a new born sense of dignity and freedom
Five Year Strategic Plan (2011-2016) - Towards a New Dawn Ministry of Women and Child Development Government of India potx
Ngày tải lên :
23/03/2014, 06:20
... 223 ABBREVIATIONS ANM Auxiliary Nurse Midwife ASHA Accredited Social Health Activist AWCs Anganwadi Centres AWW Anganwadi Worker AWH Anganwadi Helper BDO Block Development Officer CARA Central Adoption ... of the Government, namely, National Rural Health Mission (NRHM), Sarva Shiksha Abhiyan (SSA), Total Sanitation Campaign (TSC) and Mahatma Gandhi National Rural Employment Guarantee Scheme (MGNREGS) ... Shortage of staff and office space groups acting as watchdogs and advocating for rights of women and children Lack of induction, orientation and refresher training for staff Web based portal containing...
- 223
- 354
- 0
Tài liệu Báo cáo khoa học: Mammalian mitotic centromere-associated kinesin (MCAK) A new molecular target of sulfoquinovosylacylglycerols novel antitumor and immunosuppressive agents pptx
Ngày tải lên :
19/02/2014, 17:20
... diacylglycerols of sea urchin Transplantation 74, 261–267 Mizushina Y, Watanabe I, Ohta K, Takemura M, Sahara H, Takahashi N, Gasa S, Sugawara F, Matsukage A, Yoshida S & Sakaguchi K (1998) Studies ... fragrans J Nat Prod 60, 387–389 Sahara H, Hanashima S, Yamazaki T, Takahashi S, Sugawara F, Ohtani S, Ishikawa M, Mizushina Y, Ohta K, Shimozawa K, et al (2002) Anti-tumor effect of chemically ... Gigartina tenella Chem Pharm Bull (Tokyo) 46, 684– 686 Ohta K, Mizushina Y, Hirata N, Takemura M, Sugawara F, Matsukage A, Yoshida S & Sakaguchi K (1999) Action of a new mammalian DNA polymerase...
- 9
- 891
- 0
REINCARNATION AND THE LAW OF KARMA A STUDY OF THE OLD-NEW WORLD-DOCTRINE OF REBIRTH, AND SPIRITUAL CAUSE AND EFFECT potx
Ngày tải lên :
06/03/2014, 13:20
... Reincarnation and Karma, which are accepted as fundamental and axiomic truths beyond the need of proof, and beyond doubt—as a writer has said: "The idea of Reincarnation has become so firmly fixed and ... round—having successively incarnated as a savage, a barbarian, a semi-civilized man, a native of India, Egypt, Chaldea, Rome, Greece, and many other lands, in different ages, filling all kinds of ... and the real intelligence The practical teachings of the school of Patanjali is a system by which the Purusha may escape from and overcome the Prakriti, and thus gain emancipation, freedom, and...
- 125
- 648
- 0
Báo cáo khoa học: A new pathway encompassing calpain 3 and its newly identified substrate cardiac ankyrin repeat protein is involved in the regulation of the nuclear factor-jB pathway in skeletal muscle pdf
Ngày tải lên :
29/03/2014, 21:20
... CGCCATGGCAATGATGGTACTGAAAGTAGAGG CGGCCCGGGAACTGATTAAGAGTCTGTCG GAGCCATGGAACAACGGAAAAGCGAGAAAC CGGCCCGGGAACTGATTAAGAGTCTGTCG CACCATGATGGTACTGAGAG GAATGTAGCTATGCGAGAGTTC CACCATGGCCGAGTTCAGAAATGGAGAAG ... CACCATGGCCGAGTTCAGAAATGGAGAAG GAATGTAGCTATGCGAGAGTTC CACCATGCTGAAGACACTTCCGGCCAACAG GAATGTAGCTATGCGAGAGTTC CACCATGCTGAAAGCTGCGCTGGAGAAC GAATGTAGCTATGCGAGAGTTC CACCATGACCAAAGTTCCAGTTGTGAAGG GAATGTAGCTATGCGAGAGTTC CACCATGATGGTACTGAGAG ... TCAGAGTTCCCTACCGAAGCAG mMurf1.F AGGGCCATTGACTTTGGGAC mMurf1.P AGGAGG AGTTTACAGAAGAGGAGGCTGATGAG mMurf1.R CTCTGTGGTCACGCCCTCTT mP0.F CTCCAAGCAGATGCAGCAGA mP0.P CCGTGGTGCTGATGGGCAAGAA mP0.R ATAGCCTTGCGCATCATGGT...
