a behavioral approach to law

... proposing a systematic frame- work for a behavioral approach to economic analysis of law, and using be- havioral insights to develop specific models and approaches addressing top- 1. See, e.g. , Mark ... state of antitrust law, or the use of market-based regulation in environmental law (to name just two of many examples),... WITHOUT LAW (1991) May 1998] BEHAVIORAL APPROACH TO LAW ... behavior of human agents insofar as that behavior is relevant to law. Our topics here include bargaining behavior and the effects of mandatory contract terms. Part III shifts to an explanation

Ngày tải lên: 07/07/2014, 18:21

... propose a new approach to law and economics that is rooted in game theory and rectifies the flaw It is argued that this approach can open up new areas of research and be marshalled to address some ... similar to a monarch announcing a new law 46 12 Concluding Remarks The focus of this paper was law and economics, but it has a larger ambition Much of the paper argued that the traditional approach ... circumvent the law or to escape harassment by bureaucrats In this, there is a second layer of fall back in India (as in most countries) There are laws and there are laws that say that you cannot circumvent

Ngày tải lên: 23/04/2016, 05:04

... existing social order Each approach. .. Chapter 4 10 A Foucauldian Approach to International Law This lack of a viable framework comparable to a domestic one is rather frustrating ... international relations as a source of inspiration and explication... define a society 20 Carty (1991) 16 A Foucauldian Approach to International Law Another approach, albeit somewhat mirroring ... developing a sound normative system of international law An important approach to international law has been an inter-disciplinary consideration, turning specifically to international

Ngày tải lên: 30/03/2014, 10:20

... cognitive and behavioral emotion regulation training with an intensive longitudinal experiment Important moderators and mediators will be taken into account to asses why and for whom which approach ... voice”) rather than cognitions The second step of the chain is to practice behavioral emotion regulation strategies (behavioral distraction, behavioral relaxation and time out) Adolescents practice ... there are six behavioral strategies (adaptive strategies: relaxation, behavioral distraction, social support; maladaptive strategies: direct expression, indirect expression, avoidance), and six

Ngày tải lên: 10/01/2020, 14:11

... Digital Commons It has been accepted for inclusion in Santa Clara Law Review by an authorized editor of Santa Clara Law Digital Commons For more information, please contact sculawlibrarian@gmail.com, ... Santa Clara L Rev 369 (2019) Available at: https://digitalcommons .law. scu.edu/lawreview/vol59/iss2/2 This Article is brought to you for free and open access by the Journals at Santa Clara Law ... distorted thinking that often accompanies a bad day on call, or a bad grade, for that matter In addition, mindfulness meditation aligns well with cognitive behavioral therapy’s approach to treating

Ngày tải lên: 23/10/2022, 13:21

... Cataloging-in-Publication Data Fulwiler, Toby, 1942– College writing : a personal approach to academic writing / Toby Fulwiler.—3rd ed. p. cm. Includes index. ISBN 0-86709-523-7 (acid-free paper) 1. English language—Rhetoric. ... include, what to omit, and the list goes on. There are, however, some things you can do to simplify this choice- making process and make it less daunting, more approachable. Whenever you sit down to ... One A WRITER’S CHOICES The reason, I think, I wait until the night before the paper is due, is that then I don’t have any choice and the prob- lem goes away. I mean, I stop thinking about all

Ngày tải lên: 18/12/2013, 17:33

... including marital rape and sexual abuse, and against violence towards women and girls as a human rights violation; and for programmes to encourage and enable men to adopt safe and ... sexual health is difficult to arrive at because human sexuality is varied, diverse and dynamic ICPD addressed sexual health as a notion that “implies a positive approach to ... and Prevention Project APHA American Public Health Association APPROPOP/PF Appui au Programme de Population/Planification Familiale ARH/SH Adolescent Reproductive Health and Sexual

