a nice hot bath

... dịch tạo kết t a tan Ba(OH)2 d dung dịch AlCl3 Còn lại tợng xảy NaCl: Ba(OH)2 + AlCl3 = BaCl2 + Al(OH)3 Al(OH)3 + Ba(OH)2 = Ba(AlO2)2 + H2O 3/ 2,5 đ: Căn vào tính chất nêu ta biết: A H 2; B CO; ... BaCO3 BaO + CO2 Rồi hoà tan sản phẩm sau nung vào nớc chất tan BaO => chất đầu BaCO3: BaO + H2O Ba(OH)2 Chất không tan MgO => chất đầu MgCO3 - Lấy Ba(OH)2 thu đợc cho vào hai chất tan NaCl AlCl3 ... thời có kết t a trắng Bình tạo kết t a , d Ba kết t a tan dần đến hết Phơng trình hoá học: Ba + H2O = Ba(OH)2 + H2 Ba(OH)2 + Na2CO3 = BaCO3 + NaOH Ba(OH)2 + CuSO4 = Cu(OH)2 + BaSO4 Ba(OH)2 + (NH4)2SO4...

Ngày tải lên: 30/09/2013, 06:10

... sensible and approachable way The authors use a case example to illuminate fundamental concepts in a manner that is both compelling and readable A definite addition to the personnel management ... employed by any type of organization As such, training and development services that incorporate the SDI are available from many individual consultants and large consulting organizations The capacity ... 10:37am Chapter collapsed in his chair and stared at the wall It wasn’t lost on him that a promotion to regional sales manager would surely have meant an office with a window For now, he had a wall...

Ngày tải lên: 29/05/2014, 16:41

... Comoros Guatemala Namibia Senegal Sao Tome and Principe Tajikistan Malawi Madagascar Kenya South Africa Eritrea Lesotho Nicaragua Cameroon Guinea Burkina Faso West Bank Colombia 35 Yemen Rank Country ... 56 Sudan Mauritania Kyrgyzstan Ethiopia Venezuela El Salvador Benin Papua New Guinea Mongolia Mali Tanzania Afghanistan Uganda Ukraine Lebanon Belarus Micronesia, Federated States of Armenia Moldova ... 105 Bhutan Sri Lanka Algeria Anguilla Guam Bulgaria Slovakia Uruguay Greece Egypt Spain Estonia United Arab Emirates Bermuda 19 Primary Care at a Glance – Hot Topics and New Insights Rank Country...

Ngày tải lên: 27/06/2014, 09:20

... Wilkins Agent This is a nice flat, Miss Wilkins Here's a plan Miss Wilkins Hmm Agent There's a living-room There's a kitchen, a bedroom, a bathroom, and there's a toilet Miss Wilkins Is there a balcony? ... there's a cooker and a fridge There are some cupboards under the sink Miss Wilkins Are there any plates? Agent Yes, there are Miss Wilkins Good Are there any chairs in here? Agent No, there aren't, ... dining/'dainiɳrum/ room phòng khách lounge /laʊndʒ/ n lớn phòng (từ hall /hɔːl/ n c a vào) chỗ trống landing /ˈlæn.dɪŋ/ n chân cầu thang downstairs /ˌdaʊnˈsteəz/ adv nhà upstairs /ʌpˈsteəz/ adv lầu lamp...

Ngày tải lên: 12/07/2014, 03:20

... Y Mầu sắc cu a dd X và Y lần lượt là: A Màu da cam và vàng chanh B Mầu vàng chanh và da cam C Mầu nâu đỏ và vàng chanh D Mầu vàng chanh và nâu đỏ HO A HỌC 12 THPT ĐỒNG ĐĂNG ... tạo thành đicromat ( màu da cam) hãy cho biết thêm - Khi thêm bazơaxit, thì cân bằng chuyển dịch theo chiều thuận, vào bazơ vào cân tạo thành cromat (bằngvàngthì cân bằng màu ... ta mạ Crom lên sắt và dùng chế tạo thép không gỉ Crom có độ hoạt động ho a học kém Zn và Tác dụng với axit tại người ta lại mạ Crom mạnh Fe, lên sắt và dùng chế tạo...

Ngày tải lên: 16/07/2014, 08:00

... SSYT, is a tabloid P such that the entries are weakly increasing along rows and strictly increasing along columns A reverse semistandard Young tableau of shape λ/µ is a tabloid R such that the ... all entries of T The content weight wc (T ) of a tabloid T is ρ∈λ/µ Tρ · (a + c(ρ)), where a is a given integer such that a + c(ρ) > for all cells ρ ∈ λ/µ A semistandard Young tableau of shape ... would have to be replaced by y c z ∗ But this cannot happen, because then y would have to be strictly smaller than z It can be shown in a very similar manner that ⇐ indeed produces a SSYT We leave...