- 16
- 462
- 0
Báo cáo hóa học: " Widespread distribution and a new recombinant species of Brazilian virus associated with cotton blue disease" pot
Ngày tải lên :
20/06/2014, 01:20
... Piracicaba – SP Piracicaba – SP Piracicaba – SP Piracicaba – SP Brasília – DF Brasília – DF Acreuna – GO Presidente Olegário -MG Holambra – SP Primavera Leste – MT Primavera Leste – MT Primavera Leste ... Location1 Cotton sp Cultivar Isolate Date Symptom2 Nested PCR Cascavel – PR Cascavel – PR Cascavel – PR Cascavel – PR Cascavel – PR Sta Helena de Goiás – GO Piracicaba – SP Piracicaba – SP Piracicaba ... typical typical typical typical typical typical typical typical typical typical typical typical typical typical atypical typical typical atypical typical typical atypical typical + + + + + + + + + +...
- 13
- 386
- 0
báo cáo hóa học:" Tuberculosis and HIVNeeded: A New Paradigm for the Control and Management of Linked Epidemics" pot
Ngày tải lên :
20/06/2014, 08:20
... clinical and virologic outcomes in patients with both TB and HIV disease in need of treatA Common TB and HIV Paradigm An Alternative TB and HIV Paradigm Collaboration of Programs National TB Program ... have the authority to oversee increased collaboration and integration of TB and HIV programs and services at both national and local levels New Ways of Delivering Integrated Care With Nontraditional ... 196:S63-S75 Abstract Gasana M, Vandebriel G, Kabanda G, et al.: Tuberculosis in Rwanda: challenges to reaching the targets Bull WHO 2007, 85:383-384 International epidemiologic databases to evaluate AIDS:...
- 5
- 469
- 0
Báo cáo hóa học: " Research Article A New Method for Least-Squares and Minimax Group-Delay Error Design of Allpass Variable Fractional-Delay Digital Filters" pdf
Ngày tải lên :
21/06/2014, 07:20
... using a a fractional delay filters, Doctoral thesis, Helsinki University of Technology, Espoo, Finland, 1995 [15] M Makundi, T I Laakso, and V V¨ lim¨ ki, “Efficient tunable a a IIR and allpass filter ... design of allpass variable fractional-delay digital filters,” IEEE Transactions on Circuits and Systems I, vol 53, no 2, pp 358–371, 2006 [22] H Hacihabiboˇ lu, B G¨ nel, and A M Kondoz, “Analysis of ... the phase approximation, that is, the phase of (7) arg H e jω , p = −Nω − arg A e jω , p where p is the parameter used to adjust fractional delay and N denotes the order of the designed allpass...
- 10
- 490
- 0
báo cáo hóa học:" Research Article A New Technique for the Digitization and Restoration of Deteriorated Photographic Negatives" pptx
Ngày tải lên :
21/06/2014, 20:20
... 125–135, 1997 E Prados, F Camilli, and O Faugeras, A unifying and rigorous shape from shading method adapted to realistic data and applications,” Journal of Mathematical Imaging and Vision, vol ... conservation can continue and no changes are made that are irreversible If the results from a digital approach are not acceptable, the more challenging and expensive physical approach can still be applied ... that methodology by assembling a cost-effective scanning system comprised of a laptop to emulate a smart light-table and a camera to observe illumination changes in the scene The area of material...
- 13
- 569
- 0
báo cáo khoa học: " Characterization of cp3 reveals a new bri1 allele, bri1-120, and the importance of the LRR domain of BRI1 mediating BR signaling" doc
Ngày tải lên :
11/08/2014, 11:21
... we added 20 μM of IAA, GA, kinetin, and ACC and 50 μM of JA to 1/2 MS MS plates and processed them the same way All of the chemicals were purchased from Duchefa Biochemie except IAA (Sigma Aldrich) ... bri1 mutant alleles are dispersed in both an extracellular domain and a cytoplasmic kinase domain [4,16] The extracellular domain of BRI1 consists of LRRs and a 70-amino acid island containing unique ... (forward) and 5’-ccggagaaattgttgaagctgagatctaacg-3’ (reverse) All of the resulting plasmids were fully sequenced to confirm the presence of the intended changes and the absence of other alterations...