Ngày tải lên: 05/03/2014, 16:20

... principal investigators are Harry ie and Margaret Harrell. Com- ments are welcome and may be addressed to Harry ie at harry_thie @rand.org and to Margaret Harrell at margaret_harrell@rand.org. For ... the Factor Analysis Procedure 42 3.7 Rotated Factors and Variable Loadings 43 3.8 Means and Standard Deviations of Rotated Factor Scores, by JDAL Category 46 xv xvi A Strategic Approach ... Monica, Calif.: RAND Corporation, MG-306-OSD, 2005. 2 Harry J. ie, Margaret C. Harrell, Sheila Nataraj Kirby, Al Crego, Roland J. Yardley, and Sonia Nagda, Framing a Strategic Approach for

Ngày tải lên: 06/03/2014, 21:20

... ATGATGAAACGGTTCAAT TTAGTTACCGTGTGCTTC CTGCTGCTCGCAGCAAGT GTGTGATCTGCAACTGTT CACCGAGGAATAATAAATGATG AAACGGTTCAATTTC TTAGTTACCGTGTGCTTC CACCGAGGAATAATAAATGATG AACGCACAAAAATCA TTACATTTTCACTTTAGT OMCA-PBAD-R ... name Sequence (5¢- to 3¢) OMCA-KO-F OMCA-KO-R OMCB-KO-F OMCB-KO-R OMCA-F OMCA-R OMCB-F OMCB-R OMCA-PBAD-F CACACTGCAACCTCTGGT ACTGTCAATAGTGAAGGT CCCCATGTCGCCTTTAGT TCGCTAGAACACATTGAC ATGATGAAACGGTTCAAT ... omcA– mutant, and omcA (lane 7), omcB (lane 8), mtrA (lane 9) and mtrB (lane 10) in the omcB– mutant MR-1R was used as a positive control to display omcA (lane 1) and omcB (lane 6) DNA standards

Ngày tải lên: 07/03/2014, 09:20

... Ex- tractor tool. 3 Or ˘ asan et al. (2000) enhanced the preference-based anaphora resolution algorithms by using a GA to find an optimal set of values for the outcomes of 14 indicators and apply ... language- independent as long as it does not perform any morphological analysis. with on a daily basis (Filippova et al., 2009), as- sist in the automated classification and filtering of documents, and increase search ... methods in automatic extracting. ACM, 16(2). G. Erkan and D. R. Radev. 2004. Lexrank: Graph- based lexical centrality as salience in text summa- rization. Journal of Artificial Intelligence Research, 22:457–479. K.

Ngày tải lên: 07/03/2014, 22:20

... similar.) The approach has been applied in an illustrative way to calculate an overall index for Costa Rica over a period of years Other approaches to measuring sustainability based ... the last word on this new field. On the contrary, it deliber- ately proposes bold ideas to spark dialogue on which data to compile and how to massage a mass of facts into a handful of meaningful ... in statistical or graphical form, they are distinct from statistics or primary data. Indeed, indicators and highly aggregated indices top an information pyra- mid whose base is primary data derived

Ngày tải lên: 15/03/2014, 16:20

... the Rubaiyat is re- garded in the nature of a miracle. For the general case, it would seem that characterizing a sample of the translator’s art as a good translation is akin to charac- terizing ... considering a word- to- word conversion as a translation. A true translation is unattainable, even by the human agent, let alone by mechanical means. However, a crude practical translation is probably ... [ Mechanical Translation , Vol.6, November 1961] A New Approach to the Mechanical Syntactic Analysis of Russian by Ida Rhodes*, National Bureau of Standards This paper categorically rejects

Ngày tải lên: 16/03/2014, 19:20

... information (Kernighan et al., 1990; Schierle et al., 2007; Mitton, 2010). As a sim- ple example, if we want to avoid maintaining a manually-crafted dictionary to accommodate the wealth of new terms ... that domain. In future work, we plan to explore how to utilize additional domain knowledge to better estimate the correlation between words. Particularly, from avail- able auxiliary data (Fagin ... In FOCS, pages 154–165. R. Fagin, B. Kimelfeld, Y. Li, S. Raghavan, and S. Vaithyanathan. 2010. Understanding queries in a search database system. In PODS, pages 273–284. Google. 2010. A Java API for

