$'s task- related ... underlying a speaker's utterance. Allen views the speaker's utterance as part of a plan which the speaker has constructed and is executlug to accomplish his overall task-related goals. To...

Ngày tải lên: 21/02/2014, 20:20

... of variation and bias in relation to monitoring of animal disease incidence on herd and national level, causal analysis on national level, as well as estimation of validated treatment criteria. Monitoring ... into potential errors (bias and random error) related to data based on clinical examina- Acta Veterinaria Scandinavica 2009, 51:36 http://www.actavetscand.com/content/51/1/36 Page 8 of 10 (page ... metritis' that relate to the quality of the data that are produced. We analyse and build &apos ;a model of understanding& apos; based on DBL's observations and the indi- vidual veterinarians'...

Ngày tải lên: 25/10/2012, 10:45