- 11
- 389
- 0
Báo cáo y học: " Response of a simian immunodeficiency virus (SIVmac251) to raltegravir: a basis for a new treatment for simian AIDS and an animal model for studying lentiviral persistence during antiretroviral therapy" pptx
Ngày tải lên :
12/08/2014, 23:23
... Animals, as well as according to animal care standards deemed acceptable by the Association for the Assessment and Accreditation of Laboratory Animal Care International (AAALAC) All experiments were ... 5’ GGCACTATTGGAGCTAAGAC 3’ (reverse primer), SIV-P 6FAM-AGATTTGGATTAGCAGAAAGCCTGTTGGA-TAMRA (TaqMan probe) The signal was finally compared to a standard curve of known concentrations from 107 ... housed at BIOQUAL, Inc Rockville, MD, according to standards and guidelines as set forth in the Animal Welfare Act and The Guide for the Care and Use of Page 14 of 19 Laboratory Animals, as well as...
- 19
- 317
- 0
PURIFICATION AND CATALYTIC REFORMING OF METHANE a NEW INSIGHT INTO CARBON ADSORBENT AND MEIC MEMBRANE REACTOR
Ngày tải lên :
09/09/2015, 10:13
... distribution of the AC_CAC47, AC_ALC47, AC_HEC47 and AC_MEC47 samples calculated by the NLDFT method 51 Figure 3.6 FT-IR spectra of carbonaceous substances of AC_MEC40, AC_ALC40, AC_HEC40 and AC_CAC40 ... AC40_TPA5p and AC40_BZA5p samples 78 Figure 4.10 Pore size distributions of AC47_TPA1p, AC47_TPA3p, AC47_TPA5p and AC47_BZA5p samples 80 Figure 4.11 FT-IR spectra of AC40_PMA1p, AC40_PMA3p, AC40_PMA5p ... adsorbents applied for many aspects, such as removal of color and odor, purification of waste water, and stripping of gaseous pollutants They can be prepared from any carbonaceous material by carbonization...
- 188
- 374
- 0
A study on prepositions of direction and some errors made by vietnamese learners
Ngày tải lên :
11/12/2013, 23:53
... was critical and demanding and yet very caring and supportive along the way I also wish to send many thanks to the Dean of Foreign Language Department of Hai Phong Private University, Ms Tran ... either an object or an adverbial modifier In addition, preposition may also show the relation of a whole clause to a verb or an adjective, the clause is an adjective clause and a noun, the clause ... relation of a whole clause to: +) a verb or an adjective; the clause is an adjective clause: He thought of how important her advice was She was surprised at what you said He was questioned about what...
- 55
- 1K
- 3
Tài liệu USB in a Nutshell - Making Sense of the USB Standard ppt
Ngày tải lên :
13/12/2013, 00:15
... of transaction to follow, data packets contain the payload, handshake packets are used for acknowledging data or reporting errors and start of frame packets indicate the start of a new frame Token ... being made The bmRequestType is normally parsed and execution is branched to a number of handlers such as a Standard Device request handler, a Standard Interface request handler, a Standard Endpoint ... exact amount of data requested, transferred a packet less than the maximum endpoint size of transferred a zero-length packet IN DATA x ACK STALL NAK OUT DATA x ACK NAK STALL Token Phase Data...
- 30
- 745
- 0
Tài liệu Báo cáo " A new natural source of Camphor from Cinnamomum longepetiolatum Costerm. apud Phamh. in Vietnam " doc
Ngày tải lên :
12/02/2014, 17:20
... phytochemical works have been recorded for the C longepetiolatum Costerm apud Phamh found in Vietnam As a part of the research on the essential oils of Medicinal and Aromatic plants of the Vietnam flora, ... Preparation Flora of China Vol (Berberidaceae through Capparaceae) Science Press, Beijing, and Missouri Botanical Garden Press, St Louis [3] Vietnamese Pharmacopoeia, Medical Publishing House, Hanoi, ... G.W .A Milne, EPA/NIH Mass Spectral Data Base, U.S Government Printing Office, Washington D.C., 1978, 1980, 1983 [5] E Stenhagen, A Abrahamsson, F.W McLafferty, Registry of Mass Spectral Data,...