Ngày tải lên: 07/08/2014, 06:23

... Checking: Look at these activities and match the pictures Play tennis b a Jog c Play badminton d Do aerobics e Skip rope f Play table tennis II Dialogue Đat: What is he doing? Tai: He is listening ... day, February ,2009 th SPORTS AND PASTIMES Lesson – A. 1-2 (P.124 -125) A What are they doing ? Thursday,February 28th, 2008 Unit 12: Lesson Vocabulary: - (to) jog : - (to) play badminton: ... Đat: What are they doing? Tai: They are swimming III Grammar Hỏi xem người làm việc gì, trả lời S1: What + be + S + doing ? S2: S + be + V-ing…… IV Practice IV Practice Ex1: Tìm s a lỗi câu sau:...

Ngày tải lên: 23/04/2015, 19:00

... • De la gomme • Un bisou en chocolat • Un sachet de thé • • • • • • • • a pair of glass an elastic a sticking plaster a pencil an eraser some soft linen threat a chocolate kiss a tea bag Vous ... about) La GOMME… pour se rappeler que chacun de no commet des erreurs et que nous avons l’occasion de les effacer The ERASER, to remind us that we all mistakes and that most of the time we can erase ... kiss and sweet words Et finalement le SACHET DE THÉ… pour qu’à la fin de la journée l’on puisse se reposer, se relaxer et réfléchir… And finally, the TEA BAG so that at the end of the day we can...

Ngày tải lên: 21/12/2015, 09:03

... young man (1-2) a large wooden table (1-5) (một niên cao lớn) (một bàn lớn gỗ) Big blue eyes (1-3) an old Russian song (2-4) (đôi mắt xanh to) (một hát Nga cổ) a small black plastic bag (1-3-5) an ... v.v…) A large round table a tall thin girl (một bàn tròn lớn) (một cô gái cao gầy) a long narrow street (một đường dài hẹp) Chúng ta dùng tính từ sau số động từ, đặc biệt động từ be/ get/become Are ... từ (“ A nice new house”) (B a cơm tối toả mùi thơm quá) - Tom sounded angry when I spoke to him on the phone (Giọng Tom giận nói chuyện qua điện thoại với anh ta) This tea tastes a bit strange...

Ngày tải lên: 14/01/2016, 16:02

Ngày tải lên: 13/06/2013, 01:26

... nhau, ®ã tam gi¸c OMN lµ tam gi¸c vu«ng O Bµi 4: tø gi¸c ACMO cã D M ∠CAO = ∠CMO = 90 => tø gi¸c ACMO néi tiÕp C O E A ®êng trßn ®êng kÝnh OC B Tam giác AEC tam giác BED c ó : góc E chung ∠EAC ... = ∠EBD = 90 ⇒ ∆AEC đồng dạng với ∆BED (g-g) CE DE => CA = DB m CA = CM ; DB = DM V ậy CE DE = CM DM hay DM CM = DE CE Tam giác vuông AOC c ó : AC = R.tg α R tgα R Rtgα tgα = R Tam giác vuông ... Parabol (P) hai điểm phân biệt M(x1 ; x12) ; N(x22) Phương trình đường thẳng OM là: y = x1.x Phương trình đường thẳng ON là: y = x2.x T ích hai hệ số góc hai đường thẳng lµ: x1.x2 = -1 Vậy hai...

Ngày tải lên: 29/08/2013, 12:11

... the the Asian Games They agreed to form the Asian Athletic Federation A passage preparatory was set up to draft the charter for the Asian amateur athletic carefully federation In February, 1949, ... children may be more an American ideal than an American reality Of course, the so-called traditional American family was always more varied than we had been led to believe, reflecting the very - Ask ... the Asian athletic federation was formed and used and the name Asian Games Federation It was formed and used the name Asian choose Games Federation It was decided to hold the first Asian Games...

Ngày tải lên: 17/09/2013, 21:10

... is a small bamboo forest at the entrance big old banyan tree to the village Liz had a snack atunder the of Ba’s uncle the house banyan tree There is a shrine on the mountain near Ba’s village ... the chance to travel between the green paddy fields and cross a small bamboo forest before they reach a big old banyan tree at the entrance to the village Liz met Ba's family at his house early ... your village again some day," Liz told Ba "You'll always be welcome here, Liz," Ba replied 2.TRUE OR FALSE? Ba and his family had a two-day trip to their a day home village Many people like...