Ngày tải lên: 17/03/2014, 00:20

... statistical verb lexicon In EMNLP Jan Hajiˇ , Massimiliano Ciaramita, Richard Johansc son, Daisuke Kawahara, Maria Ant` nia Mart´, Llu´s o ı ı M` rquez, Adam Meyers, Joakim Nivre, Sebastian a ˇe a Pad´ ... cross-lingual semantic role annotation In ACL Dekai Wu and Pascale Fung 2009 Semantic roles for SMT: A hybrid two-pass model In NAACL Dekai Wu, Marianna Apidianaki, Marine Carpuat, and Lucia Specia, ... parameter T is chosen empirically Empirical Evaluation 7.1 Data and Evaluation We keep the general setup of (Lang and Lapata, 201 1a) , to evaluate our models and compare them to the current state

Ngày tải lên: 17/03/2014, 22:20

... elektrostaattisen attraktion vaikutusta. Märän paperin lujuuden parantuminen korkeassa pH:ssa adsorboidun kitosaanin ansiosta yhdistettiin selluloosapintojen välisen adheesion kasvuun kitosaanin ... experimental data had indicated that plasticization by water was essential in regard to tensile properties of polysaccharide materials Paper. .. there is a crucial process stage in regard to ... Yhdistelmäväitöskirja (yhteenveto + erillisartikkelit) Tiedekunta Kemian ja materiaalitieteiden tiedekunta Laitos Puunjalostustekniikan laitos Tutkimusala Puunjalostuksen kemia Vastaväittäjä(t)

Ngày tải lên: 18/03/2014, 02:20

... program, taking care of such tasks as transferring command-line arguments (see Chapter 5) to main and main’s return value back to the operating system We are finally ready to treat program ... Program There is no faster way to crash a program than to make a mistake with memory (Actually, this statement overstates the case: a program need not crash immediately after an erroneous ... chapter covers both for two reasons First, manipulating... the addresses are the particular values that they are later Each cell is annotated with its associated variable and the type of that

Ngày tải lên: 19/03/2014, 14:05

... and place in a hat and let each student draw an audience out of a hat Each now write a paragraph to the audience drawn making the information relevant to that particular audience (Results ... read and evaluated by playing... words to have the force of law, writing makes a permanent record to be reread and studied in your absence And if you want to maintain a certain tone ... or relate it to an issue with which you are already familiar Modifying a writing task into something both interesting and manageable dramatically increases your chances of making the writing

Ngày tải lên: 20/03/2014, 10:20

... a top-down approach to graphing attacks which allows a more systemic analysis The cost or 11 A N ANALYSIS 12 OF E - BANKING VULNERABILITIES difficulty of attacks can also be propagated ... eBay Toolbar [64] is mainly aimed at preventing phishing of eBay and PayPal, the two main eBay brands These are both targets of a lot of phishing attacks, due to their market share The eBay ... VoIP and war-dialling techniques an... the same as a low per-attack cost Some attackers may not be able to ever afford the initial outlay (particularly if it is not cost, but 2.4 ATTACK TREES

Ngày tải lên: 23/03/2014, 03:20

... of variation and bias in relation to monitoring of animal disease incidence on herd and national level, causal analysis on national level, as well as estimation of validated treatment criteria. Monitoring ... into potential errors (bias and random error) related to data based on clinical examina- Acta Veterinaria Scandinavica 2009, 51:36 http://www.actavetscand.com/content/51/1/36 Page 8 of 10 (page ... metritis' that relate to the quality of the data that are produced. We analyse and build &apos ;a model of understanding' based on DBL's observations and the indi- vidual veterinarians'...

Ngày tải lên: 25/10/2012, 10:45

... Feyn- man soon learned that there was a great obstacle to this delayed action-at -a- distance theory: namely, if a radiating electron, say in an atom or an antenna, were not acted upon at all by ... is determined by saying her whole space-time path has a certain character. For the action [with advanced and retarded terms] the equations are no longer at all easy to get back into Hamil- tonian form. ... example, the transformation may be a rotation). The trans- formation is to contain a parameter, a, and is to be a continuous function of a. Fora equal to zero, the transformation should reduce to the...

Ngày tải lên: 06/11/2012, 11:21