- 4
- 403
- 0
Báo cáo "A NEW NUMERICAL INVARIANT OF ARTINIAN MODULES OVER NOETHERIAN LOCAL RINGS " pptx
Ngày tải lên :
05/03/2014, 14:20
... R (A/ y1 A) n1 t A) R (A/ m n1 R (A/ (x1 A t + AnnR A) A) n1 R (A/ y1 A) = tI(y(n); A) Assume that d > and our assertion is true for all Artinian R-module of N-dimension smaller than d Lemma 3.5 allow ... Note that for each element a ∈ R and each element x ∈ A, we can see that ax and ax are the same, where a is the image of a by the canonical homomorphism R −→ R On the other hand, when we regard ... References Auslander, M and Buchsbaum, D .A, Codimension and multiplicity, Ann of Math 68(1958), 625-657 Brodmann, M.P and Sharp, R.Y, Local cohomology: an algebraic introduction with geometric applications,...
- 11
- 324
- 0
A New Vision for Adolescent Sexual and Reproductive Health pot
Ngày tải lên :
05/03/2014, 17:20
... adults, both at home and in other social institutions such as health care and education, conceptualize and approach adolescent sexuality Dutch and U.S Parents and Teenagers A qualitative interview ... sexual behavior, use of contraception, and use of abortion An important reason that European youth have better sexual health outcomes is that adults approach teenage sexuality differently than adults ... nations and across gender at around age 17 In Europe, age at first intercourse among rich and poor teens has also become similar Today, despite similar rates of sexual involvement, European teens are...
- 7
- 662
- 0
Báo cáo khoa học: Dissociation/association properties of a dodecameric cyclomaltodextrinase Effects of pH and salt concentration on the oligomeric state pot
Ngày tải lên :
07/03/2014, 12:20
... mutant, 5Â-TCTGCTGCAGCA GGGTGTT GAGAAGCGCTGGATG-3Â (forward) and 5Â-CATCCAG CGCTTCTCAACACCCT GCTGCAGCAGA-3Â (reverse); for the H539V mutant, 5Â-CGACAAGGCGGGCGTC ACGTTA ACGCTGCCTGTCC-3Â (forward) ... His89 to 118 Val89, and His539 to Val539 using the following primers: for the H49V mutant, 5Â-AGTACATGTGGGACGTCAC CATGGAGTATGTCCC-3Â (forward) and 5Â-GGGACAT ACTC CATGGTGACGTCCCACATGTACT-3Â (reverse); ... dissociation of dodecameric CDase I-5, sedimentation equilibrium 110 Fig Apparent molecular mass of CDase I-5 at various pH values determined by analytical ultracentrifugation analysis analysis was performed...
- 13
- 511
- 0
CROSSED SWORDS A Canadian-American Tale of Love and Valor docx
Ngày tải lên :
08/03/2014, 18:20
... single-handed against a sovereignty which reached back over a line of a hundred kings, and was hoary with the traditions of a thousand years of valor From every casement, door and garden-wall along ... by Daniel Morgan, a Virginian, of a famous family of Indian fighters A hero in buckskin and a giant in stature, he had won a name for bravery and daring unequalled by any in the great woods of ... savage sense of honor, and enlist him in the cause Everything being ready, as well as haste and circumstances permitted, with as little appearance of unusual preparation as possible, shortly after...
- 156
- 383
- 0
Đề tài " Higher composition laws I: A new view on Gauss composition, and quadratic generalizations " docx
Ngày tải lên :
14/03/2014, 22:20
... by 2 ( 2a1 − 3a0 a1 a2 + a0 a3 − ε a0 ), 2 (a1 a2 − 2a0 a2 + a0 a1 a3 − ε a1 ), − (a1 a2 − 2a2 a3 + a0 a2 a3 + ε a2 ), 2 − 3a a a + a a2 + ε a ), − ( 2a2 3 c0 = c1 = c2 = c3 = where as usual ε = ... of discriminant D This interpretation of the space of × × cubes then specializes to give the narrow class group in Gauss’s case and in the cases of pairs of binary quadratic forms and pairs of ... nondegenerate oriented quadratic ring and M is an equivalence class of balanced ideals of S having rank Under this bijection, the discriminant of a senary alternating 3-form is equal to the discriminant...
- 35
- 430
- 0