Ngày tải lên: 29/09/2013, 21:10

... CaCO3 NaOH) Phơng trình chữ: 1) TN1: Kali pemanganat Kali manganat + Mangan oxit + Oxi 2) TN2: Canxi Hiđroxit + Cacbonic Canxi cacbonat + nớc Canxi Hiđroxit + Natri cacbonat Canxi cacbonat ... tìm: Al2(SO4)3 BG: a) CT chung: NaxOy -> Ta lấy x = b = : y = a = -> Na2S b) Fe(OH)3 c) Ca3(PO4)2 d) SO3 IV Luyện tập củng cố: HS thảo luận nhóm làm 3: Hãy cho biết CT sau hay sai? Hãy s a lại ... a cách lập CT nhanh - Nếu a = b x = y = - Nếu a b tỉ lệ a : b (tối giản) x=b;y =a - Nếu a : b cha tối giản giản ớc để có a, : b, lấy x = b, ; y = a, Ví dụ 3: Lập CT h/c gồm: a) Na (I) S (II) b)...

Ngày tải lên: 30/09/2013, 05:10

... now unable to exit from the hand blocked tap outlet, will instead flow across to the hot water pipe causing a backflow in the hot water system, clearing the airlock Note: If you have a similarly ... find another tap and having to use a long hose which may, anyway, not fit the shape of some taps Simpler than playing around with washing machine hoses Procedure: 1)Squeeze the single mixer tap ... A Further method was sent in by a user, Dave Maynard: When needing to pass mains cold water pressure across to air locked hot water supply using kitchen mixer taps: Easier than trying...

Ngày tải lên: 17/12/2013, 10:45

... Actinobacteria Aquificae Proteobacteria Proteobacteria Proteobacteria Proteobacteria Proteobacteria Proteobacteria Proteobacteria Proteobacteria Proteobacteria Proteobacteria Proteobacteria Proteobacteria ... Tsa family protein Transketolase Translation elongation factor Tu ATP synthase F1, a- subunit Fig Genomic orientation (A) , nucleotide and amino acid sequence (B) of MCA0715 (A) MCA0715 is located ... termophilum Aquifex aeolicus Magnetospirillum gryphiswaldense Burkholderia mallei Burkholderia pseudomallei Janthinobacterium sp J3 Ralstonia solanacearum Pseudomonas aeruginosa Pseudomonas resinovorans...

Ngày tải lên: 07/03/2014, 17:20

... he had to go to work, and how relieved he was tofind out that he had beenable to avoid it, and how peaceful he felt right now Then, slowly, withoutopening his eyes, Johnnysuddenly became aware ... right now Then, slowly, withoutopening his eyes, Johnnysuddenly became aware that he was floating through the clouds again ...

Ngày tải lên: 21/03/2014, 22:08

... R GGCAACGAGCAAGGTCCGAAG AAGTCGTTGCAATCGGCGTCG GGCAACGAGCAAGGTCCGAAG GACGTCGTGAGTGCCTCCGTG CGACGTGCAGTATTACTTTTCTAGGG AGTATCAAACCGTGCTGGTCTCC Bioinformatic analyses Sequence similarity searches ... membrane The extracellular localization is in accordance with the prediction of a signal peptide in a primary translation product Bioinformatical analyses revealed that SACCP shares characteristics ... processing would lead to a mature protein of 732 amino acids with a theoretical molecular mass of 78 kDa A search in the PROSITE database of protein families and domains [12] with MCA2590 revealed two...

Ngày tải lên: 23/03/2014, 11:20

... Boracay Philippines Khu nghỉ dưỡng Boracay điểm đến sôi động Philippines, thu hút hàng ngàn du khách nước m a du lịch đến Nổi tiếng giới, đảo Boracay nằm Aklan đảo nhỏ xinh đẹp bao quanh rặng san ... rặng san hô sặc sỡ Pantai Chenang Malaysia Đây đ a điểm du lịch phổ biến Langkawi Nơi nằm gần sân bay cách 25km từ thị trấn Kuah Bãi biển có bờ cát trắng kéo dài đến 3km, cảnh quan vô đẹp nhiều điểm ... tiếng với trung tâm mua sắm sầm uất, sống đêm sôi động phương tiện giao thông thuận tiện Sanur Indonesia Bãi biển Sanur tiếng nằm bờ biển ph a nam bán đảo Bali, phần nhỏ Kuta thuộc phần vị trí...

Ngày tải lên: 02/04/2014, 01:20

... claims made after the bath is fitted will not be accepted by the manufacturer To add stiffness, most moulded plastic baths have a baseboard bonded underneath and a wooden frame bonded beneath ... Also, cut through the old bath overflow If the bath has been sealed against the wall with flexible sealant, cut through this with a craft knife Pull the bath out from the walls If the bath has ... compression joints, or plastic pipes that are usually connected with push-fit joints Adapter couplings are available to join pipes of different materials and sizes Always follow tap manufacturers' instructions...

Ngày tải lên: 14/04/2014, 11:31